snOPY snoRNA Orthological Gene Database

Family: SNORD22

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300035 TCCCAGTGAAGAAACCTT-AA-GGGACATAACT-CCTGT---CCTAGTTC C_familiaris300043 -------------------TCTCATAAATGAATAAATAAAATCTTAAAAA C_familiaris300055 TCCCAGTGAAGAAA-CAGTCA-CATGTCTTACCTCCTGT---CCTAGTCC C_familiaris300087 TCCTAGTGAAGAAA-CAGTCA-CATGTTTTACCTCCTGT---CTTAGTCC C_familiaris300104 TGCCGGTGAGGAGAGCAAGCATCCTGTCTTACCCCCTGT---T-CAGTTC C_familiaris300108 TCCCAGTGAAGAAA-CAGTCA-CATGTCTTACCTCCTGT---CCTAGTCC C_familiaris300121 ----------------TCTCATTCCATGTTAA---AGAATCACAGAGAGC C_familiaris300148 TCCCAGTGAAGAAA-CAGTCA-CATGTCTTACTTCCTGT---CCTAGTCT C_familiaris300164 -GCTCAGTGGTTTAGCACCTGCCTTTGGCTCAGGGCGTGATCCCTGGAGT C_familiaris300348 TCCCAGTGAAGAAA-CAGTCA-CATGTCTTACCTCCTGT---CCTAGTCC C_familiaris300349 TCCCAGAGAAGAAAACAGTCA-CATGTCTTACCTCCTAT---CCTAGTAC C_porcellus300575 TCCCAGTGATGAAATAGT-CA-CGAGTCTTACTTCCTGT---CCTAGTCC D_rerio300012 CTTTTATGATGCAACTC-GCA-CACGTCTTACGCCCTGT---GTCAATGC D_novemcinctus300091 TCCCCGTGAAGAAA-CATTCA-CATGTCTTACCTTCTGT---CCTAGTCC D_novemcinctus300095 TGCCAGTGAGGAG--CAAACATCTTGTCTTAATCCCTGT---TATGGCCC D_novemcinctus300547 TGCCAGTGCAGAG--CAAACATCTTATTTTAACCCCTGT---TCTGGTCC E_telfairi300020 CCCCAATGAGGAAACAAATCA-CATATCTTACCTCCTGT---CCTATCCA E_telfairi300192 CCCCAATGAGGAAACAAT----CACGTCTTACCTCCTGT---CCTAGCCC E_telfairi300450 CCCCAATGAGGAAACAAT----CATGTCTTACCTCCTGT---CCTAGCC- E_telfairi300627 CCCCAGTGAGGAAACAAATCA-CACGTCTTACCTC-TGT---CCTAGCCC E_telfairi300658 ------TGAGGAAACAGT-CA-CATGGCTTACTTCCTGT---CCTAGTTT E_caballus300008 TCCCAGAGAAGAAA-CAGTCA-CAAGTCTTACCTCTTGT---CCTAGTCC E_caballus300027 TCCCAGTGAAGAAACTTT-CA-CACGTCTTACCTCCTGT---CCTAGTCC E_caballus300031 TGCCAGTGAGGAGAGCAAGCATCCTGTCTTAACCCCTGT---T-TAGCCC E_caballus300135 TCCCAGTGAAGAAACATT-CA-CACGTCTTACCTCCTGT---CCTAGTTC E_europaeus300052 TCCTGGTGAAAAAAACACCCA-AATGTCTTACCTCCTGT---CCTAGTCC E_europaeus300106 TCCCAATAAAGAAACTTTTCA-CATGTCTTACCTCCTGT---CCCAGTAT E_europaeus300150 TCTCGGTGAAGAAA-CACCCA-AATGTTTTACCTCCTGT---CCTAGTCC E_europaeus300328 TCCCAGAAAAAAAACACT-CT-CATGTCTTAGCTTCAGT---CCTAGTCC E_europaeus300333 TTCCGGTGAAGAAA-CACCCG-AATGTCTTACCTGCTGT---CCTAGTCC E_europaeus300338 ACCTGGTGAAGAAA-CACTCA-AATATCTTACCTCCTGT---CCTAGTCC E_europaeus300354 TTCCGGTGACGAAA-CACCCA-AATGTCTCACCTCCTGT---CCTAGTCC E_europaeus300477 -----TCCAGAGATATTTAAAATATAAAATAAAACAGTGGTACTTAACTC E_europaeus300578 TCCCAGTGAAGAAACACC-CA-AATGTCTTACCTCCTGT---CCTAGTCC F_catus300026 TCCCAGTGAAGAAACAGT-CA-CATGTCTTACTTCCTGT---TCTAGTCC F_catus300028 TGCCAATGAAGAGAGCAAGCATCCTGTCTTA-CCCCTGT---TCTAGCCC G_aculeatus300078 CCTTTGTGATGACATCC-GCA-TACGTCTTACGCCTCTG---TTTAACGC G_aculeatus300106 CCTTTGTGATGACATCC-GCA-CACGTCTTACGCCTCTG---TTTAACGC H_sapiens300162 TCCCAATGAAGAAACTTT-CA-CATGTCTTACTCTCTGT---CCTAGTCC L_africana300010 TCCCGATGAAGAAACAT--GTACACGTCTTACCTCCTGT---CCTGGTCC L_africana300333 TCCCAGTGAGGAAACAC--TGACACGTCTTCCCTCCTGT---CCTGGTCC M_mulatta300139 --TTACAGGCATACACCACCATACCTGGCCAATACATATTTTCCCGGAGC M_mulatta300227 TCCCAATGAAGAAACTTT-CA-CACGTCTTACTCTCTGT---CCTAGTCC M_murinus300360 TCCCGATGAAGAAAACATTCA-CACGTCTTACTTCCTGT---CCCAGTCC M_murinus300391 TGCCAGTGAGGAC------------------ACCCCTGT---TCTAACCC M_murinus300402 TTTCAAAAAGAGAGTCGTCAGTAACATCAAAGTTTATAGAAAACGAGTTC M_domestica300065 ACCCAATGAAGAAGACA-TCA-CCTGTCTTACTCCCTGA---CCT-GCCC M_domestica300069 TACCCATGAGGAAAGCAAACAAA-TGTCTTAACCCCAGT---CCTGGCCC M_musculus300716 TCCCCATGAAGAAATGTT-CA-CACGTCCTACTTCCTGT---CCTAGCTC O_anatinus302434 TCCTAATGAAGAAAACCAGCA-CCTGTCTTACTCCTTGT---CCTGGCCC O_anatinus302950 TCCTAATGAAGAAAACCAGCA-CCTGTCTTACTCCTTGT---CCTGGCCC O_anatinus302954 TACTAATGAGGAAATCC-ACA-CCTGTCTTA-GCTCCTG---TCCAGTTC O_anatinus303603 ---TGTCTATTTAAACC-ACC-CCCGACTTA-GCCACTG---GCCAGTTC O_anatinus304214 TCCTAATGAAGAAAACCAGCA-CCTGTCTTACTCCTTGT---CCTGGCCC O_cuniculus300013 TCCCAGTGAGGAAGCACT-CA-CACGTCTTACTTCCTGT---CCTAGCCC O_cuniculus300344 TGCCAATGAGGAA--CAGACATCCTGTCTTACTCCCTGT---TTTAATCC O_cuniculus300351 TCCCAATGAGGAAACATT-CA-CACATCTTACTTCCTGT---CCTAGTCC O_cuniculus300379 CTCCAATGAGGAA--CAGACATCCTGTCTTACTCCCTAT---TTTAATCC O_cuniculus300424 TCCCAGTGAGGAAAC-----A-CATATGTTACTTCCTGT---CCTATTCC O_latipes300036 TATTTATGATGACACTC-GCA-CGCGTCTTACGCCATGT---GTTGACGC O_garnettii300576 TCCCAATGAAGAAACATT-CA-CATGTCTTACTTCCTGT---CTTAGCTC P_troglodytes300456 TCCCAATGAAGAAACTTT-CA-CATGTCTTACTCTCTGT---CCTAGTCC P_pygmaeus300542 TCCCAATGAAGAAACTTT-CA-CATGTCTTACTCTCTGT---CCTAGTCC R_norvegicus300082 TCCCTATGAAGATAT-TT-CA-CACGTCTTACTTCCTGT---CCTAGCTC R_norvegicus300131 ----TTCTTGGGAACACTGAATCATGAGTCAAATGTGCAGCGCTTTGACT R_norvegicus300300 ----TTCTTGGGAACACTGAATCATGAGTCAAATGTGCAGCGCTTTGACT R_norvegicus300460 CACACACAAATAAACATTTAAAAATAAGTCAG--CCTGT---CCTAGCTC R_norvegicus300495 CTCCAGAAAAGGAATGTT-CA-CACACCTTACTTCCTGT---CCTAGTCC R_norvegicus301101 TCCCTATGAAGAAACATT-CA-CACGTCTTACTTCCTGT---CCTAGCTC S_araneus300140 TCCCCATGAAGAAACTCT-CA-CATGTCTTACCACCTGT---CCTAGTCC S_tridecemlineatus300147 TCCCAATGAAGAAACATTTCA-CACGTCTTACTTCCTGT---CCGAGTCC S_tridecemlineatus300181 TCCCAATGAAGAAACATT-CA-CGT--CTTACTTCCT-T---TCTGGTCC S_tridecemlineatus300193 TCCCAATGAAGAAACATTTCA-CACGTCTTACTTCCTGT---CCTAGTCC T_nigroviridis300127 CCTTGGTGATGACACCC-GCA-CACGTCCGTCGCCTCGC---GCCAACGC T_belangeri300016 TCCCAATGAGGAAACATT-CA-CAAGTCTTACTTCCTGT---CCTAGTCC T_belangeri300095 TTCTAAACAGGAGTT-------CAGATCTT----CCTGT---CTTAGCCA X_tropicalis300009 CCCCAATGATGAAACCTT-CA-CATGTCCGACCAGCTG----CCTGGTGC C_familiaris300035 CAGATCCTGTAAA----GGT-GAACCC-AGTGGGGCTGACTGGGG-AGAA C_familiaris300043 AAAAAAAGACTGGCTTAGGT-GAACCC-ACTGGGGCTGGC-TGGGGAAAA C_familiaris300055 CAGAGCATGTAAA----GGT-GAACC--ACTGGGGCTGGC-TGGGGGAAA C_familiaris300087 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA C_familiaris300104 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGACTGAC-TGGGAGAGA C_familiaris300108 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAG C_familiaris300121 CTGTAAAG----------GT-GAATCC-ACCGGGGCTGGC-TGGGGAAAA C_familiaris300148 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAC C_familiaris300164 GTAAAG------------GT-GAACCC-ACTGGGGCTGGC-TGGGGGGAA C_familiaris300348 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA C_familiaris300349 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA C_porcellus300575 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA D_rerio300012 CAGAACCTGAAAA----GGT-GAACCC-ACTGGTGTGTCC-TGGGCAATA D_novemcinctus300091 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGATA D_novemcinctus300095 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGGCTAAC-TGGGAGAGA D_novemcinctus300547 CAGAGCCAGTAAA----GGT-GACCCC-GCTGGGGCTAAC-TGGGAGAGA E_telfairi300020 CAGAACCTGAAAA----GGT-GAACCC-ACTGGGACTGGC-TCGGGGAGG E_telfairi300192 CAGAACCTGAAAA----GGT-GAACCA-ACTGGGGCTGGC-TGGGGGAGG E_telfairi300450 CAGACCCTGAAAA----GGC-GAACCC-ACTGGGGCTGGC-TTGGGGAGG E_telfairi300627 TAGAACCTGAAAA----GAT-GAACCC-ACTGGGGCTGGC-TGGGGGAGG E_telfairi300658 CAGAACCTGAGAA----GGT-GAACCT-ACTGGGGTTGGC-TGGGGGAGG E_caballus300008 CAGAGCCTGTAAA----GGA-GAGCCC-ACTGGGACTGGCTGGGA-GAGA E_caballus300027 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGT-TGGGGGAAA E_caballus300031 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGGCTAAC-TGGGAGAGA E_caballus300135 CAGAGCCTGTAAA----GCT-AAACCC-ACTGGGGCTGGC-TGGGGGAAA E_europaeus300052 CAGAGCCTACAAA----GGT-GAACCC-ACTGGGACTGGCTGGGAGAAAA E_europaeus300106 CAGAGCCTATAAT----GGT-GAGCCC-ACTAGCATTGGCTGGGG-AAAA E_europaeus300150 CAGAGCCTGCAAA----GGT-GAACCC-ACTGAGACTGGCTGGAGGTGAA E_europaeus300328 CAGAGAC----------AGG-GAACTT-T-----GTCCCAGAAGG-AACT E_europaeus300333 CAAAGCCTGCAAA----GGT-GAACCC-ACTGGGACTGGCTGGGGGAAAA E_europaeus300338 CAGAGCCTGCAGA----AGT-GAACCT-ACTGGGACTGGCTGGGGGAAAA E_europaeus300354 CAGAGCCTGCAAA----GGT-GAACCC-ACTGGGACTGGCTGGGGGAAAA E_europaeus300477 ATAAAA------------GT-TTGCTT-TTAGGGACTGGC-TGGGGGAAA E_europaeus300578 CAGGGCCTGCAAA----GGT-GAACCC-ACTAGGACTGACTGGGG-GAG- F_catus300026 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAAA F_catus300028 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGGCTAAC-TGGGTGAGA G_aculeatus300078 CAGAACCTGTAAA----GGT-GGACCC-ACTGGTGTTGCC-TTGGCAATA G_aculeatus300106 CAGAACCTGTAAA----GGT-GGACCC-ACTGGTGTTGCC-TTGGCAATA H_sapiens300162 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAGA L_africana300010 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAGA L_africana300333 CAGAGCCTGTAAA----GGC-GAGCCC-ATTGGGGCTGGC-TGGGGG-GA M_mulatta300139 CTGTAAAG----------GT-GAACCC-ACTGGGACTGGC-TGGGGAAAA M_mulatta300227 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAAA M_murinus300360 CAGAGCCTGTAAA----GGT-GAACCCCACTGAGACTGGCTGGGAAGAGA M_murinus300391 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGG-TAAC-TGGGAGAGA M_murinus300402 CAGAGTCTATAAA----GGT-GAACCC-ACTGGGGACGAT-CCGGAGAGA M_domestica300065 CAGAACCTGCAAA----GGTTGAACCC-ACTGGGGCTGGC-TGGGAGGCA M_domestica300069 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA M_musculus300716 CAGAGCCTGAAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA O_anatinus302434 CAGAGCCTGCAAA----GGC-GAACCC-ACTGGGGTCGGC-TGGGGGAGA O_anatinus302950 CAGAGCCTGCAAA----GGC-GAACCC-ACTGGGGTCGGC-TGGGGGAGA O_anatinus302954 CAGAGCCTGCAAA----GGC-GAACCC-ACTGGAATTGGC-AGGGGAG-- O_anatinus303603 CAGAGTCTGCAAA----GGC-GAATCC-ATTGGAGCTGGC-AGGGGAG-- O_anatinus304214 CAGAGCCTGCAAA----GGC-GAACCC-ACTGGGGTCGGC-TGGGGGAGA O_cuniculus300013 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGAGAAA O_cuniculus300344 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGG-TGAC-TGGGAGATG O_cuniculus300351 CAGAGCCTGTAAA----GGC-GAACCC-TTCTGAGTTCCAGAAGG-AGCT O_cuniculus300379 CAGAGCCAGTAAT----GGT-GAACCC-ACTGGGG-TGAC-TGGGAGATG O_cuniculus300424 TAGAGCCTGTAAA----GGT-GG-CCC-ACTGGGGCTGGCCTGGGAGGAA O_latipes300036 CAGA-CCTGAAAA----GGT-GAACCC-ACTGGTGTTGCC-ATGGCAATA O_garnettii300576 CAGAGCCTGTGAA----GGT-GAACCC-ACTGGGGCTAGC-TGGGGGAGA P_troglodytes300456 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAGA P_pygmaeus300542 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAGA R_norvegicus300082 CAGAGCCTGAAAA----GAC-GAACCC-ACTGGGGCTGGC-TGGGGGAAA R_norvegicus300131 CTAGTAAGGCAGGGT--GGT-GAACCC-AGTGGGGCTGGC-TGGAGGAAA R_norvegicus300300 CTAGTAAGACAGGGT--GGT-GAACCC-AGTGGGGCTGGC-TGGAGGAAA R_norvegicus300460 CAGAGCCTGAAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA R_norvegicus300495 CAAG-CCCAAAAA----GAT-GGACTT-ACTGGGGCTGGCTGTGGTGGAA R_norvegicus301101 CAGAGCCTGAAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAAA S_araneus300140 CAGAGCCTGCAAA----GGT-GAACCC-ACTGGGACTGGCTGGGG-GAAA S_tridecemlineatus300147 CAGAGCCCGTAAA----GTT-GAACCC-ACTGAGGCTGGC-TGGGGGAGA S_tridecemlineatus300181 CAGAATTGGTAAA----GGT-GAATCC-ACTAGGGCTGGC-TGTGAGAGA S_tridecemlineatus300193 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAGA T_nigroviridis300127 CAGAACCTGAGAA----GGT-GAACCC-ACTGGCGTTGCC-TTGGCAGCC T_belangeri300016 CAGAGCCTGTAAA----GGT-GAACCC-ACTGGGGCTGGC-TGGGGGAGA T_belangeri300095 CAGAGTCTGCAAG----GGT-GAACCC-ACTGGGGCTGGT-TCTGGGAGT X_tropicalis300009 CAGAGCCTGAAAA----GGT-GAACCC-ACTGGTACCAACAGCTGGAGAG C_familiaris300035 GAGGAAAG-------TTTATC-GAAAAAGGAACTGTCAGAGAGCA--- C_familiaris300043 GGAGGAGGC------TT-GCT-CCAGAAGGAACTGTCTGAGGGAT--- C_familiaris300055 GGAGGAA-G------CTTGCT-CTAGAAGGAACTGTCTGAGGGAT--- C_familiaris300087 GGAGGAA-G------CTTGCT-CCAGAAGGAACTGTCTGAGGGAT--- C_familiaris300104 GGATGAGAA------TTTGTT-CCATAGGGAACAGTCTGAGGCAC--- C_familiaris300108 GAAGGAG-A------TTTGCT-CCAGAAGGAACTGTCTGAGGGAT--- C_familiaris300121 GGAGGAAG-------CTTGCT-CCAGAAGGAACTGTCTGAGGGAT--- C_familiaris300148 GAAGGAG-A------CTTGCT-CCAGAAGGAACTGTTTGAGGGAT--- C_familiaris300164 GGAGGAAAC------TT-GCT-CCAGAAGGAACAGTCTGAGGGAT--- C_familiaris300348 GGAGGAA-A------CTTGCT-CCAGAAGGAACTGTCTGAGGGAT--- C_familiaris300349 GGAGGAA-G------CTTGCT-CCAGAAGGAACTGTCTGAGGGAT--- C_porcellus300575 AGAGGAAAA------TTAGTT-CTAGAAGGAACTGTCTGAGGGAT--- D_rerio300012 AGGGGATGA------TCCGTTGGGGTTTCCAACAGTCTGAGAAGC--- D_novemcinctus300091 AGAGGAGCA------TTTGTT-CCAGATGGAACTGTCTGAGGGAT--- D_novemcinctus300095 TGATGATAA------CTTATT-CCATAAGGAACTGTCTGAGGTAC--- D_novemcinctus300547 GGATAAGAA------CTTATT-CCATAAGGAACTGTCTGGGGAAG--- E_telfairi300020 AGAGGAGAA------CTTGTT-CCAGAAGGAATTATTTGAGGGGT--- E_telfairi300192 AGAGGAGAA------CTTGTT-CCAGAAGGAACTGTCTGAGGGGT--- E_telfairi300450 AGAGGAGAA------CTTGTT-CCAGAAGGAACTGTCTGACGGAG--- E_telfairi300627 AGAGGAGAA------CTTGTT-CCAGAAGGAACTGTCTGAGGGGG--- E_telfairi300658 AGAGGAGAA------TTTGTT-CCAGGAAAAA------AATAAATA-- E_caballus300008 GGAGGAAAG------TTTGTT-CT--AAAAGGAACTGTCTGAGGGAA- E_caballus300027 AGAGGAAAG------CTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- E_caballus300031 GGATGAAAA------CTTGTT-CCATAAGGAACGGTCCGAGGTAC--- E_caballus300135 AGAGGAAAG------CTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- E_europaeus300052 -GAGAAAAT------TCTATT-CCAGAAGGAACTGTCTGAGGGAT--- E_europaeus300106 TTCAGGAGG------TTGCTC-AGCAGGTGAAAAACATTCTTTGTGTT E_europaeus300150 GGGGGGAAGAGGAAATTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- E_europaeus300328 ATCTGAGAG------AT------------------------------- E_europaeus300333 AGAGGAAAT------TTTCTT-CCAGAAAGAACTGTCTGAGGGAT--- E_europaeus300338 AAGAGGACT------TTTGTT-CCAGCAGGAACTGTCTGAGGGAT--- E_europaeus300354 -GAGGAAAT-------TTGTT-CCAGAAGGAACTGTCTGAGGGAC--- E_europaeus300477 AGAGGAAAT------TTTGTC-CCAGAAGGAACTGTCTGAGGGAT--- E_europaeus300578 ------------------------------------------------ F_catus300026 AG-AGGAAG------CTTGTT-CCAGAAGGAACAGTCTGAGGGAT--- F_catus300028 GGATGAGAA------TTTGTT-CCATAAGGAACTGTCTGAGGTAC--- G_aculeatus300078 AGGGGAAGG------AAAGTTGGTGTCGCCAACAGTCTGAATGGA--- G_aculeatus300106 AGGGGAAGG------AAAGTTGGTGTCGCCAACAGTCTGAATGGA--- H_sapiens300162 AGAGGAAGA------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- L_africana300010 GGAGGAGAG------CTTGTT-CCAGAAGGAACAGTCTGAGGGAT--- L_africana300333 AGAGGAGAG------CTTATT-CCAGAAGGAAC-GTCTGAGGGGT--- M_mulatta300139 AGAGGAAGA------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- M_mulatta300227 AGAGGAAGA------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- M_murinus300360 AGAGGAAAG------TTTGTT-CCCAGAAGGAAACTGTCTTGAGGGAC M_murinus300391 AGATGAGAA------CTTGTT-CCCTAAGGAACTGTCTGAGGTAC--- M_murinus300402 AGAGAAAAG------TTTGTG-TCAAAAGGAACTGTCTGAGGAAT--- M_domestica300065 GGAGGAAAC----------ATGTTCCAGAGAACTGTCTGAGGGAC--- M_domestica300069 AGAGGAAGC------CCTGTT-CCTGAAGGAACTGTCTGAGGTAC--- M_musculus300716 AGAGGAAAC------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- O_anatinus302434 AGATGATAA------TCTGTTCCAGC-GGGAACAGTCTGAGGGAC--- O_anatinus302950 AGATGATAA------TCTGTTCCAGC-GGGAACAGTCTGAGGGAC--- O_anatinus302954 AGAGGAAGA------TAAAATGTTCCTGAGTGAACAGTCTGATGTGC- O_anatinus303603 AGAGGAAGA-------GGAATGCTTTAAAGCAC--------------- O_anatinus304214 AGATGATAA------TCTGTTCCAGC-GGGAACAGTCTGAGGGAC--- O_cuniculus300013 AGAGGAAAG------TGTGTT-CCAGAAGGAACTGTCTGAGGGAC--- O_cuniculus300344 GGATGAGAA------CTGGTT-CTGTAAGGAACTGTCTGAGGTGC--- O_cuniculus300351 GTCTGAGGG------TC------------------------------- O_cuniculus300379 GGATGAGCA------CTGGTT-CTGTAAGGAACAGTCTAAAGC----- O_cuniculus300424 AGAGGAAAG------TGTGTT-GCAGAAGGAACTGTCCGAGGGAT--- O_latipes300036 AGGGGATGA------CTCGTTGGGGTTACCAACAGTCTGAATGG---- O_garnettii300576 AGAGGAAAG------TTGGTT-CCAGAAGGAACTGTCTGAGGGAC--- P_troglodytes300456 AGAGGAAGA------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- P_pygmaeus300542 AGAGGAAGA------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- R_norvegicus300082 AGAGGACGT------TTTGTT-CCAGAAGGAACTGTCTAATGGAT--- R_norvegicus300131 AGAGGAAGT------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- R_norvegicus300300 AGAGGAAGT------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- R_norvegicus300460 AGAGGAAAT------TTTGTT-CCAGAAGGAACTGTCTGAGGGA---- R_norvegicus300495 TAAGAAAG-------TCTGCT-CCAGAAGGAGCTACCTGAGGGGT--- R_norvegicus301101 AGAGGAAAT------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- S_araneus300140 AGAGGCAAG------CTTGTT-CCAGCAGGAACTGTCTGAGGGAT--- S_tridecemlineatus300147 AGAGGAGAA------CTTGTT-CCAGAAAGAACTGTCTGAGGGAT--- S_tridecemlineatus300181 AGAGCAAAA------TTTGTT-CCAGAAAGAACT----AAGGAAT--- S_tridecemlineatus300193 AGAGGAAAG------CTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- T_nigroviridis300127 GGGGGAAGA------CTGGTTGGGGTTACCAACAGTCTGAAGGGA--- T_belangeri300016 AGAGGAGAG------TTTGTT-CCAGAAGGAACTGTCTGAGGGAT--- T_belangeri300095 AGAGGAAAG-----------TTCCAGAGAGAAGTGTCTCTGGGTT--- X_tropicalis300009 GAAGGAAGA------CTTGTT-CCAGCTGGAACTGTCTGAGGGCT---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved