snOPY snoRNA Orthological Gene Database

Family: SNORD25

CLUSTAL W (1.83) multiple sequence alignment A_tauschii300011 ---GGCAACAGTGATGAGTT---CTTACAG------ACCTGTAATGATTC A_tauschii300012 ---CGTGACGGTGATGAGCC---TTTACAG------ACCTGTAATGATTC A_tauschii300013 -AATGACTCAATGA-GAGTT---TTAGCAG------ACTTGTAATTATTC A_tauschii300018 ---GGCAACAGTGACGAGTT---CTTACAG------ACCTATAATGATTC A_tauschii300019 ----GCGAAGGTGATGAACC---TTTGCAG------ACCTGTAATGATTC A_tauschii300020 TCATGAAACGATGA-G--TT---CTAGCAG------ACCAGTAATGATTC A_tauschii300032 ---GACAACCGTGATGAGCCAATTTTACAGTTACCGACCTGTAATGACTC A_thaliana300032 ------AACAGTGATGAGTCAG-TTTACAG------ACCTGTAATGATT- A_thaliana300033 ------AACAGTGATGAGTCAG-TTTACAG------ACCTGTAATGATT- C_elegans300120 -------TGGGCGGTGAAA-TTGTT-GCACA----GACCTGTTCCTATTA C_familiaris300100 ----CTCTCTGTGATGAGA-ACCTT-TCACA----GACCTGTACTGATCT D_novemcinctus300099 ----CTCCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGAGCC D_melanogaster300048 -----CTTCTCTGATGATCT---TTTACACA----GACCTGTACTGA--- E_europaeus300186 ---ATTCTCTGTGATGAGA-ATCTTATCATA----GACTTGTATCGAGAT E_europaeus300242 ---GTTCTCTGTGATGAGA-ATCTTATCATA----GACCTGTACCGAGAT E_europaeus300418 ---TCTCTCAGTGATGAGG-ATCTTATCACA----GACCTGTACCGAGAT F_catus300032 ----CTCTCTGTGATGAGA-ACCTTTTCACA----GACCTGTACTGAGCT H_sapiens300169 -----TTCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGAGCT M_mulatta300220 ----CTCCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGAGCT M_murinus300395 ----CCTCCTATGATGAGG-ACCTTGTCACA----GACCTGTACTGAGTT M_musculus300709 ---ACCCCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGATAT O_garnettii300570 ---TCTGGCTATGATGAGG-ACTTTTTCACA----GACCTGTACTGATCT P_troglodytes300396 ---GTTCCCTATGGTGAGG-ACATTTTCACA----GGCTTGCACTGAGCT P_troglodytes300463 ----CTTCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGAGCT P_pygmaeus300536 ----CTTCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGAGCT R_norvegicus300380 ---ATGCCCTATGATGAGG-ACCTTTTCACA----GACCTGTACTGATCT S_cerevisiae300046 --TTAACATGATGAAAAAATATATTAACACA----GACCTGTACTGAACT S_araneus300242 ---CTTCCCCGTGATGAGA-CGGTTTTCACA----GACCTGTACTGAGTT S_tridecemlineatus300198 ----CTCCCAGTGATGAGG-ACATTTTCACA----GACCTGTACTGAACT T_nigroviridis300123 ------CTCGATGATGATA---ATTCTCACA----GACCTGTACTGAAAA * * ** * * A_tauschii300011 TTGCGGAAATGATCGCACAGTTCAGAGAACATCTAAGGGACTGAGTTGTT A_tauschii300012 TTGCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTCCTT A_tauschii300013 TTGCGGGAATAATCGGAAGATTCAAATCACATCCAAGGGATTGAGTTATA A_tauschii300018 TTGCGGAAATGATTGCACAGTTCAAAGAACATCTAAGGGACTGAGTTGTT A_tauschii300019 TTGCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACCGAGTCGGC A_tauschii300020 TTGCAGGAATGATCGCACGATTCAAAGAACATCTAAGGGACTGAGT-GTG A_tauschii300032 GTGCAGAAATAATCGCATGGTC-AAAGAACATCTAAGGGACTTATTTGTC A_thaliana300032 --GCGGTAATGATCGCATTATT--ATGAACATCTAAGGGACTGAGT---- A_thaliana300033 --GCGGTAATGATCGCATTATT--ATGAACATCTAAGGGACTGAGT---- C_elegans300120 GTTCACTGAGGAAAATAG--CAATCATGAGCCT----------------- C_familiaris300100 --CCGTGAGGATAAAAAAAACTCTGAGGAG-------------------- D_novemcinctus300099 --CCGTGAGGATAAGTAA--CTCTGAGGAGAC------------------ D_melanogaster300048 ----GCTCATAACCGTGCAGAAAATTGTAAACTGAAA------------- E_europaeus300186 --CCATGAGGATAAAACA--CTCTGAGGAGAC------------------ E_europaeus300242 --CCATGAGGATAAGACA--CTCTGAGGAAAA------------------ E_europaeus300418 --CCATGAGGATAAGACA--CTCTGAGGAGAC------------------ F_catus300032 --CCGTGAGGATAAGACA--CTCTGAAGAGAC------------------ H_sapiens300169 --CCGTGAGGATAAATAA--CTCTGAGGAGA------------------- M_mulatta300220 --CCGTGAGGATAAGTGA--CTCTGAGGAGAT------------------ M_murinus300395 --CCGTGAGGATAAGTAA--CTCTGAGGAGAC------------------ M_musculus300709 ATCTGTGAGGATAAGTAA--CTCTGAGGAGGC------------------ O_garnettii300570 --CCATGAGGATAAGTAA--CTCTGAGGAGAC------------------ P_troglodytes300396 --CTATGAGCATAAGTAA--TTCTGAGGAAAT------------------ P_troglodytes300463 --CCGTGAGGATAAGTAA--CTCTGAGGAGAT------------------ P_pygmaeus300536 --CCGTGAGGATAAGTAC--CTCTGAGGAGAT------------------ R_norvegicus300380 --CTGTGAGGATAAGTAA--CTCTGAGGAGGC------------------ S_cerevisiae300046 --TTTCGAAGTTTTGCAGATAACAATATTGCTTTTTTTCTCTGACT---- S_araneus300242 --CCGTGAGGATGGAAAG--CTCTGAGGAGAT------------------ S_tridecemlineatus300198 --CCGTGAGGATAAGTAA--CTCTGAGGAGAC------------------ T_nigroviridis300123 --CTGTGA----TTGCAACTATTAAATCTGATG----------------- A_tauschii300011 - A_tauschii300012 - A_tauschii300013 - A_tauschii300018 - A_tauschii300019 - A_tauschii300020 C A_tauschii300032 - A_thaliana300032 - A_thaliana300033 - C_elegans300120 - C_familiaris300100 - D_novemcinctus300099 - D_melanogaster300048 - E_europaeus300186 - E_europaeus300242 - E_europaeus300418 - F_catus300032 - H_sapiens300169 - M_mulatta300220 - M_murinus300395 - M_musculus300709 - O_garnettii300570 - P_troglodytes300396 - P_troglodytes300463 - P_pygmaeus300536 - R_norvegicus300380 - S_cerevisiae300046 - S_araneus300242 - S_tridecemlineatus300198 - T_nigroviridis300123 -

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved