snOPY snoRNA Orthological Gene Database

Family: SNORD25

CLUSTAL W (1.83) multiple sequence alignment A_tauschii300011 -GGCAACAGTGATGAG---------TTCTTACAGACCTGTAATGATTCTT A_tauschii300012 -CGTGACGGTGATGAG---------CCTTTACAGACCTGTAATGATTCTT A_tauschii300013 -AATGACT-CAATGAGA-------GTTTTAGCAGACTTGTAATTATTCTT A_tauschii300018 -GGCAACAGTGACGAG---------TTCTTACAGACCTATAATGATTCTT A_tauschii300019 --GCGAAGGTGATGAA---------CCTTTGCAGACCTGTAATGATTCTT A_tauschii300020 TCATGAAA-CGATGAG---------TTCTAGCAGACCAGTAATGATTCTT A_tauschii300032 -GACAACCGTGATGAGCCAATTTTACAGTTACCGACCTGTAATGACTCGT A_tauschii300132 -GACAGCTGTGATGAGCCCATTTTACAGTTACAGACCTGTAATGACTCCT A_tauschii300226 -GACAACCGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCT A_tauschii300492 -GACAACTGTGATGAGCCAATTTTGCAGTTACAGACCTGTAATGACTCCT A_tauschii300400 -GACAACCGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCT A_tauschii300391 -GACAACTGTGATGAGCCCATTTTACAGTTACAGACCTGTAATGACTCCT A_tauschii300374 -GACAACTGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCT A_thaliana300032 ----AACAGTGATGAGT-------CAGTTTACAGACCTGTAATGATT--- A_thaliana300033 ----AACAGTGATGAGT-------CAGTTTACAGACCTGTAATGATT--- C_elegans300120 -----TGGGCGGTGA-A-----ATTGTTGCACAGACCTGTTCCTATTAGT C_familiaris300100 --CTCTCTGTGATGA-G-----AACCTTTCACAGACCTGTACTGAT---C D_novemcinctus300099 --CTCCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCC-- D_melanogaster300048 ---CTTCTCTGATGATCT-------TTTACACAGACCTGTACTGAGCTCA E_europaeus300186 -ATTCTCTGTGATGAGA-----ATCTTATCATAGACTTGTATCGAGAT-- E_europaeus300242 -GTTCTCTGTGATGAGA-----ATCTTATCATAGACCTGTACCGAGAT-- E_europaeus300418 -TCTCTCAGTGATGAGG-----ATCTTATCACAGACCTGTACCGAGAT-- F_catus300032 --CTCTCTGTGATGAGA-----ACCTTTTCACAGACCTGTACTGAGCT-- G_gorilla301037 --CTTCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCT-- H_sapiens300169 ---TTCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCT-- M_mulatta300220 --CTCCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCT-- M_murinus300395 --CCTCCTATGATGAGG-----ACCTTGTCACAGACCTGTACTGAGTT-- M_musculus300709 -ACCCCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGATATAT O_sativa300116 -GGCAACAGTGATGAG---------TCCTTACAGACCTGTAATGATTCTT O_sativa300117 -TGTGGCAGTGATGAG---------CCCTAACAGACCTGTAATGATTCTT O_sativa300118 -TTTGACGGTGATTAG---------CCCTAACAGACCTGTAATGATTCTT O_sativa300119 -CATGGCGGTCTTGAG---------CCCTAACAGACCTGAAATAATTATT O_sativa300003 -AGCAACGGTGATGAG----------TCCTACAGACCTGTAATGACTCCT O_garnettii300570 -TCTGGCTATGATGAGG-----ACTTTTTCACAGACCTGTACTGATCT-- P_troglodytes300463 --CTTCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCT-- P_troglodytes300396 -GTTCCCTATGGTGAGG-----ACATTTTCACAGGCTTGCACTGAGCT-- P_pygmaeus300536 --CTTCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGAGCT-- R_norvegicus300380 -ATGCCCTATGATGAGG-----ACCTTTTCACAGACCTGTACTGATCT-- S_cerevisiae300046 TTAACATGATGAAAAAAT----ATATTAACACAGACCTGTACTGAACTTT S_araneus300242 -CTTCCCCGTGATGAGA-----CGGTTTTCACAGACCTGTACTGAGTT-- S_tridecemlineatus300198 --CTCCCAGTGATGAGG-----ACATTTTCACAGACCTGTACTGAACT-- T_nigroviridis300123 ----CTCGATGATGATA-------ATTCTCACAGACCTGTACTGAAAACT T_aestivum300012 -GACAACTGTGATGAGCCCATTTTACAGTTACAGACCTGTAATGACTCCT T_aestivum300013 -GACAACTGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCT T_aestivum300015 -GACAACCGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCT T_aestivum300103 -GGCAACAGTGATGAG---------TTCTTACAGACCTGTAATGATTCTT T_aestivum300104 -CGTGACGGTGATGAG---------CCTTTACAGACCTGTAATGATTCTT T_aestivum300105 -GGCAACAGTGACGAG---------TTCTTACAGACCTATAATGATTCTT T_aestivum300106 --GCGAAGGTGATGAA---------CCTTTGCAGACCTGTAATGATTCTT T_aestivum300107 TCATGAAA-CGATGAG---------TTCTAGCAGACCAGTAATGATTCTT T_aestivum301270 -AATGACT-CAATGAGA-------GTTTTAGCAGACTTGTAATTATTCTT * * * * A_tauschii300011 GCGGAAATGATCGCACAGTTCAGAGAACATCTAAGGGACTGAGTTGTT- A_tauschii300012 GCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTCCTT- A_tauschii300013 GCGGGAATAATCGGAAGATTCAAATCACATCCAAGGGATTGAGTTATA- A_tauschii300018 GCGGAAATGATTGCACAGTTCAAAGAACATCTAAGGGACTGAGTTGTT- A_tauschii300019 GCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACCGAGTCGGC- A_tauschii300020 GCAGGAATGATCGCACGATTCAAAGAACATCTAAGGGACTGAGT-GTGC A_tauschii300032 GCAGAAATAATCGCATGGT-CAAAGAACATCTAAGGGACTTATTTGTC- A_tauschii300132 GTGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTT- A_tauschii300226 GCGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- A_tauschii300492 GCGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- A_tauschii300400 GTGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- A_tauschii300391 GTGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- A_tauschii300374 GCGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- A_thaliana300032 GCGGTAATGATCGCATTATT--ATGAACATCTAAGGGACTGAGT----- A_thaliana300033 GCGGTAATGATCGCATTATT--ATGAACATCTAAGGGACTGAGT----- C_elegans300120 TCACTG--AGGAAAATAGCAATCATGAGCCT------------------ C_familiaris300100 TCCGTG--AGGATAAAAAAAACTCTGAGGAG------------------ D_novemcinctus300099 CCGTGA--GGATAAGTAACTCTGAGGAGAC------------------- D_melanogaster300048 TAACCGTGCAGAAAATTGTAAACTGAAA--------------------- E_europaeus300186 CCATGA--GGATAAAACACTCTGAGGAGAC------------------- E_europaeus300242 CCATGA--GGATAAGACACTCTGAGGAAAA------------------- E_europaeus300418 CCATGA--GGATAAGACACTCTGAGGAGAC------------------- F_catus300032 CCGTGA--GGATAAGACACTCTGAAGAGAC------------------- G_gorilla301037 CCGTGA--GGATAAGTAACTCTGAGGAGAT------------------- H_sapiens300169 CCGTGA--GGATAAATAACTCTGAGGAGA-------------------- M_mulatta300220 CCGTGA--GGATAAGTGACTCTGAGGAGAT------------------- M_murinus300395 CCGTGA--GGATAAGTAACTCTGAGGAGAC------------------- M_musculus300709 CTGTGA--GGATAAGTAACTCTGAGGAGGC------------------- O_sativa300116 GCGGGAATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTTATC- O_sativa300117 GTGTATATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTTGTC- O_sativa300118 GCGGATACGATCGCTTGAT-CAAAGAACATCTAAGGGACTGAGTAATA- O_sativa300119 GCGGATATGATTGCTTAATTCAGAGCACATCTAAGGGACTGAGTTGCC- O_sativa300003 GCGGAGATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- O_garnettii300570 CCATGA--GGATAAGTAACTCTGAGGAGAC------------------- P_troglodytes300463 CCGTGA--GGATAAGTAACTCTGAGGAGAT------------------- P_troglodytes300396 CTATGA--GCATAAGTAATTCTGAGGAAAT------------------- P_pygmaeus300536 CCGTGA--GGATAAGTACCTCTGAGGAGAT------------------- R_norvegicus300380 CTGTGA--GGATAAGTAACTCTGAGGAGGC------------------- S_cerevisiae300046 TCGAAGTTTTGCAGATAACAATATTGCTTTTTTTCTCTGACT------- S_araneus300242 CCGTGA--GGATGGAAAGCTCTGAGGAGAT------------------- S_tridecemlineatus300198 CCGTGA--GGATAAGTAACTCTGAGGAGAC------------------- T_nigroviridis300123 GTGA----TTGCAACTATTAAATCTGATG-------------------- T_aestivum300012 GTGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- T_aestivum300013 GCGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- T_aestivum300015 GTGGAAATGATCGCATGGT-CAAAGAACATCTAAGGGACTGAGTTGTC- T_aestivum300103 GCGGAAATGATCGCACAGTTCAGAGAACATCTAAGGGACTGAGTTGTT- T_aestivum300104 GCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTCCTT- T_aestivum300105 GCGGAAATGATTGCACAGTTCAAAGAACATCTAAGGGACTGAGTTGTT- T_aestivum300106 GCGAGCATGATCGCTTGATTCAAAGAACATCTAAGGGACCGAGTCGGC- T_aestivum300107 GCAGGAATGATCGCACGATTCAAAGAACATCTAAGGGACTGAGT-GTGC T_aestivum301270 GCGGGAATAATCGGAAGATTCAAATCACATCCAAGGGATTGAGTTATA-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved