snOPY snoRNA Orthological Gene Database

Family: SNORD25

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300032 ----AACAGTGATGAGT-CAGTT--TACAGACCTGTAATGATTGCGGTAA A_thaliana300033 ----AACAGTGATGAGT-CAGTT--TACAGACCTGTAATGATTGCGGTAA C_elegans300120 -----TGGGCGGTGAAA-TTGTT-GCACAGACCTGTTCCTATTAGT-TCA C_familiaris300100 --CTCTCTGTGATGAGA-ACCTT-TCACAGACCTGTACTGATCT---CCG D_novemcinctus300099 --CTCCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGAGCC---CCG D_melanogaster300048 ---CTTCTCTGATGA---TCTTTTACACAGACCTGTACTGAGCT----CA E_europaeus300186 -ATTCTCTGTGATGAGA-ATCTTATCATAGACTTGTATCGAGAT---CCA E_europaeus300242 -GTTCTCTGTGATGAGA-ATCTTATCATAGACCTGTACCGAGAT---CCA E_europaeus300418 -TCTCTCAGTGATGAGG-ATCTTATCACAGACCTGTACCGAGAT---CCA F_catus300032 --CTCTCTGTGATGAGA-ACCTTTTCACAGACCTGTACTGAGCT---CCG H_sapiens300169 ---TTCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGAGCT---CCG M_mulatta300220 --CTCCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGAGCT---CCG M_murinus300395 --CCTCCTATGATGAGG-ACCTTGTCACAGACCTGTACTGAGTT---CCG M_musculus300709 -ACCCCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGATATAT-CTG O_garnettii300570 -TCTGGCTATGATGAGG-ACTTTTTCACAGACCTGTACTGATCT---CCA P_troglodytes300396 -GTTCCCTATGGTGAGG-ACATTTTCACAGGCTTGCACTGAGCT---CTA P_troglodytes300463 --CTTCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGAGCT---CCG P_pygmaeus300536 --CTTCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGAGCT---CCG R_norvegicus300380 -ATGCCCTATGATGAGG-ACCTTTTCACAGACCTGTACTGATCT---CTG S_cerevisiae300046 TTAACATGATGAAAAAATATATTAACACAGACCTGTACTGAACTTTTCGA S_araneus300242 -CTTCCCCGTGATGAGA-CGGTTTTCACAGACCTGTACTGAGTT---CCG S_tridecemlineatus300198 --CTCCCAGTGATGAGG-ACATTTTCACAGACCTGTACTGAACT---CCG T_nigroviridis300123 ----CTCGATGATGATA---ATTCTCACAGACCTGTACTGAAAACTGTGA * * ** * ** * ** * A_thaliana300032 TGATCGCATTATTATGAACATCTAAGGGACTGAGT---- A_thaliana300033 TGATCGCATTATTATGAACATCTAAGGGACTGAGT---- C_elegans300120 CTG--AGGAAAATAG---CAATCATGAGCCT-------- C_familiaris300100 TGA--GGATAAAAAAAA-CTCTGAGGAG----------- D_novemcinctus300099 TGA--GGATAAGTAA---CTCTGAGGAGAC--------- D_melanogaster300048 TAACCGTGCAGAAAATTGTAAACTGAAA----------- E_europaeus300186 TGA--GGATAAAACA---CTCTGAGGAGAC--------- E_europaeus300242 TGA--GGATAAGACA---CTCTGAGGAAAA--------- E_europaeus300418 TGA--GGATAAGACA---CTCTGAGGAGAC--------- F_catus300032 TGA--GGATAAGACA---CTCTGAAGAGAC--------- H_sapiens300169 TGA--GGATAAATAA---CTCTGAGGAGA---------- M_mulatta300220 TGA--GGATAAGTGA---CTCTGAGGAGAT--------- M_murinus300395 TGA--GGATAAGTAA---CTCTGAGGAGAC--------- M_musculus300709 TGA--GGATAAGTAA---CTCTGAGGAGGC--------- O_garnettii300570 TGA--GGATAAGTAA---CTCTGAGGAGAC--------- P_troglodytes300396 TGA--GCATAAGTAA---TTCTGAGGAAAT--------- P_troglodytes300463 TGA--GGATAAGTAA---CTCTGAGGAGAT--------- P_pygmaeus300536 TGA--GGATAAGTAC---CTCTGAGGAGAT--------- R_norvegicus300380 TGA--GGATAAGTAA---CTCTGAGGAGGC--------- S_cerevisiae300046 AGTT-TTGCAGATAACAATATTGCTTTTTTTCTCTGACT S_araneus300242 TGA--GGATGGAAAG---CTCTGAGGAGAT--------- S_tridecemlineatus300198 TGA--GGATAAGTAA---CTCTGAGGAGAC--------- T_nigroviridis300123 -----TTGCAACTATTAAATCTGATG-------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved