snOPY snoRNA Orthological Gene Database

Family: SNORD24

CLUSTAL 2.0.10 multiple sequence alignment D_rerio300255 CAAAAGTGATGATACCAGAGAATGGTTTCGCAAATTTGAC-TGATGTCATGTGATGTTAT D_rerio300256 CAAAAATGATGATACCAGAGAATGGTTTCGCAAATTTGAC-TGATGTCATGTGATGTTAT D_rerio300257 CAAACATGATGATACCAGAGAATGGTTTCGCTAACTTGAC-TGATGTCATGTGATGTTAC D_rerio300258 CAAAAATGATGATACCAGAGAATGGTTTCGCTTGCATGAC-TGATTTCATGTGATGTCAC D_rerio300259 TGCACATGATGATACTGGAGAATGGTTTCGCTTTTATGACCTGATGTCATGTGATGATAC * ********* ************** **** **** ********** * D_rerio300255 GCTTCTCTTGGCTATCTGATTAA D_rerio300256 GCTTCTCTTGGCTATCTGATTAA D_rerio300257 ACTTCTCTTGGCTGTCTGATTTA D_rerio300258 GCTTCTCTTGGCTGTCTGATTAA D_rerio300259 TCTTCTCTTGGCTGTCTGATCTA ************ ****** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved