snOPY snoRNA Orthological Gene Database

Family: SNORD24

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300189 GTTGCCGTTCTTGCACTTTATACTGAAACCCTGCATTTAAAGAGATTCCGGCTAAGCGAG D_melanogaster300190 GCGGCATCGCTTGCAACTCAT--TGAATTCGTTTTTCTAATC-GAATAAAATGAAGTGAG * ** ****** * ** **** * * * *** ** * *** *** D_melanogaster300189 TGTGGCACAGAGAAAATCTTCCTTTGGAAAGTAGACTTTCAGACATAGTTGAGGCGACAT D_melanogaster300190 TGTTGCCAAGAGCAATACACCTTTTCGTATG-AGGCTTTCAGACATAGTTGAGGCGACAT *** ** **** ** * * *** * * * ** ************************* D_melanogaster300189 AACCCACGCCACGATTGTATCACTCAAAGTCTAATATCT D_melanogaster300190 AATCCACGCCACGATTGTATCACTCAAAGTCTTACAATT ** ***************************** * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved