snOPY snoRNA Orthological Gene Database

Family: SNORD17

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300020 AGACAGAGGAGTTGAT-GAGAACTCTAATCCATTCT-CTGAGCGAGAAG- C_familiaris300448 ------GTGAAGTGAT-GATTCAGTTTATCCATTCG-CTGAGTGCACTG- C_porcellus300550 ------GTGAAGTGAT-GATTCAGTTTATCCATTCG-CTGAGTGCACCC- E_caballus300088 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- F_catus300265 ------GTGAAGTGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- H_sapiens300482 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- M_mulatta300532 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- M_murinus300513 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- M_domestica300131 ------GTGAAATGAT-GATGAAGTTTATCCATTCT-CTGAGTGTGCTGC M_domestica300132 ------GTGAAATGAT-GATGAAGTTTATCCATTCT-CTGAGTGTGCTGC M_musculus300985 ------GTGAAATGAT-GATTCTGTTTATCCATTCG-CTGAGTACGCTG- O_anatinus304501 ------GTGGAATGACAGTTGAAGTTTATCCATTCT-CGGAGTATGTC-A O_anatinus304503 ------GTGACATGAT-GATGAAGTTTATCCATTCT-CTGAGCTTGCAGA O_garnettii300704 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGTGCTG- P_troglodytes300726 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGCGCTG- P_pygmaeus300622 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGTGCTG- R_norvegicus300954 ------GTGAAATGAT-GATTCTGTTTATCCATTCG-CTGAGTACGCTG- S_araneus300150 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTACGCAGT S_tridecemlineatus300315 ------GTGAAATGAT-GATTCAGTTTATCCATTCGGCTGAGTGTGCTG- T_belangeri300109 ------TTGAAATGAT-GATTCAGTTTATCCATTCG-CTGATTGTGCTG- T_belangeri300118 ------GTGAAATGAT-GATTCAGTTTATCCATTCG-CTGAGTGTGCTG- * *** * * ******** * ** C_elegans300020 -GATGGCCGAAGCGGGT--TCGCATTTGAGGCATTAAGGTAGACGACAGA C_familiaris300448 TACTGACCTTCTTCCAA-GCCTTGGTTCCTGTTCTAGGAA---CT-CGGG C_porcellus300550 CACT-ACCTTCTTCAAG---CCCCGTTCCTGTTCTAGGGA---CT-CAGG E_caballus300088 CACTGATCTTCTTCCAA-GCCTCGGTTCCTGTTCTAGGAA---CT-CGGG F_catus300265 CACTGACCTTCTTCCAA-GCCTCGGTTCCTGTTCTAGGAA---CT-CGGA H_sapiens300482 CACTGACCTTCTTCCAA-GCCTCAGTTCCTGTTCTAGGAA---CT-TGAG M_mulatta300532 CACTGACCTCCTTCCAA-GCCTCAGTTCCTGTTCTAGGAA---CT-TGAG M_murinus300513 CACTGACCTCCTTCCAA-GCCTCAGTTCCTGTTCTAGAAA---CT-TGGG M_domestica300131 TCTGCCCTTCCTACAGC-TCT-GAGTTCCTGTTCTAGGAA--CTC-TTGA M_domestica300132 TCTGCCCTTCCTACAGC-TCT-GAGTTCCTGTTCTAGGAA--CTC-TTGA M_musculus300985 CTCTGACCTTCTTCCCA-GTCTCGGTTCCTGTTCTGGGAG---CT-TGGG O_anatinus304501 TGCTACTCTTCTGCAGC-ACC-AGGTTCCTGTTCCAGAAC--CTC-C-GT O_anatinus304503 CTCTGCCCTCCTTCAGC-ATCGAGGTTCCTGTTCTAGGGC--CTC-G-GT O_garnettii300704 CACTGACCTCCTTCCAG-GTCTCAGTTCCTGTTCTAGGAA---CT--GGG P_troglodytes300726 CACTGACCTTCTTCCAA-GCCTCAGTTCCTGTTCTAGGAA---CT-TGAG P_pygmaeus300622 CACTGACCTCCTTCCAA-GCTTCAGTTCCTGTTCTAGGAA---CT-TGAG R_norvegicus300954 CACTGACCTTCTTCCCA-GTCCCAGTTCCTGTTCTGGGAG---CT-TGGG S_araneus300150 CACTGATCTTCTTCCAA-GCCTCAGTTCCCGTTCTGGGAA---CC-TGAG S_tridecemlineatus300315 CATTGACCTTCTTCCCAAGCCTCAGTTCCTGTTCTAAGAAACTTT-TGGT T_belangeri300109 TGCTGATCTCCTTCTAA--TCTCAGTTCCTGTTCTAGGAA---CT-TGGG T_belangeri300118 TCCTGACCTCCTTCCAA-GTCTCAGTTCCTGTTCTAGGAA---TG-TGGG ** * C_elegans300020 GTTCTTCTGGAAACTACTGCCTCGCG------CTGACGTCATGCCTTCGC C_familiaris300448 GCTACGTAGCCTCCAAATGCCCTGCAG-----TTTGCGGTGTTCTACCGT C_porcellus300550 GCTCTGCGGCCCCCAG-TGCCTTGCGG-----CCTGCAGCGTTCTGCTGC E_caballus300088 GTTACGTAGCCTCCAAACACCCGGCAG-----TCTGTGGTGTTCTACTGT F_catus300265 GCTATGTAGCCTCTAAATGCCCTGCAG-----TCTGCAGTGTTCTACTGT H_sapiens300482 GCTATGTAGCCTGAAAATGCCCTGCAG-----TCTGCAGTGTTCTACTGT M_mulatta300532 GCTATGTAGCCTGCAAATGCCCTGCAG-----TCTGCAGTGTTCTACTGT M_murinus300513 GCTACATAGCCTCCAAATGCCCTGCTC-----TCTGCAGTGTTCTACTGT M_domestica300131 GTTATGTAACCTCCAGATACCCTCCA----GACTTGCAGTGTTCTACTGT M_domestica300132 GTTATGTAACCTCCAGATACCCTCCA----GACTTGCAGTGTTCTACTGT M_musculus300985 GCTGAGTAGCCACCA---GCCCTGCTC-----TCTGCAGTGTTCTATTGT O_anatinus304501 GCCATGCAGTTTCCAAATGCCCCTTGT---GTCTTGTGGTGTTCTGCTGG O_anatinus304503 GTTTCGCGGCCTTCTG-TGCACTCCA----GCCTTCCAGTGTTCTACTGG O_garnettii300704 GCTATGTAGCCTCCAACTGCCCTGCAA-----TCTGCGGTGTTCTACTGC P_troglodytes300726 GCTATGTAGCCTGAAAATGCCCTGCAG-----TCTGCAGTGTTCTACTGT P_pygmaeus300622 GCTATGTAGCCTGAAAATGCCCTGCAG-----TCTGCAGTGTTCTACTGT R_norvegicus300954 GCTGAGTAGCCTCCA---ACCCTGCAA-----TCTGCAGTGTTCTACTGT S_araneus300150 TCTACGCAGCCTCCAGTTGCCTTGCCTTGCAGTCTGTAGTGTTCTACTGT S_tridecemlineatus300315 GCTATGTAGCCTCCAAATGCCCTGGCAGA---TCTGCAATGGTCTATTGC T_belangeri300109 -CCACGCAGCCTCCAAATGCCCGA--G-----TCTGCAGTGTTCTGCTGT T_belangeri300118 GCCACGCAGCCTCCAAATGCCCTACAG-----TCTGCAGTGTTCTACTGT * * * C_elegans300020 GGGCTGAATTTTGGGTCTGATCCTC------------------------- C_familiaris300448 GGACAGCTTGTGTGT--TGGTAGACTAC---TGGTTAGAA-TGGTTGG-T C_porcellus300550 AGGT-----GCGTGGTGCAGGGGGCTGT--------------GGGAGG-- E_caballus300088 GGACAGCTTGTGTGT--TGGTGGACTAC---TGGTAAGAA-TGGTTGG-T F_catus300265 GGACAGCTTGTGTGT--TGGTAGACTAC---CGGTAAGAA-TGGTTGG-T H_sapiens300482 GAACTGCTTGTGTGT--TGGCAGGCTAC---CGGTAAGAA-TGGTTGG-T M_mulatta300532 GAACTGCTTGTGTGT--TGGCAGGCTAC---CGGTAAGAA-TGGTTGG-T M_murinus300513 CGACTGCTTGGGTCT--TGGTAGACTAT---TGGTAAGGA-TGGTTGG-T M_domestica300131 GGATGGCAGGTGTGTG-TGGTGGTCTTA--CTAGTAGGAAGAGATGGAGT M_domestica300132 GGATGGCAGGTGTGTG-TGGTGGTCTTA--CTAGTAGGAAGAGATGGAGT M_musculus300985 GGATTGCTTGTGTGC--TGGCAGGCTACTACTGGTAAGAA-TGGCTAG-T O_anatinus304501 AGACG--GCTGGTGTG-TGTTTGG-TGT--CTG--CCCGCGGGAGAGGGT O_anatinus304503 GGGTG-CGACCGTGTC-CGGTTGACTGC--TTG--AGGGTGTGGTGGAGT O_garnettii300704 GGTCTGCTTGGGTGT--TGGCAGACTAT---CGGTAAGGA-TGGTTGG-T P_troglodytes300726 GAACTGCTTGTGTGT--TGGCAGGCTAC---CGGTAAGAA-TGGTTGG-T P_pygmaeus300622 GAACTGCTTGTGTGTGTTGGCAGGCTAC---CGGTAAGAA-TGGTTGG-T R_norvegicus300954 GGATTGCTTGTGTGT--TGGCAGACTACTACTGGTAAGAA-TGGCTAG-T S_araneus300150 GGACAGCTTGTGTGT--TGGT-GGCTGC---TGGTAAGA--TGGTTGG-T S_tridecemlineatus300315 AGATTGCTTGTGTGG--TGGTAGCCCAT--CTGATAAAAAGTGGCTTGAT T_belangeri300109 GGGCTGTTTGTGTGT--TGGTAGGCTGC---CGGCAGGAA-TGGTGGG-T T_belangeri300118 GGGCTGTTTGTGTGT--TGGTAGGCTGC---TGGCAGGAA-TGGTTGG-T C_elegans300020 -------------------------------------------------- C_familiaris300448 GTCAGTAGGGATGGGGTC-CCTCTG-GGTCCCA--TCTCACCAAGATGAG C_porcellus300550 GTGGACGGAGGCAGC------------------------ACGAAGATGAG E_caballus300088 GTCAGCAGGGATGGGT-C-CCTTGG-GGTCTCA--TCTCACCAAGATGAG F_catus300265 GTCAGCAGGGGTGGGG-C-CCTCTG-GGTCCCA--TCTCACCAAGATGAG H_sapiens300482 GTCAGCAGGGACGGGGCC--CTCTG-AGACCCA--TCTCACAAAGATGAG M_mulatta300532 GTCAGCAGGGATGGGGCT--CTCTG-GGACCCA--TCTCACAAAGATGAG M_murinus300513 GTCAGCAGGGATAGGTCC--CTCTG-GGTCCCA--TCTCACAAAGATGAG M_domestica300131 TAGCAGAGGTGAAACCCCATTATTTGGGGTCCCATCTT-ACCAAGACGAA M_domestica300132 TAGCAGAGGTGAAACCCCATTATTTGGGGTCCCATCTT-ACCAAGACGAA M_musculus300985 GTCAGCAGGGATGGCTCC-TCTCTG-GGTTCCA--TCTCACCAAGATGAG O_anatinus304501 GGTGACAGCAGGAGTGGATGCAAAGATCCTGTTCCATCTGCAAAGATGAA O_anatinus304503 TAGCAGGGTGGGAACCCCTTCTGGGGGGATCCCATCTCGGCAAAGACGAA O_garnettii300704 CTCAGCAGGGACGGGTCC--CTCTG-GGTCCCA--TCTCTCAAAGATGAG P_troglodytes300726 GTCAGCAGGGATGGGGCC--CTCTG-AGACCCA--TCTCACAAAGATGAG P_pygmaeus300622 GTCAGCAGGGGTGGGGCC--CTCTG-AGACCCA--TCTCACAAAGATGAG R_norvegicus300954 GTCGGCAGGGATGGCTCCCTCTCTG-GGTTCCA--TCTCACCAAGATGAG S_araneus300150 GTCAGCAGGGATAGGTCC---TCCG-GGTCCCA--TCTCACTAAGATGAG S_tridecemlineatus300315 GTCTACAAAGAATGATGCCCATGTGTGGTTCGAATTTTTACCCAGATGAG T_belangeri300109 ATCAGCAGGGATGGGGCC--ACTTG--GTACCA--TCCCACCAAGATGAG T_belangeri300118 GTCAGCAGGGATGGGGCC--ACTTG--GTCCCA--TCCCACCAAGATGAG C_elegans300020 --------------------- C_familiaris300448 TGGTG--GAAATCT-GATCAC C_porcellus300550 TGGTG---GAATCT-GATCAC E_caballus300088 TGGTG--GAAATCT-GATCAC F_catus300265 TGGTG--GAAATCT-GATCAC H_sapiens300482 TGGTG--AAAATCT-GATCAC M_mulatta300532 TGGTG--AAAATCT-GATCAC M_murinus300513 TGGTG--CAAATCT-GATCAC M_domestica300131 TGACT--GGTGTCT-GATCAC M_domestica300132 TGACT--GGTGTCT-GATCAC M_musculus300985 TGGTG--CAAATCT-GATCAC O_anatinus304501 CGGTG--ACAGTCG-GATCAA O_anatinus304503 TGATG--GGAGTCT-GATCAC O_garnettii300704 TGGTG--AAAATCT-GATCAC P_troglodytes300726 TGGTG--AAAATCT-GATCAC P_pygmaeus300622 TGGTG--AAAATCT-GATCAC R_norvegicus300954 TGGTG--CAAATCT-GATCAC S_araneus300150 TGGTG---AAATCT-GATCAC S_tridecemlineatus300315 TGGGGGGCAAATCTAGATCAT T_belangeri300109 TGGTG--GGAAAAA-AATAAA T_belangeri300118 TGGTG--GAAATCT-GATCAC

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved