snOPY snoRNA Orthological Gene Database

Family: SNORD15

CLUSTAL W (1.83) multiple sequence alignment C_elegans300045 -------------------------------------------------- C_elegans300046 ---------------------------------------------TCACC C_familiaris300473 CTTCGGTGATGACACGATGACGAGTCAGA------AAGGTCACATCCTGC C_familiaris300474 CTTCAATGAAGAGAAGATGACGAGTCTGACT-GGAGGTGTT-ATCTTTG- C_porcellus300740 ------------CTTCATGATGA--CTTGCT-GGGAGTGTC-ATCTCTGT C_porcellus300924 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGCCACGTCTTGC C_savignyi300000 -------------------------------------------------- C_savignyi300001 -------------------------------------------------- C_savignyi300007 -------------------------------------------------- D_rerio300128 CTTCGGTGATGATACGATGACGAGTCGGAAC----AGGGCCAGTTCTGAC D_rerio300129 CTTCGGTGATGATACGATGACGAGTCGGAGT----AGGGCCAGTTCTGAC D_rerio300130 CTTCGGTGATGATACGATGACGAGTCGGAGT----AGGGCCGGTTCTGTC D_rerio300262 CTTCAGTGACGATACGATGACGAGTCGGATC----GAGGAC-----CAAC D_novemcinctus300602 CTTCAATGAAGAGATGATGACGAGTCTGACT-GGGGGTGTT-ATTTTTGT D_melanogaster300176 ---------------------------------------------ATATA D_melanogaster300180 --------------------------------------------TGAGCA D_melanogaster300188 ---------------------------------------------TTGAA E_telfairi300833 CTTCCGTGAAGAGATGATGACGAGTCTGA-TGGGAGGTGTT-GCCTTTGT E_telfairi300834 CTTCGGTGATGACACGATGACGAGTCAGA------AAGGCCACCTCCTGC E_caballus300305 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCACATCCTGC E_caballus300306 CTTCAGTGAAGAGATGATGACGAGTCTGACT-GGAGGTGTC-ATCTTTGT E_europaeus300555 CTTCAGTGATGACACGATGACGAGTCAGA------ATGGTCACATCCTGC E_europaeus300556 CTTCGATGAAGAGAAGATGACGAGTCTGACT-GGAGGTGT---TCTTTGT F_catus300284 CTTCAATGAAGAGAAGATGACGAGTCTGACT-GGAGGTTTT-CTCTTTGT F_catus300285 CTTCGGTGATGATACGATGACGAGTCAGA------AAGGTCACATCCTGC G_gallus300036 CTTCAGTGATGATAAGATGACGAGTCAGAAG---GGATGTC----CTTGT G_gallus300037 CTTCAGTGATGATAAGATGACGAGTCAGA------AGGGATGGCTCCTG- G_aculeatus300115 CTTCAGTGATGAGACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300116 CTTCAGTGATGATACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300117 CTTCAGTGATGATACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300118 CTTCAGTGATGATACGATGACGAGACGGAAT----AAGGCT----CCAGT G_gorilla301039 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTT-CTCTTTGC G_gorilla301038 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCACGTCCTGC H_sapiens300741 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTT-CTCTTTGC H_sapiens300742 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCACGTCCTGC L_africana300144 CTTCAGTGAAGAGATGATGACGAGTCTGATT-GGAGGTGTT-ATCTTTGT L_africana300438 CTTCGGTGATGACACGATGACGAGTCAGA------AAGGTCACTTGCTGC M_mulatta300654 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGGTGTT-GCCTTCGC M_mulatta300655 CTTCAGTGATGACATGATGACGAGTCAGA------AAGGTCACCTCCTGC M_murinus300177 --CTTGTGACCTTAGTATAAAACTTCTGACT----GATAAA----GTGGT M_domestica300155 CTTCAGTGATGACAAGATGACGAGTCAGAAA---GGGCACT---ACCTGC M_domestica300156 CTTCAATGAAGATGCGATGACGAGTCTGACA-GGAGGTGTA---CTCTGT M_musculus300759 CTTCAGTGATGACACGATGACGAGTCAGA------ATGGCCACGTCTTGC M_musculus300760 CTTCGATGAAGAGGTGATGACGAGTCTGAGTAGGAAGTGTT-GTCTTTGT M_lucifugus300750 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCAC-TCCTGC M_lucifugus300991 CTTCGATGAGGAGACGATGACGAGTCTGACT--GGGGTGTT----GCTGT O_cuniculus300273 CTTTGGTGATGACATAATGACGAGTCAGA------AAGGTTACGTCCTGC O_latipes300073 CTTCAGTGATGAGACGATGACGAGTCGGATC----AGGGCTCCGTTTGGT O_latipes300074 CTTCAGTGATGAGACGATGACGAGTCGGAAC----ACACCCCGGCCTGGT O_garnettii300632 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCACATTCTGC P_troglodytes300471 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTT-CTCTTTGC P_pygmaeus300739 CTTCAGTGATGACACGATGACGAGTCAGA------AAGGTCACGTCCTGC P_pygmaeus300738 CTTCGATGAAGAGATAATGACGAGTCTGACTTGGGGGTATT-CTCTTTGC R_norvegicus301084 CTTCGGTGATGACACGATGACGAGTCAGA------AAGGCCACGTCTTGC R_norvegicus301085 CTTCGATGAAGAGGTGATGACGAGTCTGACTAGGAGGTATTTGTCTTTGC S_cerevisiae300051 ----------------------------AGGAAGTTTTTTCCTTTTTATA S_araneus300977 CTTCAGTGATGACACGATGACGAGTCAGA------ATGGTCACATCCTGC S_tridecemlineatus300015 CTTCAGTGATGATATGATGACGAGTCAGA------AAGGTCACATCCTGC T_nigroviridis300140 CTTCGGTGAAGATACGATGACGAGTCGGAGG----AGGACCG-TCCTGCT T_nigroviridis300141 CTTCGGTGATGATACGATGACGAGTCGGAAC----CAGGCC--GTCTTCT T_belangeri300300 CTTCAATGAAGAGATGATGACGAGTCTGAAT-GGGGATGT---TCTTTGT T_belangeri300301 CTTCGGTGATGACACGATGACGAGTCAGA------AAGGTCACGTCCTGC X_tropicalis300105 CTTCTGTGATGATACGATGACGAGTCTGATT---GGGTAAA---TCCTTT X_tropicalis300106 CTTCAGTGATGAGACGATGACGAGTCAGAC-----AGGACA-------AG X_tropicalis300107 CTTCAGTGATGAGACGATGACGAGTCAGAC-----AGGACA-------AG X_tropicalis300108 CTTCAGTGATGATTTGATGACGAGTCGGAC-----ATTCTCCTCTCGTGC C_elegans300045 ----------------------CCGCATATGAAGACCACTAAATGACGAA C_elegans300046 AATGATGCAATGGTTAAATCAGACGAGTCTATTTTGGCTATCTATTCGAG C_familiaris300473 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG C_familiaris300474 CCAGGCGG--CCCCTACTCC-TTGCTGCGTTCTGTGGCA--GTTTTAAGG C_porcellus300740 CTCTGTGG--CCCTTGCT---GTCCTGTAT-CTGTGGTATAATCTC-AAG C_porcellus300924 TTTTGGTC------CATGACAGTACCATGTTCTGTGGTACTGCACGTGGG C_savignyi300000 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG C_savignyi300001 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG C_savignyi300007 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG D_rerio300128 TTTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300129 TTTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300130 TCTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300262 TCTGAGGA--TT-CTGGGTCAGACTCACGTTCTGTGCGTCTGATTTCAAG D_novemcinctus300602 CCAGGTGA--CCAGGACTCT-GTGCTGCGTTCTGCGGCATAGTTTTTAAG D_melanogaster300176 TATGATGT--TAACAT-CATACTGAGTGCCTAAATCGATCTATTTTTGAT D_melanogaster300180 CTTGATGA--TAAACTACAAACTGAAACGTTGTTGTGGTCTATTTTTGAA D_melanogaster300188 AATGATGT--TAAACT-GTCACTGATAGTTGGACTTAATCTATTTTGGAG E_telfairi300833 CCAGGCGG--CT--TACTCT-GTGCTGCGTTCTGTGGCTCAGTGTCAAGG E_telfairi300834 TCTTGGTG------CTGGTCAGTGCCACGTTCTGTGGTCCTGGCCATCGC E_caballus300305 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG E_caballus300306 CCAGGAGG--CCCCTGCTCT-GTGCTGCGTTCTGTGGCGCAGGTGTAAGG E_europaeus300555 TCTTGGTC------CTTGCCAGTGCCATGTTCTGTGGTGCTATGCATGGG E_europaeus300556 CCAGGTGA--CTCCTACTCT-GTGCTGCGTTCTGTGGCATAGTTTTAAGG F_catus300284 CCGGGGGGGGCCCCTACTTC-GTGCCGCGTTCTGTGGCA--GTTTTAAGG F_catus300285 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGCGCATGGG G_gallus300036 GCCAGCACAGCC--TGGTCA-GTGCCATGTTCTGTGGTGCTGTACTAAGG G_gallus300037 CTGAGTGGTGCCCCTGCA---GTGTCACGTTCTGTGCTGCTGCATGTGGT G_aculeatus300115 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTG-GTTCCGCTCCAGT G_aculeatus300116 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTG-GTTCTGCTCTAGT G_aculeatus300117 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTG-GTTCCGCTCCAGT G_aculeatus300118 TCTGTGGG--TTACTGGTTCAGGTCCACGTCCTGTG-GTTCGGCTCCAGT G_gorilla301039 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGA G_gorilla301038 TCTTGATC------CTTGTCAGTGCCATGTTCTGTGGTGCTGTGCACGAG H_sapiens300741 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGA H_sapiens300742 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGTGCACGAG L_africana300144 CCAGGTGG--CT--TACTCT-GTGCTGCGTTCTGTGGGGCAGGTTTAAGG L_africana300438 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTCCTGGTCATTGG M_mulatta300654 CCAGGTTG--CC--TACTCT-GTGCTGCATTCTGTGGCACAGTTTAAAGG M_mulatta300655 TCTTGGTC------CTTGTCAGTACCATGTTCTGTGGTGCTGTGCGTGAG M_murinus300177 TTTGGAGA---TTTATGCTTATTAAAAGTTTCCCTCGTGCTGTGCATGGG M_domestica300155 TCTGTACC---CCCTGGCTT--TGGCACGTTCTGTGCCACTGTGTGTGGG M_domestica300156 TCAGGTGT----TCTACTCTGGTTCTGCGTTCTGCAGGCCAGAATTCAGA M_musculus300759 TCTTGGTC------CCTGTCAGTGCCATGTTCTGTGGTGCTGTACATGGT M_musculus300760 CCAAGATG--CC-TCACT---ATGCTGCGTTCTGTGGCACAGCTGAAAGC M_lucifugus300750 TCTTGGTT------CTTGTCAGTGCCATGTTCTGTGGCACTG--CATAGG M_lucifugus300991 CCAGGTGG--TCCCTGCTCG-GAGCTGCGTCCTGCGGCGCCGTGGTCAGG O_cuniculus300273 CCTTGGGC------CGTGTCAGTGCCACGTCCTGTGGTGCTGTGCGTGGG O_latipes300073 TCTGGTTG--CT---GGTTCAGATCCACGTTCTGTGGTTCTGCTCAAAAG O_latipes300074 TCTGGTGG--CTCCTGGTCCAGATCCACGTTCTGTGGGTCCGCTTCAG-G O_garnettii300632 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG P_troglodytes300471 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGA P_pygmaeus300739 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGTGCACGAG P_pygmaeus300738 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGG R_norvegicus301084 TCTTGGGC------CCTGTCAGTGCCATGTTCTGTGGTGCTGTAAGTGCG R_norvegicus301085 CCAGGATG--CC-TCACT---GCGCTGCGTTCTGTGGCACAGTTGTGAGC S_cerevisiae300051 TGATGAATATGAGTGCATTTGGCTCGAGTTGCTGTTTGGCTTTTGCCAAA S_araneus300977 TCTGGGTC------CGTGTCGGTGCCACGTTCTGTGGTGCTGTGC-ACGG S_tridecemlineatus300015 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGC--AGG T_nigroviridis300140 TCTGTGGG--TGGCTGGTTCAGATCCACGTTCTGTG-GCCCGGTGCCAGC T_nigroviridis300141 TCTGCTGG--TCGCTGGTTCGGGGCCACGTTCTGTG-GCTCTGCTCCGGC T_belangeri300300 CCAGGCGG--CC-TTACTCT-G-GCTGCGTTCTGTAGCACAGTTTAAAGG T_belangeri300301 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCCAAGG X_tropicalis300105 TCCAGTGG--TCCCTGTCT--GCATCACGTTCTGTGCTGTAGGCTGAAGC X_tropicalis300106 CAATGTAGTGTTTCCTGCACAGAGGCACGTTCTGTGTCGCTGTACTTGGC X_tropicalis300107 CAATGTAGTGTTTCCTGCACGGGGGCACGTTCTGTGTCGCTGGGCTTGGC X_tropicalis300108 CCCAGTCGG-----CGGAAG-GAGCTGCGTTCTGCCGCT--GCTTTTGCT C_elegans300045 TCCTAATAACCCAATGGGTTTCATTG-------CGGATATGAGGCATTTG C_elegans300046 TTCTTCGAA---GAAATTGCCGCTAA-GCGGGGTGAAATTGAGGCATTTG C_familiaris300473 TTCCTTTTG-CAAAAGTGTCCTGTTT-ATTGATTGATT-AGAGGCATTTG C_familiaris300474 GTCCTTGGGTTAAA-GTAACTTCCAA---AGGACGATCTAGAGGCATTTG C_porcellus300740 GT-------TCAAA-GAAACTTCCAA---AAGATAACCTGGAGGCATTAG C_porcellus300924 TTCCTTTTG-CAAAAGTGTCCTGCTT-ATTGATTGATTTAGAGGCATTTG C_savignyi300000 TCGTATTAACC--ATG---CCGACTA-------TGTA-ACGAGGCATTTG C_savignyi300001 TCGTATTAACC--ATG---CCGACTA-------TGTA-ACGAGGCATTTG C_savignyi300007 TCGTATTAACC--ATG---CCGACTA-------TGTA-ACGAGGCATTTG D_rerio300128 TCCTCAAAG--CAGTAAGTCCTTTT--GCTTGAAGACA--GAGGCATTTG D_rerio300129 TCCTCAAAG--CAGTGAGTCCTTTT--GCTTGAAGACATAGAGGCATTTG D_rerio300130 TCCTCAAAG--CAGTGAGTCCTTTT--GCTTGAAGACATAGAGGCATTTG D_rerio300262 TCCTCGGAGA-TCATGCGTCCTCTA--GATTGAAGATCTTGAGGCATTTG D_novemcinctus300602 GTCCTTGGATCAAA-GTAACTTCCAA---ACGATGACCTAGAGGCATTTG D_melanogaster300176 TGATTC-----TGGCTTTTAAAAGGGATGTTCGCAGCTGCGAGGCATTTG D_melanogaster300180 CACTTC------GATGTTACCTTGGGATGGTCGCACTTGCGAGGCATTTG D_melanogaster300188 AGAGTCG----TAAACTTTTCCTAGGATGTTCGCATTTGCGAGGCATTTG E_telfairi300833 GTCCT-GGGTCAGA-GTAACTTCCTA---AAGATGACTTAGAGGCATTTG E_telfairi300834 T--CTTTTG-CTGAGGTTTCCTGTTC-GTTGGT-GATCTAGAGGCATTTG E_caballus300305 TTCCTTTGG-CAAAAGTGTCCTGTTC-ATTGATTGATT-AGAGGCATTTG E_caballus300306 GTCCT-GGGTCAAA-GTAACTTCCAA---AAGATGACCTAGAGGCATTTG E_europaeus300555 TTCCATTTG-CAAAAGTGTCCTGTGC-ATTGATTGATT-AGAGGCATTTG E_europaeus300556 GCTCT-GGGTCAAG-CTATCTTCCAA---AAGACGACATAGAGGCATTTG F_catus300284 GCCCTCTGGTTAAA-GTAACTTCCAA---AGGACGACCTAGAGGCATTTG F_catus300285 TTCCTTTTG-CAAAAGTGTCCTGTTC-ATTGATTGATT-AGAGGCATTTG G_gallus300036 CTGCCTTGGGCAGG-ATGTCCTCCTC-ATTGGTTGATTCAGAGGCATTTG G_gallus300037 TCTTC---AGCAGGAGCATCCCGTCG--CTGAATGATTTAGAGGCATTTG G_aculeatus300115 CCCTCAGAG--CAGGGAGTCCCTTTT-GATTGAAGACATTGAGGCATTTG G_aculeatus300116 CCCTCAGAG--CAGGGAGTCCCTTTT-GATTGAAGACATTGAGGCATTTG G_aculeatus300117 CCCTCAGAG--CAGGGAGTCCCTTTTTGGTTGAAGACATTGAGGCATTTG G_aculeatus300118 TCCTCAGAC--CAGGAAGTCTTCTTC-TCATGAAGACACAGAGGCATTTG G_gorilla301039 GCCCT--GGTTGAA-GTAATTTCCTA---AAGATGACTTAGAGGCATTTA G_gorilla301038 TTCCTTTGG-CAGAAGTGTCCTATTT-ATTGATCGATTTAGAGGCATTTG H_sapiens300741 GCCCT--GGTTGAA-GTAATTTCCTA---AAGATGACTTAGAGGCATTTG H_sapiens300742 TTCCTTTGG-CAGAAGTGTCCTATTT-ATTGATCGATTTAGAGGCATTTG L_africana300144 ATCCT-GGGTCAAA-GTGACTTCCTT---AAGATGACCAAGAGGCATTTG L_africana300438 TTCCTTTTG-CAAAGGTGTCCTGTTC-ATTGGTTGATTTAGAGGCATTTG M_mulatta300654 GCCCT--GGTTGAA-GTAACTTCCTA---AAGATGACCTAGAGGCATTTG M_mulatta300655 TTCCTTCTG-CAGAAGTGTCCTATTC-ATTGATTGATTTAGAGGCATTTG M_murinus300177 TTCCTTTTG-CAAAGGTGTCCTGTTC-ATTGATTGATTTAGAGGCATTTC M_domestica300155 GGTCTTTG--CAGAGGTGTCTGGACA--TTGGTTGATCTAGAGGCATTTG M_domestica300156 CTCCT-GACTTAAA-GTCATTTCCTT---AAGAAGATCTAGAGGCATTTG M_musculus300759 TCCCTTG-G-CAAAAGTGTCCTGCGC-ACTGATTGATTTAGAGGCATTTG M_musculus300760 ACTGT--GGTCAAAAGAAACTTCCTA---AAGATGACCAAGAGGCATTTG M_lucifugus300750 TTCCTTTTG-CAAAAGTGTCCTATTC-ATTGGTTGACT-AGAGGCATTTG M_lucifugus300991 GCCCC-GGGTCAGA-GTCGCCACCAG---ACGATGACCAAGAGGCATTTG O_cuniculus300273 TTCCTTTGG-CAAAAATATCCTGTTC-ATTGCCTGATTTAGAGGCATTTG O_latipes300073 TTATCAGAACCCGGCGGGTCCTTTTC-AGCTGAAGACATCGAGGCATTTG O_latipes300074 TCATCAGAACACGGCGGGGCCTTTTT-GCCTGAAGACACTGAGGCATTTG O_garnettii300632 TTCCTTTTG-CAAAAGTGTCCTGTTT-ATTGATTGATTTAGAGGCATTTG P_troglodytes300471 GCCCT--GGTTGAA-GTAATTTCCTA---AAGATGACTTAGAGGCATTTG P_pygmaeus300739 TTCCTTTTG-CAGAAGTGTCCTATTT-ATTGATCGATTTAGAGGCATTTG P_pygmaeus300738 GCCCT--GGTTGAA-GTAATTTCCTA---AAGATGACTTAGAGGCATTTG R_norvegicus301084 TCCCTTG-G-CAAAAGTGTCCTGCAT-ACTGATTGATTTAGAGGCATTTG R_norvegicus301085 ACTGT--GGTCAAA-GAAACTTCCTA---AAGATGACCAAGAGGCATTTG S_cerevisiae300051 TCAGTAACGGTGTGGAAAAACTCAAG-----CTACCTTTTTTTACTTTTA S_araneus300977 TTCCTTTTG-CAATAGTGTCCTGGTA-ACTGATTGATT-AGAGGCATTTG S_tridecemlineatus300015 GTCCTTTTG-CAA--GTGTCCTGTTC-ATTGATTGATTTAGAGGCATTTG T_nigroviridis300140 CCCCCAGAG--CGGGCTGTCCTCGCC-GTATGAAGACGCTGAGGCATTTG T_nigroviridis300141 TCCGCAGAA----GAGAGGCCGTGTCCCCCTGAAGACGCTGAGGCATTTG T_belangeri300300 GCCCT--GGGCAAA-GTCA-TTCCTA---AAGATGACCTAGAGGCATTTG T_belangeri300301 TTCCATTTG-CAAAAGTGTCCTGTCC-ATTGATTGATTTAGAGGCATTTG X_tropicalis300105 CCACT-GAGTCAAGGTTGCCCTTTGC---TTGATGTCCATGAGGCATTTG X_tropicalis300106 TGCACTGCATGAGATTTGTCCTTCTT-ACTGATCGATATTGAGGCATTTG X_tropicalis300107 TGCACTGCATGAGATTTGTCCTTCTT-ACTGATCGATATTGAGGCATTTG X_tropicalis300108 GTTGGGTTCTCATGAGAAAGTTGTGT---GA-AGAGTCTTGAGGCATTTG * ** C_elegans300045 TCTGAGCGG-- C_elegans300046 TCTGAGGTGA- C_familiaris300473 TCTGAGAAGG- C_familiaris300474 TCTGAGAAGG- C_porcellus300740 TCTAAGAAGG- C_porcellus300924 TCTGAGAAGG- C_savignyi300000 TCTGAGAACC- C_savignyi300001 TCTGAGAACC- C_savignyi300007 TCTGAGAACC- D_rerio300128 TCTGAGAAGG- D_rerio300129 TCTGAGAAGG- D_rerio300130 TCTGAGAAGG- D_rerio300262 TCTGAGAAGG- D_novemcinctus300602 TCTGAGAAGG- D_melanogaster300176 TCTGATAAC-- D_melanogaster300180 CCTGATGCTTA D_melanogaster300188 TCTGATTCG-- E_telfairi300833 TCTGAGAAGG- E_telfairi300834 TCTGAGAAGG- E_caballus300305 TCTGAGAAGG- E_caballus300306 TCTGAGAAGG- E_europaeus300555 TCTGAGAAGG- E_europaeus300556 TCTGAGAAGG- F_catus300284 TCTGAGAAGG- F_catus300285 TCTGAGAAGG- G_gallus300036 TCTGAGAAGG- G_gallus300037 TCTGAGAAGG- G_aculeatus300115 TCTGAGAAGG- G_aculeatus300116 TCTGAGAAGG- G_aculeatus300117 TCTGAGAAGG- G_aculeatus300118 TCTGAGAAGG- G_gorilla301039 TCTGAGAAGG- G_gorilla301038 TCTGAGAAGG- H_sapiens300741 TCTGAGAAGG- H_sapiens300742 TCTGAGAAGG- L_africana300144 TCTGAGAAGG- L_africana300438 TCTGAGAAGG- M_mulatta300654 TCTGAGAAGG- M_mulatta300655 TCTGAGAAGG- M_murinus300177 TCTGAGAAGG- M_domestica300155 TCTGAGAAGG- M_domestica300156 TCTGAGAAGG- M_musculus300759 TCTGAGAAGG- M_musculus300760 TCTGAGAAGG- M_lucifugus300750 TCTGAGAAGG- M_lucifugus300991 TCTGAGAAGG- O_cuniculus300273 TCTGAGAAGG- O_latipes300073 TCTGAGAAGG- O_latipes300074 TCTGAGAAGG- O_garnettii300632 TCTGAGAAGG- P_troglodytes300471 TCTGAGAAGG- P_pygmaeus300739 TCTGAGAAGG- P_pygmaeus300738 TCTGAGAAGG- R_norvegicus301084 TCTGAGAAGG- R_norvegicus301085 TCTGAGAAGG- S_cerevisiae300051 TCTGACC---- S_araneus300977 TCTGAGAAGG- S_tridecemlineatus300015 TCTGAGAAGG- T_nigroviridis300140 TCTGAGAAGG- T_nigroviridis300141 TCTGAGAAGG- T_belangeri300300 TCTGAGAAGG- T_belangeri300301 TCTGAGAAGG- X_tropicalis300105 TCTGAGAAGG- X_tropicalis300106 TCTGAGAAGG- X_tropicalis300107 TCTGAGAAGG- X_tropicalis300108 TCTGAGAAGA- ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved