snOPY snoRNA Orthological Gene Database

Family: SNORD15

CLUSTAL W (1.83) multiple sequence alignment C_elegans300045 -------------------------------------------------- C_elegans300046 ---------------------------------------------TCACC C_familiaris300473 CTTCGGTGATGACACGATGACGAGTCAGAAA------GGTCACATCCTGC C_familiaris300474 CTTCAATGAAGAGAAGATGACGAGTCTGACT-GGAGGTGTT-ATCTTTG- C_porcellus300740 ------------CTTCATGATGA--CTTGCT-GGGAGTGTC-ATCTCTGT C_porcellus300924 CTTCAGTGATGACACGATGACGAGTCAGAAA------GGCCACGTCTTGC C_savignyi300000 -------------------------------------------------- C_savignyi300001 -------------------------------------------------- C_savignyi300007 -------------------------------------------------- D_rerio300128 CTTCGGTGATGATACGATGACGAGTCGGAAC----AGGGCCAGTTCTGAC D_rerio300129 CTTCGGTGATGATACGATGACGAGTCGGAGT----AGGGCCAGTTCTGAC D_rerio300130 CTTCGGTGATGATACGATGACGAGTCGGAGT----AGGGCCGGTTCTGTC D_rerio300262 CTTCAGTGACGATACGATGACGAGTCGGATC----GAGGAC-----CAAC D_novemcinctus300602 CTTCAATGAAGAGATGATGACGAGTCTGACT-GGGGGTGTT-ATTTTTGT D_melanogaster300176 ---------------------------------------------ATATA D_melanogaster300180 --------------------------------------------TGAGCA D_melanogaster300188 ---------------------------------------------TTGAA E_telfairi300833 CTTCCGTGAAGAGATGATGACGAGTCTGATG-GGAGGTGTT-GCCTTTGT E_telfairi300834 CTTCGGTGATGACACGATGACGAGTCAGAAA------GGCCACCTCCTGC E_caballus300305 CTTCAGTGATGACACGATGACGAGTCAGAAA------GGTCACATCCTGC E_caballus300306 CTTCAGTGAAGAGATGATGACGAGTCTGACT-GGAGGTGTC-ATCTTTGT E_europaeus300555 CTTCAGTGATGACACGATGACGAGTCAGAAT------GGTCACATCCTGC E_europaeus300556 CTTCGATGAAGAGAAGATGACGAGTCTGACT-GGAGGTGT---TCTTTGT F_catus300284 CTTCAATGAAGAGAAGATGACGAGTCTGACT-GGAGGTTTT-CTCTTTGT F_catus300285 CTTCGGTGATGATACGATGACGAGTCAGAAA------GGTCACATCCTGC G_gallus300036 CTTCAGTGATGATAAGATGACGAGTCAGAAG---GGATGTC----CTTGT G_gallus300037 CTTCAGTGATGATAAGATGACGAGTCAGAA------GGGATGGCTCCTG- G_aculeatus300115 CTTCAGTGATGAGACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300116 CTTCAGTGATGATACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300117 CTTCAGTGATGATACGATGACGAGTCGGAAC----GGGGCTCAGACTGCT G_aculeatus300118 CTTCAGTGATGATACGATGACGAGACGGAAT----AAGGCTCCAG----T H_sapiens300741 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTT-CTCTTTGC H_sapiens300742 CTTCAGTGATGACACGATGACGAGTCAGAAA------GGTCACGTCCTGC L_africana300144 CTTCAGTGAAGAGATGATGACGAGTCTGATT-GGAGGTGTT-ATCTTTGT L_africana300438 CTTCGGTGATGACACGATGACGAGTCAGAAA------GGTCACTTGCTGC M_mulatta300654 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGGTGTT-GCCTTCGC M_mulatta300655 CTTCAGTGATGACATGATGACGAGTCAGAAA------GGTCACCTCCTGC M_murinus300177 --CTTGTGACCTTAGTATAAAACTTCTGACT------GATAAAG--TGGT M_domestica300155 CTTCAGTGATGACAAGATGACGAGTCAGAAA---GGGCACT---ACCTGC M_domestica300156 CTTCAATGAAGATGCGATGACGAGTCTGACA-GGAGGTGTA---CTCTGT M_musculus300759 CTTCAGTGATGACACGATGACGAGTCAGAAT------GGCCACGTCTTGC M_musculus300760 CTTCGATGAAGAGGTGATGACGAGTCTGAGTAGGAAGTGTT-GTCTTTGT O_cuniculus300273 CTTTGGTGATGACATAATGACGAGTCAGAAA------GGTTACGTCCTGC O_latipes300073 CTTCAGTGATGAGACGATGACGAGTCGGATC----AGGGCTCCGTTTGGT O_latipes300074 CTTCAGTGATGAGACGATGACGAGTCGGAAC----ACACCCCGGCCTGGT O_garnettii300632 CTTCAGTGATGACACGATGACGAGTCAGAAA------GGTCACATTCTGC P_troglodytes300471 CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTT-CTCTTTGC P_pygmaeus300738 CTTCGATGAAGAGATAATGACGAGTCTGACTTGGGGGTATT-CTCTTTGC P_pygmaeus300739 CTTCAGTGATGACACGATGACGAGTCAGAAA------GGTCACGTCCTGC R_norvegicus301084 CTTCGGTGATGACACGATGACGAGTCAGAAA------GGCCACGTCTTGC R_norvegicus301085 CTTCGATGAAGAGGTGATGACGAGTCTGACTAGGAGGTATTTGTCTTTGC S_cerevisiae300051 ------------------------------AGGAAGTTTTTTCCTTTTTA S_araneus300977 CTTCAGTGATGACACGATGACGAGTCAGAAT------GGTCACATCCTGC S_tridecemlineatus300015 CTTCAGTGATGATATGATGACGAGTCAGAAA------GGTCACATCCTGC T_nigroviridis300140 CTTCGGTGAAGATACGATGACGAGTCGGAGG----AGGACC-GTCCTGCT T_nigroviridis300141 CTTCGGTGATGATACGATGACGAGTCGGAAC----CAGGCC-GTCTT-CT T_belangeri300300 CTTCAATGAAGAGATGATGACGAGTCTGAAT-GGGGATGTT---CTTTGT T_belangeri300301 CTTCGGTGATGACACGATGACGAGTCAGAAA------GGTCACGTCCTGC X_tropicalis300105 CTTCTGTGATGATACGATGACGAGTCTGATT---GGGTAAA---TCCTTT X_tropicalis300106 CTTCAGTGATGAGACGATGACGAGTCAGACA-----GGACA-------AG X_tropicalis300107 CTTCAGTGATGAGACGATGACGAGTCAGACA-----GGACA-------AG X_tropicalis300108 CTTCAGTGATGATTTGATGACGAGTCGGAC-----ATTCTCCTCTCGTGC C_elegans300045 ----------------------CCGCATATGAAGACCACTAAATGACGAA C_elegans300046 AATGATGCAATGGTTAAATCAGACGAGTCTATTTTGGCTATCTATTCGAG C_familiaris300473 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG C_familiaris300474 CCAGGCGG--CCCCTACTCC-TTGCTGCGTTCTGTGGCA--GTTTTAAGG C_porcellus300740 CTCTGTGG--CCCTTGCT---GTCCTGTAT-CTGTGGTATAATCTC-AAG C_porcellus300924 TTTTGGTC------CATGACAGTACCATGTTCTGTGGTACTGCACGTGGG C_savignyi300000 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG C_savignyi300001 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG C_savignyi300007 ----------------------GTTCA-GTGATGACTGTTGA-TGACGAG D_rerio300128 TTTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300129 TTTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300130 TCTGAGGA--TT-CTGGGTCAGGTTCACGTTCTGTGCGTCTGGCTGCAGC D_rerio300262 TCTGAGGA--TT-CTGGGTCAGACTCACGTTCTGTGCGTCTGATTTCAAG D_novemcinctus300602 CCAGGTGA--CCAGGACTCT-GTGCTGCGTTCTGCGGCATAGTTTTTAAG D_melanogaster300176 TATGATGT--TAACAT-CATACTGAGTGCCTAAATCGATCTATTTTTGAT D_melanogaster300180 CTTGATGA--TAAACTACAAACTGAAACGTTGTTGTGGTCTATTTTTGAA D_melanogaster300188 AATGATGT--TAAACT-GTCACTGATAGTTGGACTTAATCTATTTTGGAG E_telfairi300833 CCAGGCGG--CT--TACTCT-GTGCTGCGTTCTGTGGCTCAGTGTCAAGG E_telfairi300834 TCTTGGTG------CTGGTCAGTGCCACGTTCTGTGGTCCTGGCCATCGC E_caballus300305 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG E_caballus300306 CCAGGAGG--CCCCTGCTCT-GTGCTGCGTTCTGTGGCGCAGGTGTAAGG E_europaeus300555 TCTTGGTC------CTTGCCAGTGCCATGTTCTGTGGTGCTATGCATGGG E_europaeus300556 CCAGGTGA--CTCCTACTCT-GTGCTGCGTTCTGTGGCATAGTTTTAAGG F_catus300284 CCGGGGGGGGCCCCTACTTC-GTGCCGCGTTCTGTGGCA--GTTTTAAGG F_catus300285 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGCGCATGGG G_gallus300036 GCCAGCACAGCC--TGGTCA-GTGCCATGTTCTGTGGTGCTGTACTAAGG G_gallus300037 CTGAGTGGTGCCCCTGCA---GTGTCACGTTCTGTGCTGCTGCATGTGGT G_aculeatus300115 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTGGTTCCGCTCCAG-T G_aculeatus300116 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTGGTTCTGCTCTAG-T G_aculeatus300117 TCTGAGGG--TT-CTGGTCCAGATTCACGTTCTGTGGTTCCGCTCCAG-T G_aculeatus300118 TCTGTGGG--TTACTGGTTCAGGTCCACGTCCTGTGGTTCGGCTCCAG-T H_sapiens300741 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGA H_sapiens300742 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGTGCACGAG L_africana300144 CCAGGTGG--CT--TACTCT-GTGCTGCGTTCTGTGGGGCAGGTTTAAGG L_africana300438 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTCCTGGTCATTGG M_mulatta300654 CCAGGTTG--CC--TACTCT-GTGCTGCATTCTGTGGCACAGTTTAAAGG M_mulatta300655 TCTTGGTC------CTTGTCAGTACCATGTTCTGTGGTGCTGTGCGTGAG M_murinus300177 TTTGGAGA---TTTATGCTTATTAAAAGTTTCCCTCGTGCTGTGCATGGG M_domestica300155 TCTGTACC---CCCTGGCTT--TGGCACGTTCTGTGCCACTGTGTGTGGG M_domestica300156 TCAGGTGT----TCTACTCTGGTTCTGCGTTCTGCAGGCCAGAATTCAGA M_musculus300759 TCTTGGTC------CCTGTCAGTGCCATGTTCTGTGGTGCTGTACATGGT M_musculus300760 CCAAGATG--CC-TCACT---ATGCTGCGTTCTGTGGCACAGCTGAAAGC O_cuniculus300273 CCTTGGGC------CGTGTCAGTGCCACGTCCTGTGGTGCTGTGCGTGGG O_latipes300073 TCTGGTTG--CT---GGTTCAGATCCACGTTCTGTGGTTCTGCTCAAAAG O_latipes300074 TCTGGTGG--CTCCTGGTCCAGATCCACGTTCTGTGGGTCCGCTTCAG-G O_garnettii300632 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGG P_troglodytes300471 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGA P_pygmaeus300738 CCAGGTGG--CC--TACTCT-GTGCTGCGTTCTGTGGCACAGTTTAAAGG P_pygmaeus300739 TCTTGGTC------CTTGTCAGTGCCATGTTCTGTGGTGCTGTGCACGAG R_norvegicus301084 TCTTGGGC------CCTGTCAGTGCCATGTTCTGTGGTGCTGTAAGTGCG R_norvegicus301085 CCAGGATG--CC-TCACT---GCGCTGCGTTCTGTGGCACAGTTGTGAGC S_cerevisiae300051 TATGATGAA-TATGAGTGCATTTGGCTCGAGTTGCTGTTTGGCTTTTGCC S_araneus300977 TCTGGGTC------CGTGTCGGTGCCACGTTCTGTGGTGCTGTGC-ACGG S_tridecemlineatus300015 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGC--AGG T_nigroviridis300140 TCTGTGGG--TGGCTGGTTCAGATCCACGTTCTGTGGCCCGGTGCCAG-C T_nigroviridis300141 TCTGCTGG--TCGCTGGTTCGGGGCCACGTTCTGTGGCTCTGCTCCGG-C T_belangeri300300 CCAGGCGG--CC-TTACTCT-G-GCTGCGTTCTGTAGCACAGTTTAAAGG T_belangeri300301 TCTTGGTC------CTTGTCAGTGCCACGTTCTGTGGTGCTGTGCCAAGG X_tropicalis300105 TCCAGTGG--TCCCTGTCT--GCATCACGTTCTGTGCTGTAGGCTGAAGC X_tropicalis300106 CAATGTAGTGTTTCCTGCACAGAGGCACGTTCTGTGTCGCTGTACTTGGC X_tropicalis300107 CAATGTAGTGTTTCCTGCACGGGGGCACGTTCTGTGTCGCTGGGCTTGGC X_tropicalis300108 CCCAGTCGG-----CGGAAG-GAGCTGCGTTCTGCCGCT--GCTTTTGCT C_elegans300045 TCCTAATAACCCAATGGGTTTCATT------GCGGATATGAGGCATTTGT C_elegans300046 TTCTTCGAAGA---AATTGCCGCTAAGCGGGGTGAAATTGAGGCATTTGT C_familiaris300473 TTCCTTTTGCA-AAAGTGTCCTGTTTATTGATTGATT-AGAGGCATTTGT C_familiaris300474 GTCCTTGGGTT--AAA-GTAACTTCCAAAGGACGATCTAGAGGCATTTGT C_porcellus300740 GT-------TC--AAA-GAAACTTCCAAAAGATAACCTGGAGGCATTAGT C_porcellus300924 TTCCTTTTGCA-AAAGTGTCCTGCTTATTGATTGATTTAGAGGCATTTGT C_savignyi300000 TCGTATTAACC--ATG---CCGACT------ATGTA-ACGAGGCATTTGT C_savignyi300001 TCGTATTAACC--ATG---CCGACT------ATGTA-ACGAGGCATTTGT C_savignyi300007 TCGTATTAACC--ATG---CCGACT------ATGTA-ACGAGGCATTTGT D_rerio300128 TCCTCAAAG-C--AGTAAGTCCTTTTGCTTGAAGACA--GAGGCATTTGT D_rerio300129 TCCTCAAAG-C--AGTGAGTCCTTTTGCTTGAAGACATAGAGGCATTTGT D_rerio300130 TCCTCAAAG-C--AGTGAGTCCTTTTGCTTGAAGACATAGAGGCATTTGT D_rerio300262 TCCTCGGAGAT--CATGCGTCCTCTAGATTGAAGATCTTGAGGCATTTGT D_novemcinctus300602 GTCCTTGGATC--AAA-GTAACTTCCAAACGATGACCTAGAGGCATTTGT D_melanogaster300176 TGATTC-TGGC---TTTTAAAAGGGATGTTCGCAGCTGCGAGGCATTTGT D_melanogaster300180 CACTTC--GAT---GTTACCTTGGGATGGTCGCACTTGCGAGGCATTTGC D_melanogaster300188 AGAGTCGTAAA---CTTTTCCTAGGATGTTCGCATTTGCGAGGCATTTGT E_telfairi300833 GTCCT-GGGTC--AGA-GTAACTTCCTAAAGATGACTTAGAGGCATTTGT E_telfairi300834 T--CTTTTGCT-GAGGTTTCCTGTTCGTTGGT-GATCTAGAGGCATTTGT E_caballus300305 TTCCTTTGGCA-AAAGTGTCCTGTTCATTGATTGATT-AGAGGCATTTGT E_caballus300306 GTCCT-GGGTC--AAA-GTAACTTCCAAAAGATGACCTAGAGGCATTTGT E_europaeus300555 TTCCATTTGCA-AAAGTGTCCTGTGCATTGATTGATT-AGAGGCATTTGT E_europaeus300556 GCTCT-GGGTC--AAG-CTATCTTCCAAAAGACGACATAGAGGCATTTGT F_catus300284 GCCCTCTGGTT--AAA-GTAACTTCCAAAGGACGACCTAGAGGCATTTGT F_catus300285 TTCCTTTTGCA-AAAGTGTCCTGTTCATTGATTGATT-AGAGGCATTTGT G_gallus300036 CTGCCTTGGGC-AGGATGTCCTCCTCATTGGTTGATTCAGAGGCATTTGT G_gallus300037 TCTTC--AGCA--GGAGCATCCCGTCGCTGAATGATTTAGAGGCATTTGT G_aculeatus300115 CCCTCAGAGCA-GGGAGTCCCTTTT-GATTGAAGACATTGAGGCATTTGT G_aculeatus300116 CCCTCAGAGCA-GGGAGTCCCTTTT-GATTGAAGACATTGAGGCATTTGT G_aculeatus300117 CCCTCAGAGCA-GGGAGTCCCTTTTTGGTTGAAGACATTGAGGCATTTGT G_aculeatus300118 TCCTCAGACCA-GGAAGTCTTCTTCTCAT-GAAGACACAGAGGCATTTGT H_sapiens300741 GCCCT--GGTT--GAA-GTAATTTCCTAAAGATGACTTAGAGGCATTTGT H_sapiens300742 TTCCTTTGGCA-GAAGTGTCCTATTTATTGATCGATTTAGAGGCATTTGT L_africana300144 ATCCT-GGGTC--AAA-GTGACTTCCTTAAGATGACCAAGAGGCATTTGT L_africana300438 TTCCTTTTGCA-AAGGTGTCCTGTTCATTGGTTGATTTAGAGGCATTTGT M_mulatta300654 GCCCT--GGTT--GAA-GTAACTTCCTAAAGATGACCTAGAGGCATTTGT M_mulatta300655 TTCCTTCTGCA-GAAGTGTCCTATTCATTGATTGATTTAGAGGCATTTGT M_murinus300177 TTCCTTTTGCA-AAGGTGTCCTGTTCATTGATTGATTTAGAGGCATTTCT M_domestica300155 GGTCT---TTGCAGAGGTGTCTGGACATTGGTTGATCTAGAGGCATTTGT M_domestica300156 CTCCT-GACTT--AAA-GTCATTTCCTTAAGAAGATCTAGAGGCATTTGT M_musculus300759 TCCCTTG-GCA-AAAGTGTCCTGCGCACTGATTGATTTAGAGGCATTTGT M_musculus300760 ACTGT--GGTC--AAAAGAAACTTCCTAAAGATGACCAAGAGGCATTTGT O_cuniculus300273 TTCCTTTGGCA-AAAATATCCTGTTCATTGCCTGATTTAGAGGCATTTGT O_latipes300073 TTATCAGAACCCGGCGGGTCCTTTTCAGCTGAAGACATCGAGGCATTTGT O_latipes300074 TCATCAGAACACGGCGGGGCCTTTTTGCCTGAAGACACTGAGGCATTTGT O_garnettii300632 TTCCTTTTGCA-AAAGTGTCCTGTTTATTGATTGATTTAGAGGCATTTGT P_troglodytes300471 GCCCT--GGTT--GAA-GTAATTTCCTAAAGATGACTTAGAGGCATTTGT P_pygmaeus300738 GCCCT--GGTT--GAA-GTAATTTCCTAAAGATGACTTAGAGGCATTTGT P_pygmaeus300739 TTCCTTTTGCA-GAAGTGTCCTATTTATTGATCGATTTAGAGGCATTTGT R_norvegicus301084 TCCCTTG-GCA-AAAGTGTCCTGCATACTGATTGATTTAGAGGCATTTGT R_norvegicus301085 ACTGT--GGTC--AAA-GAAACTTCCTAAAGATGACCAAGAGGCATTTGT S_cerevisiae300051 AAATCAGTAAC-GGTGTGGAAAAACTCAAGCTACCTTTTTTTACTTTTAT S_araneus300977 TTCCTTTTGCA-ATAGTGTCCTGGTAACTGATTGATT-AGAGGCATTTGT S_tridecemlineatus300015 GTCCTTTTGCA-A--GTGTCCTGTTCATTGATTGATTTAGAGGCATTTGT T_nigroviridis300140 CCCCCAGAGCG--GGCTGTCCTCGCCGTATGAAGACGCTGAGGCATTTGT T_nigroviridis300141 TCCGCAGAA-G--AGAGGCCGTGTCCCCCTGAAGACGCTGAGGCATTTGT T_belangeri300300 GCCCT--GGGC--AAA-GTCA-TTCCTAAAGATGACCTAGAGGCATTTGT T_belangeri300301 TTCCATTTGCA-AAAGTGTCCTGTCCATTGATTGATTTAGAGGCATTTGT X_tropicalis300105 CCACT-GAGTC--AAGGTTGCCCTTTGCTTGATGTCCATGAGGCATTTGT X_tropicalis300106 TGCACTGCATGAGATTTGTCCTTCTTACTGATCGATATTGAGGCATTTGT X_tropicalis300107 TGCACTGCATGAGATTTGTCCTTCTTACTGATCGATATTGAGGCATTTGT X_tropicalis300108 GTTGGGTTCTC--ATGAGAAAGTTGTGTGA-AGAGTCTTGAGGCATTTGT * ** C_elegans300045 CTGAGCGG-- C_elegans300046 CTGAGGTGA- C_familiaris300473 CTGAGAAGG- C_familiaris300474 CTGAGAAGG- C_porcellus300740 CTAAGAAGG- C_porcellus300924 CTGAGAAGG- C_savignyi300000 CTGAGAACC- C_savignyi300001 CTGAGAACC- C_savignyi300007 CTGAGAACC- D_rerio300128 CTGAGAAGG- D_rerio300129 CTGAGAAGG- D_rerio300130 CTGAGAAGG- D_rerio300262 CTGAGAAGG- D_novemcinctus300602 CTGAGAAGG- D_melanogaster300176 CTGATAAC-- D_melanogaster300180 CTGATGCTTA D_melanogaster300188 CTGATTCG-- E_telfairi300833 CTGAGAAGG- E_telfairi300834 CTGAGAAGG- E_caballus300305 CTGAGAAGG- E_caballus300306 CTGAGAAGG- E_europaeus300555 CTGAGAAGG- E_europaeus300556 CTGAGAAGG- F_catus300284 CTGAGAAGG- F_catus300285 CTGAGAAGG- G_gallus300036 CTGAGAAGG- G_gallus300037 CTGAGAAGG- G_aculeatus300115 CTGAGAAGG- G_aculeatus300116 CTGAGAAGG- G_aculeatus300117 CTGAGAAGG- G_aculeatus300118 CTGAGAAGG- H_sapiens300741 CTGAGAAGG- H_sapiens300742 CTGAGAAGG- L_africana300144 CTGAGAAGG- L_africana300438 CTGAGAAGG- M_mulatta300654 CTGAGAAGG- M_mulatta300655 CTGAGAAGG- M_murinus300177 CTGAGAAGG- M_domestica300155 CTGAGAAGG- M_domestica300156 CTGAGAAGG- M_musculus300759 CTGAGAAGG- M_musculus300760 CTGAGAAGG- O_cuniculus300273 CTGAGAAGG- O_latipes300073 CTGAGAAGG- O_latipes300074 CTGAGAAGG- O_garnettii300632 CTGAGAAGG- P_troglodytes300471 CTGAGAAGG- P_pygmaeus300738 CTGAGAAGG- P_pygmaeus300739 CTGAGAAGG- R_norvegicus301084 CTGAGAAGG- R_norvegicus301085 CTGAGAAGG- S_cerevisiae300051 CTGACC---- S_araneus300977 CTGAGAAGG- S_tridecemlineatus300015 CTGAGAAGG- T_nigroviridis300140 CTGAGAAGG- T_nigroviridis300141 CTGAGAAGG- T_belangeri300300 CTGAGAAGG- T_belangeri300301 CTGAGAAGG- X_tropicalis300105 CTGAGAAGG- X_tropicalis300106 CTGAGAAGG- X_tropicalis300107 CTGAGAAGG- X_tropicalis300108 CTGAGAAGA- ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved