snOPY snoRNA Orthological Gene Database

Family: SNORD19

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300410 -GAAATATGATG-AGCATACAAAATCTTGATTAA-A---AAATG-AGAAT C_familiaris300411 -GAGGTATGAGG-AAAACATGTGAG-CAGTCTGATT-TTCATTG-AAGAC C_porcellus300850 -GAGGTATGAGG-AAAACATCTGAATCAGTCT-GAT-------------- C_porcellus300851 -GAAATATGATG-AGTATATGAGAAGTTGAGTTA-----AAATG-AAAAA D_novemcinctus300554 -GAGGTATGAGG-AAAACGTCTGAA-CAGTCTGATT-GTCACTG-AAGAC D_melanogaster300050 ---CAATTAATGATAAATATTTTA-TAAGGTGCGGAAATAAAGTGAGGAA E_telfairi300842 -GAGGAATGAGG-ACAACGTCTAA--CAGTCTGATG-GTCGCTG-AAGAC E_caballus300369 -GAAATATGATG-AGTCTACAAAATCTTGATTAA-A---AAATG-AAAAC E_caballus300370 -GAGGTATGAGG-AAAACATCTAAA-CAGTCTGAT-TGTCACTG-AAGAC E_europaeus300065 -GCGGTATGATG-AGCACATGTCAG-CCGACTGACT-GTCACTG-GAGAG E_europaeus300629 -GAGGCATGATG-AAGAGTCTGAA--CAGTCTGATC-ATCTCTG-AAGAC G_gallus300003 -CATGGATGAAA--CAAGGCAATAA-GAGTAGGATT-GAAACCCTGGACT G_gallus300047 -GAGAAATGAGG----ATAC-AGACTTTGTCTGAGT-TTTATA-TGAAGA H_sapiens300607 --ACATGGGTGA-GGTACGAGGAAA-CAGTCTGATA-GTCACTG-AAGAC H_sapiens300608 -GAAATATGATG-AGTGTACAAAATCTTGATTTA-A-GTGAATG-AAAAA L_africana300499 -GAGGTATGAGG-AAAATATGTGAA-CAGTCTGATT-GTCAGTG-AAGAC M_mulatta300427 ----GGCTCA--ATAAATGTTTCAATTTAATTGAATGAAAAATTAATTTC M_mulatta300600 -GAAATATGATG-AGTGTACAAAATCTTGATTTA-A-ATAAATG-AAAAA M_mulatta300601 ---CATTGGTGA-GGTATGAGGCTA-CAGTCTAATA-GTCACTG-AAGAC M_murinus300532 -GACGTATGAGG-AAAACATCTCAG-CAGTCTGATT-GTCACTGAGAGAC M_domestica300025 --------TAGGTATAAAGTAGTAA--ATTCTGATT-ACCACTGAAGAAC M_domestica300190 -GAGGTATGAGG-AAAACATCTAAA-CAGTCTGAAATACCATTG-GAGAC M_musculus300819 -GAAATGTGATG-AGTACACAAA-TGTTGAT------GAAAGTG-AAAAA M_musculus300820 -GAGGTATGAGG-AAAATATCGGA--CAGTCTGATT-ACCACTG-AAGAC O_anatinus302871 TCTGGGTTGAACTGTGATGAAACTGATCGCTCTGGATACAAGAGTGAAGA O_anatinus302872 -GAGGAATGAGG-AAAATATCTGAT-CAGTCTGATATACCACTG-AAGAC O_cuniculus300203 -GAGGTATGAGGGAAAATATCTGAA-CAGTCT-GATTGTTGTTG-AAGAC O_cuniculus300416 -AAGAAATGAGG----AAACTACAATTGGTCTTAGT-GTTGAAGTGAAGA O_garnettii300734 -GAGGTATGAGG-AAAACATCTGAA-TAGTCT-GATTGTCATTG-ATGAC P_troglodytes300625 ---CATGGGTGA-GGTACGAGGAAA-CAGTCTGATA-GTCACTG-AAGAC P_troglodytes300626 -GAAATATGATG-AGTGTACAAAATCTTGATTTA-A-GTAAATG-AAAAA P_pygmaeus300721 -GAAATATGATG-AGTGTACAAAATCTTGATTTA-A-GTAAATG-AAAAA P_pygmaeus300722 ---CATTGGTGA-GGTATGAGGATA-CAGTCTGATA-GTCACTG-AAGAC R_norvegicus300994 -GAAATATGATG-AGCATACAAAATGTTGATTAC------AGTG-AAAAA R_norvegicus300995 -GAGGTATGAGG-AAAATATCGGAA-CAGTCTGATT-ATCACTG-GAGAC S_araneus301079 -GAGGTATGAGG-AAAACATCTGAA-CAGTCTGACT-GTCACTG-AAGAC S_tridecemlineatus300219 -GAGGTATGAGG-AAAACATCTGAA-CAGTCTTGATTGTCACTG-AAGAC S_tridecemlineatus300304 -GAAATATGATG-AGTATGCAAAATGTTGATTTTTA-AAAAATG-AAAGA T_belangeri300379 -GAGGTATGAGG-AAGACATCTGAA-CAGTCT-GAT-GACACTG-AAGAC T_belangeri300380 -GAAATATGATG-AGTGTACAAAAT-TTGATGT--A-AAAAATG-AAAAA C_familiaris300410 TTATAAGATCCAACTCTGATTTCATCCAGAGA-- C_familiaris300411 TGATAAGATCCAACTCTGACCTCAATAAAGCC-- C_porcellus300850 ---------CCAACTCTGACCTCAGCAAACCA-- C_porcellus300851 TAAAAAGATCCAACTCTGATTTCATCCAGAGA-- D_novemcinctus300554 TGATAAGATCCAACTCTGACCTCAGTTAAACC-- D_melanogaster300050 TATCT--TTTAAATTCAAGTTCAATTCTGAAAGC E_telfairi300842 TGATAAGATCCAACTCTGACCTCAGAAGCAGC-- E_caballus300369 TTATAAGATCCAACTCTGATTTCATCCAGAGA-- E_caballus300370 TGATAAGATCCAACTCTGACCTCAGCAGAGTC-- E_europaeus300065 TGATAAGATCCAACTCTGACCTCAGCAAAGCC-- E_europaeus300629 TGATAAGATCCAACTCTGACCTCAGTAGAGTC-- G_gallus300003 TCAGTAGATCCAACTCTGATTTCTTCAGATAC-- G_gallus300047 C-TTCAGATCCAACTCTGATCTCACATGGAA--- H_sapiens300607 TGATTAGATCCAACTCTGATCTCAGCAAAGCC-- H_sapiens300608 TTACAAGATCCAACTCTGATTTCAGCCAGAGA-- L_africana300499 TGATAAGATCCAACTCTGACCTCAG---AGCC-- M_mulatta300427 TATTT--TTTTCACCTTGATTCATTTGCACTG-- M_mulatta300600 TTACAAGATCCAACTCTGATTTCAGCCAGAGA-- M_mulatta300601 TGATTAGATCCAACTCTGACCTCAGCACAGCC-- M_murinus300532 TGGTAAGATCCAACTCTGACCTCAGCAGAGCC-- M_domestica300025 TGG-AAATTCCAAGCCAGAAAGAATTGA------ M_domestica300190 TG-TAAGATCCAACTCTGACCTCAGCCTAGGC-- M_musculus300819 CATGAAGATCCAACTCTGATTTCATTAAAAAT-- M_musculus300820 TGATAAGATCCAACTCTGACCTCAACAAAGCC-- O_anatinus302871 ATACAAGATCCAACTCTGATTTCATCCCATT--- O_anatinus302872 TG-TAAGATCCAACTCTGACCTAAAACTTGCC-- O_cuniculus300203 TGGTAAGATCCAACTCTGACCTCAGCAAAACC-- O_cuniculus300416 CACTCAGATCCAACTCTGATCTTGCTGTAAAC-- O_garnettii300734 TGATAAGATCCAACTCTGACCTCAGCAAAGCC-- P_troglodytes300625 TGATTAGATCCAACTCTGATCTCAGCAAAGCC-- P_troglodytes300626 TTACAAGATCCAACTCTGATTTCAGCCAGAGA-- P_pygmaeus300721 TTACAAGATCCAACTCTGATTTCAGCCAGAGA-- P_pygmaeus300722 TGATTAGATCCAACTCTGATCTTAGCAAAGCC-- R_norvegicus300994 CAGTAAGATCCAACTCTGATTTCATTAAAGAT-- R_norvegicus300995 TGATAAGATCCAACTCTGACCTCAGCAAAGCC-- S_araneus301079 TGATAAGATCCAACTCTGACCTCAGCAAAAGC-- S_tridecemlineatus300219 TGATAAGATCCAACTCTGACCTCAACAAAGCC-- S_tridecemlineatus300304 CAATAAGATCCAACTCTGATTTCATCCAGAGA-- T_belangeri300379 TGATAAGATCCAACTCTGACCTCAGCAAAGCC-- T_belangeri300380 TGTTAAGATCCAACTCTGATTTCAACTCAGGT-- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved