snOPY snoRNA Orthological Gene Database

Family: SNORD23

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300488 TGCCCAGTGATGATACCCATCCTTGCTCCCCGTGCCCCCC--GG---GCTGTGGGCGACA D_novemcinctus300508 TGTCCGGTGATGACATCTATCTTTGCTCTTCGTGCCTCTCAGG----GCCATGGGCGACA E_telfairi300811 TACCCGCTGATGAT-CCCATCCTTGCTCCCCAGGCCCTCCC-GG---GCAGTGGGCGACA E_caballus300087 TGCTCGAGGATGACACTCATCCTTGCTCCCCGTGCCC--CCAG--GGGCTGTGGGCGACA E_europaeus300643 TGCCCGGTGATGACACCCATCCTTGCTCCCCGTGCCCTCCCAGCAGGGCTTTGGGCGACA H_sapiens300142 TGTTTAATGACTAAG------GAAGGTCCCTGTCCCC-GCCAGG--GGCTGTGAGCAACA H_sapiens300562 TGCCCAGTGATGACA-CCATCCTTGCTCCCCGTGCCCCCCAGGG---GCTATGGGCGACA M_mulatta300279 TGTTTAATGATTAAG------GAAGGTCCCTGTCCCCAGCCAGG--GGCTGTGGGTAACA M_murinus300236 TGTTTAACGACTAGG------GAAGATTCTCGTGTCC-CCCAGA--GGCTGTGGGTGACA M_murinus300512 TGCCCGGTGATGACACCCATCCTTGCTCCCCGTGCCC-CCCAG--GGGCTGTGGGCGACA M_musculus300008 TGCCCAGTGATGATA-CCATCCTGGCTCCTTGTGCATTTTGAG----GCTGGGGATGACA M_musculus300746 TGCCCAGTGATGATAACCATCCTTGCTCCCCGTGCCTACTCGG----GCTGTGGGCGACA O_garnettii300100 TGCCCAGTGATGATACCCATCCTTGCTCCCCGTGCCTCCCAGGG---GCTGTGGGCGACA P_troglodytes300270 TGTTTAATGACTAAG------GAAGGTCCCTGTCCCC-CCCAGG--GGCTGTGAGCAACA P_troglodytes300605 TGCCCAGTGATGACA-CCATCCTTGCTCCCCGTGCCCCCCAGGG---GCTATGGGCGACA P_pygmaeus300043 TGTTTAATGACTAAG------GAAGGTCCGGGTCCCC-CCCAGG--GGCTGTGAGCAACA P_pygmaeus300661 TGCCCAGTGATGACA-CCATCCTTGCTCCCCGTGCCCCCCAGGG---GCTATGGGCGACA R_norvegicus301072 TGCCCGGTGATGATAACCATCCTTGCTCCCCGTGCCCTCTTGG----GCTGTGGGCGACA S_araneus300921 TGCCCGCTGATGACA-C-ATCCTTGCTCCCCGTGCCTGTTG------GCTGTGGGTGACA T_belangeri300395 TGCCCAGTGATGAGA-CCATCCTTGCTCCCCATGCTCCCCAGGG--GGCTGTGGGTGACA * ** * * * ** * *** C_familiaris300488 TCATGGCTGCCCCCAGGTTGTGCCAGTTGGG----CTGATG-CCTGGGGGCTGAGGGCA D_novemcinctus300508 CTCTGGCTAGCTCTGGGCTGGGCCGGTTGGG----CCAGCG-CCTGGGGGCTGAGGGCA E_telfairi300811 CTGTGGCT--CCCCTGGGCTGGCCAGTTGGG----CTGATG-CCTGGGGGCTGAGGGCA E_caballus300087 TCGTGGCTGCCCC-GGGCTGGGCCAGTTGGG----CTGATG-CCCGGGGACTGAGGGCA E_europaeus300643 TCCTGGCTGCCCCTGGGCAGGGCCGGTTGGG----CTGATG-CCTGGGGGCTGAGGGCA H_sapiens300142 CCATGGCTGCCCCAGGGCTGG-CCAATTGGGC----AGATG-CCCAGGGGCTGAGAACA H_sapiens300562 CCATGGCTGCCCCTGGGCTGGGCCAGTGGGG----CCAATG-CCCAGGGGCTGAGGGCA M_mulatta300279 CCACAGCTGCCCCAGGGCTGG-CCAATTGGGC----AGATG-TTCAGGGGCTGAGAACA M_murinus300236 CCATGGCTGCCCCCAGTCTGGACCATTTGGGCCAGTGAGTG-CCCAGGGGCTGTGGACA M_murinus300512 -CATGGCTGCCCCCGGGCCAGGCTGGTTGGGG---CCGGTG-CCCGGGGGCTGAGGGCA M_musculus300008 ACATAGCTTTTCTTGGGACAGGCCAGCTGGA----CAACTG-CTTGAGGCTTGAGGGCA M_musculus300746 CCATGGCTGCCCT-GGGCTGGGCCAGTTGGG----CCATTG-CCTGGGGACTGAGGGCA O_garnettii300100 CCATGGCTGCCCCCAGGACAGGCTGGTTGGG----CTATTGGCCTGGGGGCTGAGGGCA P_troglodytes300270 CCATGGCTGCCCCAGGGCTGG-CCAATTGGGC----AGATG-CCCAGGGGCTGAGAACA P_troglodytes300605 CCATGGCTGCCCCTGGGCTGGGCCAGTGGGG----CCAATG-CCCAGGGACTGAGGGCA P_pygmaeus300043 CCATGGCTGCCCCAGGGCTGG-CCAACTGGGC----AGATG-CCCAGGGGCTGAGAACA P_pygmaeus300661 CCATGGCTGCCCCTGGGCTGGGCCAGTGGGG----CCAATG-CCCAGGGGCTGAGGGCA R_norvegicus301072 CCATGGCTGCCCT-GGGCTGGGCCAGTTGGG----CCATTG-CCTGGGGACTGAGGGCA S_araneus300921 TCCTGGCTGCCCT-GGGCCAAGCCAGTGGGC----TAA--G-CCTGGGGGCTGAGGGCA T_belangeri300395 CTATGGCTGCCCCCGGGCTGGGCCAGGTGGG----CCAGAG-CCCGGGGGCTGAGGGCA *** * * ** * ** ** * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved