snOPY snoRNA Orthological Gene Database

Family: SNORD20

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300372 TGGATATGATGACTGATT--ATCTGAGAAAATAATTGATGAAATCA--AG D_novemcinctus300568 TGGATATGATGACTGATT--ATCTGAGAAA-TAATTGATGAAATCA-CAA E_telfairi300752 TGGACATGATGACTGCTT--ATCTGAGAAG-TAACTGATGAAATCACAAG E_caballus300240 TGGACATGATGACTATGATTATCTGAGAAA-TTATTGATGAAATCTCAAG E_europaeus300583 TGGATGTGATGATTGATTATCTGAGTAAA----ACTGATGAAAAATCAAG F_catus300124 AGAGAGAGAGAAATAAAAGAAGCAGAAGGG---GATGATGGAATCTCAAG G_gallus300108 TGGATATGATGACTGATT--ATCTGAAA---TGC-TGATGAAACCACTTC H_sapiens300509 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATCTCAAG L_africana300061 TGGACATGATGACTGATTTTATCTGAGAAA-TAATTGATGAACCTCAAGA M_mulatta300522 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATCTCAAG M_murinus300322 TGCATATGATGACTGATT--ACCTGAGAAA-TAATTGA---GGTCTCCAG M_murinus300420 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATTTCAAG M_domestica300102 TGGATATGATGACTCATT--ATCTGAGAAT-TGC-TGATGAAACCTCCAG M_musculus300789 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATCTCAAG M_lucifugus300752 TGGATATGATGACTGATT--ATCTGAGAAA-TAATTGATGAAATAC-AAG O_anatinus303498 TGGATATGATGACTGATT--ATCTGAGACA--AACTGATGAAACCA-ATA O_cuniculus300048 TGGATATGATGACAGACG--GCCTGAGAAG--GAATGATGAAATCTCGAG O_garnettii300066 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAGATTTCAAG O_garnettii300319 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAGATTTCAAG P_troglodytes300643 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATCTCAAG P_pygmaeus300697 TGGATATGATGACTGATT--ACCTGAGAAA-TAATTGATGAAATCTCAAG R_norvegicus300855 TGGATATGATGACTGATT--ACCTGAGAAA-TAACTGATGAAATCTCAAG S_araneus300948 TGGAAATGATGATTGATTATCTGAGAAAT---AATTGATGAAATATCAAG S_tridecemlineatus300004 TGGATATGATGACTGAT---ACCTGAGAAA-TAATTGATGAAATATCAAG T_nigroviridis300015 CAGACATGATGA--AACTTCGTCATCCAGA-----------AACCCCGTG T_belangeri300213 TGAAAA--ACACATGATTTTATGAGGAAAT-AAACTGAT-AAATCTCAAG X_tropicalis300111 TGGAAGTGATGAGCTGTT--ATCTGAGAAT-TTTGTGATGAAAA---TTA * C_familiaris300372 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG D_novemcinctus300568 GAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG E_telfairi300752 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAC E_caballus300240 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG E_europaeus300583 AAAAGTCCTCT-AGATAGTCAAGT-TCTGATCCAG F_catus300124 AAAATTCCTCT-AGGTAGTTAAGT-TCTGACCCAG G_gallus300108 TAAAGTCCTCT-AGATAGTCAAGT-GCTGATCCAG H_sapiens300509 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG L_africana300061 AAATTTCCTCT-AGATAGTCAAGT-TCTGACCCAG M_mulatta300522 AAGATTCCTCT-AGATAGTCAAGT-TCTGATCCAG M_murinus300322 AAAATTAAAAAAAAAAAATCAAA--ACAAATGAAG M_murinus300420 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG M_domestica300102 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG M_musculus300789 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG M_lucifugus300752 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG O_anatinus303498 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAC O_cuniculus300048 AGAATTCCTCT-AGATAGTCAAGT-TCTGATCTGG O_garnettii300066 AAAA--AAAAAAAAGAAATTGAATTAGAAATTTAA O_garnettii300319 AAAA--AAAAAAAAGAAATTGAATTAGAAATTTAA P_troglodytes300643 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG P_pygmaeus300697 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG R_norvegicus300855 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG S_araneus300948 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG S_tridecemlineatus300004 AAAATTCCTCT-AGATAGTCAAGT-TCTGATCCAG T_nigroviridis300015 AGGACTCAGAG-AGATAGTCAAGT-CCTGATCTGT T_belangeri300213 AAAATTTCTCCCAGATAGTCAAGT-TCTGATCCAG X_tropicalis300111 ACAATTTCTCT-AGATAGTCAAGT-ACTGATCCAG * * * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved