snOPY snoRNA Orthological Gene Database

Family: SNORD14

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300141 -------------------------------------GTTAATGATGATA A_thaliana300142 ----------------------------------TCGGTTGATGAGGATT A_thaliana300143 -------------------------------------GTCGATGAGGATA A_thaliana300144 -------------------------------------ATCAATGATGATA C_elegans300051 CAAGCCTCCTGGCGCTGCTATTAGCCGGGATTCATAGGCTGGCGATGAT- C_familiaris300226 ---------------------------------------TTACAGTAAT- C_familiaris300335 ---------------------------------------TCGCTATGAT- C_familiaris300336 ---------------------------------------CCGCTGTGAT- C_familiaris300337 ---------------------------------------TCACGATGAT- C_porcellus300675 ---------------------------------------TCATTGTGAT- C_porcellus300905 ---------------------------------------TCACTGTGAT- C_porcellus300940 ---------------------------------------TCACTGTGAT- C_intestinalis300009 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300010 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300011 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300012 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300013 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300014 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300015 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300022 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300023 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_intestinalis300024 -----CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC- C_savignyi300003 -----CTGCAATGATGATGTATCCCAACATTCGCAGTTTCCACCAGACCA C_savignyi300004 -----TTGCAATGATGATGTATCCCAACATTCGCAGTTTCCACCAGACCT C_savignyi300005 -----TTGCAATGATGATGTATCCCAACATTCGCAGTTTCCACCAGACCT C_savignyi300006 -----ATGCAATGATGATGTATCCCAACATTCGCAGTTTCCACCAGACCA D_rerio300120 ---------------------------------------TCGCTATGAT- D_rerio300121 ---------------------------------------TCGCTATGAT- D_rerio300123 ---------------------------------------TCGCTGTGAT- D_novemcinctus300109 ---------------------------------------TCACAGTGAT- D_novemcinctus300252 ---------------------------------------TCACAATGAT- D_novemcinctus300473 ---------------------------------------TCACAATGAT- D_novemcinctus300601 ---------------------------------------TCACAGTGAT- D_melanogaster300046 ---------------------------------------ATAAACTGATG D_melanogaster300047 ---------------------------------------TTTTACTGATG E_telfairi300200 ---------------------------------------TCACAATGAT- E_telfairi300412 ---------------------------------------TTGCTGTGAT- E_telfairi300572 ---------------------------------------TCACTGTGAT- E_telfairi300688 ---------------------------------------TCACAATGAT- E_telfairi300689 ---------------------------------------TCGCTATGAT- E_telfairi300690 ---------------------------------------TTGCTATGAT- E_caballus300298 ---------------------------------------TCACAGTGAT- E_caballus300299 ---------------------------------------CCGCTGTGAT- E_caballus300300 ---------------------------------------TCGCTGTGAT- E_caballus300310 ---------------------------------------TCATTATGGT- E_caballus300311 ---------------------------------------TTACTATGGT- E_europaeus300152 ---------------------------------------TCACTGTGAT- E_europaeus300283 ---------------------------------------TCGTTAAGAT- E_europaeus300329 ---------------------------------------TCACAATGAT- E_europaeus300499 ---------------------------------------TCACAATGAT- E_europaeus300632 ---------------------------------------TCGCTATGAT- F_catus300225 ---------------------------------------TCATTATGAT- F_catus300226 ---------------------------------------TCACTCTGTT- F_catus300317 ---------------------------------------TCACAATGAT- F_catus300318 ---------------------------------------CTGCTATGAT- F_catus300319 ---------------------------------------TCGCTATGAT- G_gallus300068 -------------------------------------------------- G_gallus300069 -------------------------------------------------- G_gallus300070 -------------------------------------------------- G_aculeatus300083 ---------------------------------------TCGCTGTGAT- G_aculeatus300084 ---------------------------------------TCGCTGTGAT- G_aculeatus300085 ---------------------------------------TCGCTGTGAT- G_aculeatus300086 ---------------------------------------TCGCTGTGAT- G_aculeatus300107 ---------------------------------------TCGCAGTGAT- H_sapiens300494 ---------------------------------------TCACTGTGAT- H_sapiens300736 ---------------------------------------TCACTATGAT- H_sapiens300737 ---------------------------------------TCACTGTGAT- H_sapiens300754 ---------------------------------------TCGCTATGAT- L_africana300364 ---------------------------------------TCACTATGAT- M_mulatta300632 ---------------------------------------TCACAGTGAT- M_mulatta300647 ---------------------------------------CCACTGGGAT- M_mulatta300648 ---------------------------------------TCACTATGAT- M_mulatta300666 ---------------------------------------TCACAATGAT- M_mulatta300667 ---------------------------------------TCGCTATGAT- M_mulatta300668 ---------------------------------------TCGCTGTGAT- M_murinus300488 ---------------------------------------TCACTGTGAT- M_murinus300489 ---------------------------------------TCACTGTGAT- M_murinus300509 ---------------------------------------TCACAATGAT- M_murinus300510 ---------------------------------------CCGCTGTGAT- M_murinus300511 ---------------------------------------TCACTGTGAT- M_domestica300150 ---------------------------------------TTGCTGTGAT- M_domestica300151 ---------------------------------------TTGCTGTGAT- M_domestica300152 ---------------------------------------CTGCTATGAT- M_domestica300153 ---------------------------------------TTGCTGTGAT- M_musculus300562 ---------------------------------------TCACAGTGAT- M_musculus300887 ---------------------------------------TCGCTGTGAT- M_musculus300888 ---------------------------------------TCGCTGTGAT- M_musculus300889 ------------------------------------TCACAATGATGAT- M_lucifugus300015 ---------------------------------------CCGCTGTGAT- M_lucifugus300621 ---------------------------------------TCACTATGAT- M_lucifugus300989 ---------------------------------------TCACTGTGAT- O_anatinus304073 ---------------------------------------TTGCTATGAT- O_anatinus304074 ---------------------------------------CTGCTGTGAT- O_anatinus304075 ---------------------------------------TCGCTGTGAT- O_anatinus304076 ---------------------------------------TCGCTGTGAT- O_anatinus304077 ---------------------------------------TCGCTGTGAT- O_anatinus304379 ---------------------------------------TCACTGTGAT- O_anatinus304380 ---------------------------------------TCACCGTGAT- O_cuniculus300220 ---------------------------------------CTGCTATGAT- O_cuniculus300254 ---------------------------------------TGGCTTTGAG- O_cuniculus300337 ---------------------------------------CTGCTATGAT- O_cuniculus300368 ---------------------------------------GCAGCGTGAT- O_cuniculus300468 ---------------------------------------TCACCGTGAT- O_cuniculus300500 ---------------------------------------GCGCTGTGAT- O_cuniculus300501 ---------------------------------------CCGCTATGAT- O_cuniculus300517 ---------------------------------------TCACAATGAT- O_cuniculus300518 ---------------------------------------GCGCTGTGAT- O_cuniculus300519 ---------------------------------------CCGCTATGAT- O_sativa300168 ------------------------------------TGCAAATGATGCTA O_sativa300160 ------------------------------------TGGCAATGATGATA O_sativa300169 ------------------------------------TGCAAATGATGCTA O_sativa300001 ------------------------------------GGCAAATGATGCTA O_sativa300000 ------------------------------------TGGCAATGATGATA O_sativa300113 ------------------------------------GCCCAGTGATGATG O_sativa300114 ------------------------------------TGGCGATGATGATA O_sativa300115 ------------------------------------GGCAAATGATGATG O_sativa300161 ------------------------------------TGGCAATGATGATA O_sativa300162 ------------------------------------TGGCAATGATGATA O_sativa300163 ------------------------------------TGGCAATGATGATA O_sativa300166 ------------------------------------TGCAAATGATGCTA O_sativa300167 ------------------------------------TGCAAATGATGCTA O_latipes300010 ---------------------------------------TCACTGTGAT- O_latipes300011 ---------------------------------------TCGCTGTGAT- O_latipes300012 ---------------------------------------TCGCTGTGAT- O_latipes300013 ---------------------------------------TCGCAATGAT- O_garnettii300744 ---------------------------------------TCACTATGAT- O_garnettii300745 ---------------------------------------TCACTATGAT- P_troglodytes300003 ---------------------------------------TCACAATGAT- P_troglodytes300128 ---------------------------------------GAGTGCTTATT P_troglodytes300129 ---------------------------------------GAGTGCTTATT P_troglodytes300593 ---------------------------------------TCACTGTGAT- P_troglodytes300662 ---------------------------------------TCACTATGAT- P_troglodytes300663 ---------------------------------------TCACTGTGAT- P_troglodytes300676 ---------------------------------------TCACAATGAT- P_troglodytes300677 ---------------------------------------TCGCTATGAT- P_troglodytes300678 ---------------------------------------TCGCTGTGAT- P_patens300014 ------------------------------------GGTCGATGATGAAG P_patens300016 ------------------------------------AGTCGATGACGATA P_patens300021 ------------------------------------AGTCGATGACAATA P_patens300030 ------------------------------------AGACTGTGATGATG P_patens300049 ------------------------------------AGTCGGTGACGATG P_patens300052 ------------------------------------AGTCGGTGACGATG P_patens300055 ------------------------------------AGTCGGTGACGATG P_patens300058 ------------------------------------AGTCGGTGACAATG P_patens300071 ------------------------------------AGTCGATGACGATA P_patens300074 ------------------------------------AGTCGATGACGATA P_patens300008 ------------------------------------GGTTGATGATGATA P_pygmaeus300132 --------------------------------------------TCACT- P_pygmaeus300189 ---------------------------------------TTCCTGTGATG P_pygmaeus300679 ---------------------------------------TCACTGTGAT- P_pygmaeus300734 ---------------------------------------TCACTGTGAT- P_pygmaeus300742 ---------------------------------------TCACAATGAT- P_pygmaeus300743 ---------------------------------------TCGCTATGAT- P_pygmaeus300744 ---------------------------------------ACTCACTGAT- P_pygmaeus300735 ---------------------------------------TCACTATGAT- P_pygmaeus300094 ---------------------------------------GAGTGCTTATT P_pygmaeus300131 ---------------------------------------TCGCTATGAT- R_norvegicus300867 ---------------------------------------TCGCTGTGAT- R_norvegicus300868 ---------------------------------------TCGCTGTGAT- R_norvegicus300869 ---------------------------------------TCACTATGAT- R_norvegicus301089 ---------------------------------------TCACTGTGAT- S_cerevisiae300053 ---------------------------------------TCACGGTGATG S_pombe300079 --------------------------------------AACA-GGTGATG S_araneus300960 ---------------------------------------TCACAGTGAT- S_araneus300961 ---------------------------------------TCGCTGTGAT- S_araneus300962 ---------------------------------------TCGCTGTGAT- S_tridecemlineatus300323 ---------------------------------------TCGCTGTGAT- S_tridecemlineatus300091 ------------------------------------------CTTTGATA S_tridecemlineatus300260 ---------------------------------------TCACTATGAT- S_tridecemlineatus300321 ---------------------------------------TCACAGTGAT- S_tridecemlineatus300322 ---------------------------------------TCGCTGTGAT- T_nigroviridis300161 ---------------------------------------ACGCTGTGAT- T_nigroviridis300163 ---------------------------------------TCGCTGTGAT- T_nigroviridis300164 ---------------------------------------TCGCTGTGAT- T_dicoccoides300006 ------------------------------------TGGTGATGATGATA T_dicoccoides300010 ---------------------------------CAATGGTGATGATGATA T_dicoccoides300042 ------------------------------------TGGCGATGATGGTA T_dicoccoides300036 ------------------------------------CGGTGATGATGATA T_belangeri300318 ---------------------------------------TCGCTATGAT- T_belangeri300319 ---------------------------------------TCGCTATGAT- T_belangeri300393 ---------------------------------CCAAACTCACTATGA-- X_tropicalis300000 ---------------------------------------TCACAGTGAT- X_tropicalis300070 ---------------------------------------TCACAGTGAT- X_tropicalis300113 ---------------------------------------TCGCTATGAT- X_tropicalis300114 ---------------------------------------TTGCTAAGAT- X_tropicalis300115 ---------------------------------------TCGCTGTGAT- X_tropicalis300131 ---------------------------------------TCACAGTGAT- A_thaliana300141 AATCCAAAGGCTTGTTTTTCAAA---CATTCGCAGTGGCCGCCTAAGAGC A_thaliana300142 ATATTAA-GGCTTGTTTCTCAAAA--CATTCGCAGTGGCCGCCTAA-AGC A_thaliana300143 AGATGAA-GGCTTGTTTCTCAAAA--CATTCGCAGTGGCCGCCTAA-GGC A_thaliana300144 AACTTAA-GGCTTGTTTCTCAAAA--CATTCGCAGTGGCCGCCTAA-AGC C_elegans300051 TGA-----GATTGTTCCC---------ACACGCAATTT-CTCCTGA---- C_familiaris300226 GAA----TGGTCCAAA-C---------ATCTGACATTTACACCAGAAT-- C_familiaris300335 GAT--TGATTCTTTAAAC---------ATTCGTAGTTTCCACCAAAAG-- C_familiaris300336 GATA-TGACCT-A-AACC---------ATTCGTAGTTTCCACCAGAAG-- C_familiaris300337 GAA-----TGGTCCAAAC---------ATTCGCGGTTTCCACCAGAAT-- C_porcellus300675 GATG---GATTCCAAAAC---------ATTTGAAATTTCCATCCGAAA-- C_porcellus300905 GAT--GGATTCCAAAAACC--------ATTCGTAGTTTCCACCAGAAA-- C_porcellus300940 GATT---GATATCCAAAC---------ATTCGCAGTTTCCACCAGAAA-- C_intestinalis300009 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCT-- C_intestinalis300010 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCT-- C_intestinalis300011 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300012 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCT-- C_intestinalis300013 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300014 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300015 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300022 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300023 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_intestinalis300024 GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCC-- C_savignyi300003 GAGATAAACTTAATATACAGGAGGGTAAAACTTGCTGTATATTATGTT-- C_savignyi300004 GAGATAAACTTAATATACAGGAGGATAAAACTTGCTGTATATTTTGTT-- C_savignyi300005 GAGATAAACTTAATATACAGGAGGATAAAACCTGCTGTATATTTTGTT-- C_savignyi300006 GAGATAAACTTAATATACAGGAGGATAAAACTTGCTGTATATTATGTT-- D_rerio300120 GAAGTTTATTCCTT-GCC---------ATTCGTAGTTTCCACCAGAGG-- D_rerio300121 GAAGTTTATTCCTT-GCC---------ATTCGTAGTTTCCACCAGAGG-- D_rerio300123 GAAGTTTATTCCTT-GCC---------ATTCGTAGTTTCCACCAGAGG-- D_novemcinctus300109 GAA----TTGTCCAAA-C---------ATTCACATTTTCCACCAGAAT-- D_novemcinctus300252 GAA----TTGTCCAAA-C---------ATTCGCAGTTTCCACCAGAAT-- D_novemcinctus300473 GAAA---CTGTCCAAA-C---------ATTCACAGTTTCCACCAAAAT-- D_novemcinctus300601 GAA----TTGCCCAAA-C---------ATTCGCAGTTTCCACCAGAAT-- D_melanogaster300046 ATT----ACCTTAAACACC--------TTTTGCGGTTTCCACCAGAAA-- D_melanogaster300047 ATT----AACTTCAACACC--------TTTTGCGGTTTCCACCAGAAA-- E_telfairi300200 GAA----TGGTCCAAAAC---------ATTCGCGGTTTCCACCAGAAT-- E_telfairi300412 GAT--TGATTCCTACCCA----------TTCATAGTTTCCACCAAAAG-- E_telfairi300572 GACT---GACTTC-CAAC---------ATTCGCAGTTTCCACCAGAAG-- E_telfairi300688 GAA----GGGTCCCAAAC---------ATTCGCAGTTTCCACCAGAAT-- E_telfairi300689 GAT--GGATTCCATAACC---------ATTCGTAGTTTCCACCAGAAA-- E_telfairi300690 GAT--TGATTCCTAACCA----------TTCGTAGTTTCCACCAAAAG-- E_caballus300298 GAA----TGGTCCAAA-C---------ATTCGCGGTTTCCACCAGAAT-- E_caballus300299 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- E_caballus300300 GAA--TGATTCTT-AAAC---------ATTCGTAGTTTCCACCAAAAG-- E_caballus300310 GCTT---AATTTACAAAC---------ATTCA--GTTTCCACCAGAAA-- E_caballus300311 GCTG---GTCTTCCAG-C---------ACTCGCAGTTTCCACCAGAAG-- E_europaeus300152 GATC---GATTTCCAA-C---------ATTCGCAGTTTCCACCAGAAA-- E_europaeus300283 TCA------TTTTA---------------TTGTAGTTTCCACCAGAAC-- E_europaeus300329 -GA-----GTGGCCCAAC---------ACGTGCAGTTGACACCAGAAT-- E_europaeus300499 GAA----TGGTCCA-AAC---------ATTCGCGGTTTCCACCAGAAT-- E_europaeus300632 GAA--TGATTATTTAAAC---------ATTCGTAGTTTCCACCAAAAG-- F_catus300225 GATT---AATTTCTAAAC---------ATTCACAGGTTTCACTAGAAG-- F_catus300226 GATA---AGCA-CCAG-C---------ATTGGCAGTTTCCTCCAGAAC-- F_catus300317 GAA----TGGTCCA-TAC---------ATTCGCGGTTTCCACCAGAAC-- F_catus300318 GAT--CGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- F_catus300319 GAG--TGATTCTT-AAAC---------ATTCGTAGTTTCCACCAAAAG-- G_gallus300068 -------------------------------------------------- G_gallus300069 -------------------------------------------------- G_gallus300070 -------------------------------------------------- G_aculeatus300083 GACGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- G_aculeatus300084 GAGGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- G_aculeatus300085 GAGGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCTGAGG-- G_aculeatus300086 GAGGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- G_aculeatus300107 GATGTTTATTCCT--GCC---------ATTCGTAGTTTCCACCAGAGG-- H_sapiens300494 GATG---GTTTTTCAA-C---------GTTCACAGTTTCCACCAGAAA-- H_sapiens300736 GATT---GGTTGCCAGAC---------ATTCGCAGTTTCCACCAGAAA-- H_sapiens300737 GATG---GTTTTCCAA-C---------ATTCGCAGTTTCCACCAGAAA-- H_sapiens300754 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAA-- L_africana300364 GATT---GATTTCCAAAC---------ATTCGCAGTTTCCACCAGAAA-- M_mulatta300632 GATG---GTTTTTCAG-C---------GTTCACAATTTCCACCAGAAA-- M_mulatta300647 GATA---GTTTTCCAG-C---------ATTCTTAGTTTCCACCAGAAA-- M_mulatta300648 GATT---GATTGCCAGAC---------ATTCGCAGTTTCCACCAGAAA-- M_mulatta300666 GAA----TGGTCCAAAAC---------ATTCGCGGTTTCCACCAGAAT-- M_mulatta300667 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAA-- M_mulatta300668 GAG--TGATTGTTAAACA----------TTCGTAGTTTCCACCAAAAG-- M_murinus300488 GATT---GATT-CCAAAC---------ATTCGCAGTTTCCACCAGAAA-- M_murinus300489 GATG---GTTTTCCAA-C---------ATTCGCAGTTTCCACCAGAAG-- M_murinus300509 GAA----TGGTCCA-AAC---------ATTCGCGGTTTCCACCAGAAT-- M_murinus300510 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAT-- M_murinus300511 GAG--TAATGAATTAAA---------CATTTGTAGTTTCCACCAAAAG-- M_domestica300150 GATATTGGTACCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- M_domestica300151 GA-AT--GTTCCAAAACC---------ATTCGTAGTTTCCACCGGAAG-- M_domestica300152 GAAAGTGATGC-AAAACC---------ATTCGTAGTTTCCACTAGAAG-- M_domestica300153 GAAAGTGTTCCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- M_musculus300562 GATG---GTGTTCCAA-C---------ATTCGCAGTTTCCACCAGAAG-- M_musculus300887 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAA--- M_musculus300888 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAA--- M_musculus300889 GAA----TGGTCCAAA-C---------ATTCGCGGTTTCCACCAGAAC-- M_lucifugus300015 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- M_lucifugus300621 GATG---GTCTTCCAA-C---------ATTCGCAGTTTCCACCAGAAG-- M_lucifugus300989 GATT---GATTTCCAAAC---------ATTCGCAGTTTCCACCAGAAA-- O_anatinus304073 AGATT-----CCAAAACC---------ATTTGTAGTTTCCACCAGAAG-- O_anatinus304074 GCAATG---TTCCAAACC---------ATTCGTAGTTTCCACCTGAAG-- O_anatinus304075 GAAAATGACCCCA-AACC---------ATTCGTAGTTTCCACCAGAAG-- O_anatinus304076 GAATGC--TTCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- O_anatinus304077 GA-GTATTTCCAAA-ACC---------ATTCGTAGTTTCCACCAGAAG-- O_anatinus304379 GATT---GCTTCCATACC---------ATTCGCAGTTTCCACCAGAAA-- O_anatinus304380 GATG---GTTC-CAAACC---------ATTCGCAGTTTCCACCAGAAA-- O_cuniculus300220 GAG--TGATCCTTAACCAA---------TTTGTAGTTTCCACCAAAAG-- O_cuniculus300254 GCA--GGAGTTTTAAGAGCTGACGTGTATTTATAGTTTCCACCAAAAG-- O_cuniculus300337 GAG--AGATTCTTAAA----------TATTTGTAGTGTCCACTAAAAG-- O_cuniculus300368 GAT--GGATTCCAAAA-CC--------ATTCGTAGTTTCCACAAGAAT-- O_cuniculus300468 GATG---GTCCTCCAC-C---------ATTCGCAGTTTCCACCAGAAA-- O_cuniculus300500 AGATT-----CCAAAACC---------ATTCGTAGTTTCCACCAGAAT-- O_cuniculus300501 GAG--TGATCCTTAACCA----------TTCGTAGTTTCCACCAAAAG-- O_cuniculus300517 GAA----TGGTCCAAAAC---------ATTCGCGGTTTCCACCAGAAC-- O_cuniculus300518 AGATT-----CCAAAACC---------ATTCGTAGTTTCCACCAGAAT-- O_cuniculus300519 GAG--TGATCCTTAACCA----------TTCGTAGTTTCCACCAAAAG-- O_sativa300168 TAATCAA-GGCTTGTTTCTCATGA--AATTCGCAGTTGCCGCCTAAGAGC O_sativa300160 AATTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300169 TAATCAA-GGCTTGTTTCTCATGA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300001 AAAGCAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300000 AATTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300113 AAAACAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300114 AACTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300115 AAATCAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300161 AATTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300162 AATTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300163 AATTTAA-GGCTTGTTTCTCATAA--CATTCGCAGTTGCCGCCTAAGAGC O_sativa300166 TAATCAA-GGCTTGTTTCTCATGA--AATTCGCAGTTGCCGCCTAAGAGC O_sativa300167 TAATCAA-GGCTTGTTTCTCATGA--AATTCGCAGTTGCCGCCTAAGAGC O_latipes300010 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCTGAGG-- O_latipes300011 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- O_latipes300012 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- O_latipes300013 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- O_garnettii300744 GATT---GATTTCCAAAC---------ATTTGCAGTTTCCACCA-AAA-- O_garnettii300745 GATG---GTTTTCCAA-C---------ATTCGCAGTTTCCACCAGAAG-- P_troglodytes300003 GAA----TGGTCCACAAC---------ATTCGCGGTTTCCACCAGAAT-- P_troglodytes300128 AGTGTGACTTTCTTAGTCACAATT--CATACACAGTGACCACGGGAGAG- P_troglodytes300129 AGTGTGACTTTCTTAGTCACAATT--CATACACAGTGACCACGGGAGAG- P_troglodytes300593 GATG---GTTTTTCAA-C---------GTTCACAGTTTCCACCAGAAA-- P_troglodytes300662 GATT---GGTTGCCAGAC---------ATTCGCAGTTTCCACCAGAAA-- P_troglodytes300663 GATG---GTTTTCCAA-C---------ATTCGCAGTTTCCACCAGAAA-- P_troglodytes300676 GAA----TGGTCCACAAC---------ATTCGCGGTTTCCACCAGAAT-- P_troglodytes300677 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAA-- P_troglodytes300678 GAG--TGATTGTTAAACA----------TTCGTAGTTTCCACCAAAAG-- P_patens300014 AATCC-TAGGCTTGTTTCCTAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300016 AACCTTCAGGCTTGTTTCTCAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300021 AACCTTTAGGCTTGTTTCTGAAA---CATTCGCAGTGGCCGTCTAA-AGC P_patens300030 AACTTCTAGGCTTGTTTCTCGAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300049 AACTCATAGGCTTGTTTCTCAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300052 AACTCATAGGCTTGTTTCTCAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300055 AACTCATAGGCTTGTTTCTCAAA---AATTCGCAGTGGCCGCCTAA-AGC P_patens300058 AACTCATAGGCTTGTTTCTCAAA---CATTCACAATGGCCGCCTAA-AGC P_patens300071 AATCTCTAGGCTTGTTTCTCAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300074 AATCTCTAGGCTTGTTTCTCAAA---CATTCGCAGTGGCCGCCTAA-AGC P_patens300008 ATCCCACTGGCTTGCTTCTCAAA---CATTCGCAGTGGCCACCTAA-AAC P_pygmaeus300132 GAG--TGATTGTTAAACA----------TTCGTAGTTGCCACCAAAAG-- P_pygmaeus300189 AAT---CAGTTGCAAAACC--------ATTTGTAGTTTCCATCTAAAT-- P_pygmaeus300679 GATG---GTTTTTCAA-C---------GTTCACAATTTCCACCAGAAA-- P_pygmaeus300734 GATG---GTTTTCCAA-C---------ATTCGCAGTTTCCACCAGAAA-- P_pygmaeus300742 GAA----TGGTCCAAAAC---------ATTCGCGGTTTCCACCAGAAT-- P_pygmaeus300743 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAA-- P_pygmaeus300744 GAG--TGATTGTTAAACA----------TTCGTAGTTGCCACCAAAAG-- P_pygmaeus300735 GATT---GATTGCCAGAC---------ATTCGCAGTTTCCACCAGAAA-- P_pygmaeus300094 AGTGTGACTTTCTTAGTCACAATT--CATACACAGTGACCATGGGAGAG- P_pygmaeus300131 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAA-- R_norvegicus300867 GAT--TGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAA--- R_norvegicus300868 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAA--- R_norvegicus300869 GAA----TGGTCCA-AAC---------ATTCGCGGTTTCCACCAGAAT-- R_norvegicus301089 GATG---GTGTTCCAA-C---------ATTCGCGGTTTCCACCAGAAG-- S_cerevisiae300053 AAAGACTGGTTCCTTAAC---------ATTCGCAGTTTCCACGGTAGGAG S_pombe300079 AAATTTCCATTG---AAC---------ATTCGCAGTTTCCCCGGAGCG-- S_araneus300960 GAA----TGGTCCAAAAC---------ATTCGCGGTTTCCACCAGAAT-- S_araneus300961 GAC--TGATTCCACAACC---------ATTCGTAGTTTCCACCAGAAA-- S_araneus300962 GAA--TGATTATT-AAAC---------ATTCGTAGTTTCCACCAAAAG-- S_tridecemlineatus300323 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAA--- S_tridecemlineatus300091 CATA--TAATTTCAAAAC---------ATTGGTAGTTTCCACAAAAAT-- S_tridecemlineatus300260 GATT---GCTATCCAA-C---------ATTCGCAGTTTCCACCAGAAA-- S_tridecemlineatus300321 GAA-----AGGTCCAAAC---------ATTCGCAGTTTCCACCAGAAT-- S_tridecemlineatus300322 GAT--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAC-- T_nigroviridis300161 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- T_nigroviridis300163 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- T_nigroviridis300164 GATGTC-ATTTCCT-GCC---------ATTCGTAGTTTCCACCAGAGG-- T_dicoccoides300006 AATTTAA-GGCTTGTTTCTCAAAA--CGTTCACAGATGCCGCCTAAGAGC T_dicoccoides300010 TAACTAA-GGCATGTTTCTCAAAA--CATTCGCAGATGCCGCCTAAGAGC T_dicoccoides300042 GAACTAA-GGCTTGTTTCTCAAAA--CATTCGCAGACGCCGCCTAAGAGC T_dicoccoides300036 AATTTAA-GG-TTGTTTCTCAAAA--CATTCGCAGATGCCGCCTAAGAGC T_belangeri300318 GAC--GGATTCCAAAACC---------ATTCGTAGTTTCCACCAGAAG-- T_belangeri300319 GAA--TGATTGATCAAAC---------ATTCGTAGTTTCCACCAGAAG-- T_belangeri300393 GATG---GTCTTCCAG-C---------ATTTGCAGTTTCCACCAGAAG-- X_tropicalis300000 GATT---GGTTTCCAGTC---------ATTCGCAGTTTCTACCAGAAA-- X_tropicalis300070 GATT---GGTTTCCAGTC---------ATTCGCAGTTTCTACCAGAAA-- X_tropicalis300113 GAACTTGATTCCAAAGCC---------ATTCGTAGTTTCCACCAGATG-- X_tropicalis300114 GAATATGATTCCAAAGCC---------ATTCGTAGTTTCCACCAGATG-- X_tropicalis300115 GAATTTGATTCCAAAGCC---------ATTCGTAGTTTCCACCAGATG-- X_tropicalis300131 GATT---GGTTTCCAGTC---------ATTCGCAGTTTCTACCAGAAA-- A_thaliana300141 TTTCGCCTTT--CGCCAGGCTTGA--------GAGTTAATGCTG-TTTTA A_thaliana300142 TTTCGCCTTT--CGCCAGGCTTGA--------GAGCTAATGCAG-CTTTA A_thaliana300143 TTTCGCCTTT--CGCCGGGCTTGA--------GAGCTTATGATGTTTTTA A_thaliana300144 TTTCGCCTTT--CGCCGGGCTTGA--------GAGTTAATGCAGCTTTTA C_elegans300051 ----TCCAC-------ATGAAGG-----------------CT-AA-A--- C_familiaris300226 ----TTTAGA----T-GTGCTGG-----------------CA-ACTAACT C_familiaris300335 -----CTTA---GCTAATGATGG-----------------TC-------- C_familiaris300336 ----AT-------TTTGTGTTGG-----------------CC------AA C_familiaris300337 ----TCCAC-------GTGTTGG-----------------CA-ACTAGCT C_porcellus300675 ----GACTTT-TTCTCATGTTGG-----------------CCAG------ C_porcellus300905 ----TT--------TTGTGTTGG-----------------CTA------G C_porcellus300940 ----GGTTTT--CCTCATGTTGG-----------------TTGT------ C_intestinalis300009 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300010 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300011 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300012 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300013 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300014 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300015 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300022 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300023 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_intestinalis300024 ----AACTCTC-ATTAATGATGG-----------------TTTA---ACG C_savignyi300003 ----GATTCTCGATTTATGATGG-----------------TTTA---ATG C_savignyi300004 ----GATTCTCGATTTATGATGG-----------------TTTA---ATG C_savignyi300005 ----GATTCTCGATTTATGATGG-----------------TTTA---ATG C_savignyi300006 ----GATTCTCGATTTATGATGG-----------------TTTA---ATG D_rerio300120 ----TTGAAA-AACCAAAGATGG-----------------CCC----AAG D_rerio300121 ----TTGAAA-AACCAAAGATGG-----------------TCC----AAG D_rerio300123 ----TTGAAA-AACCAAAGATGG-----------------CCC----AAG D_novemcinctus300109 ----TTAACT----T-GTGTTTG-----------------TA-CACTAGC D_novemcinctus300252 ----TTAACT----T-GTGTTGG-----------------CATAGGTACC D_novemcinctus300473 ----TCACCT----T-GTGTTGG-----------------AACATCAGC- D_novemcinctus300601 ----TTAACT----T-GTGTTGG-----------------CATAGGTAGC D_melanogaster300046 ----GCTTCG-GCTTAAGGATGG-----------------TCTA-----A D_melanogaster300047 ----GCTTCG-GCTTAATGATGG-----------------TCTA-----A E_telfairi300200 ------GACT----T-GTGTTGG-----------------C--------- E_telfairi300412 ----CTTTGT--GCTCATAATGG-----------------TT-------- E_telfairi300572 ----GGTTTCC---CCCTTATGT-----------------TGTGCTA--- E_telfairi300688 ------GACT----T-GAGTTGG-----------------C--------- E_telfairi300689 ----TCA-------TTACTGTTG-----------------GCA------G E_telfairi300690 ----CTTTGT--GCTCATGATGG-----------------CT-------- E_caballus300298 ----AACAAA----T-GT--TGG-----------------CA-GCTAGC- E_caballus300299 ----TC--------TTGTGTTGG-----------------CCA------A E_caballus300300 -----CTTA---GCTAATGATGG-----------------CC-------- E_caballus300310 ----AGTTTT-TCTTTATGTTGA-----------------CCAG------ E_caballus300311 ----CGTTTT----CCTTGCTGT-----------------TGGG-TAAA- E_europaeus300152 ----G---TT-GGCTGATGTTGG-----------------TCGT------ E_europaeus300283 ----TCT-------TTGTGTTGG-----------------CAAG------ E_europaeus300329 ----TTCAG-------ATGTTGG-----------------CA-ACTA--- E_europaeus300499 ----TTTAG-------ATGTTGG-----------------TA-ACTTA-- E_europaeus300632 ----CTTTT---GCTAATGATGG-----------------CC-------- F_catus300225 ----GGTTTT-TCCTTATGTTGG-----------------CCGG------ F_catus300226 ----GGTTTT----CCTTAGTGC-----------------TGGG-TAAA- F_catus300317 ----TTCAG-------ATGTTGG-----------------CA-ACTTAGA F_catus300318 ----CC--------TTGTGTTGG-----------------CCA------A F_catus300319 ----CTTAA---GCTGATGATGG-----------------TC-------- G_gallus300068 -------------------------------------------------- G_gallus300069 -------------------------------------------------- G_gallus300070 -------------------------------------------------- G_aculeatus300083 ----TC-AACAGACCGGTGACGG-----------------TCC----AA- G_aculeatus300084 ----TCCAACAGACCAGTGACGG-----------------TCC----AA- G_aculeatus300085 ----TCCAACAGACCGGTGACGG-----------------TCC----AA- G_aculeatus300086 ----TCCAACGGGCCGATGACGG-----------------TCC----AA- G_aculeatus300107 ----TTGCAA-GACCGAAGAGGG-----------------CCC----CG- H_sapiens300494 ----GATTTT----CCTTAGTGT-----------------TCGG-TAAA- H_sapiens300736 ----TGTTTT-TCCTTATGTTGG-----------------CCAG------ H_sapiens300737 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAA- H_sapiens300754 ----GTC-------TTATGTTGG-----------------CCA------G L_africana300364 ----GGTTTT-TCCTTGTGTTGG-----------------CCAG------ M_mulatta300632 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAA- M_mulatta300647 ----GGTTTT----CCTTAGTCT-----------------TGGG-TAAA- M_mulatta300648 ----GGTTTT-TCCTTTTGTTGG-----------------CCAG------ M_mulatta300666 ----TCAAG-------GTGTTGG-----------------CA-ACTA--- M_mulatta300667 ----GTC-------TTATGTTGG-----------------CCA------G M_mulatta300668 -----CTTG---GCTAATGATGG-----------------CAA------- M_murinus300488 ----GGTCTT-TCCTTGTGTTGG-----------------CCAG------ M_murinus300489 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAAA M_murinus300509 ----TCAAAT----C-ATGTTGG-----------------CA-ACTA--- M_murinus300510 ----TC--------CTGTGTTGG-----------------CCA------A M_murinus300511 -----CTTG---GCTGATGATGG-----------------CC-------- M_domestica300150 ----CTT-----GCTAATGATGG-----------------C------AAG M_domestica300151 ----CTT-----GCTGATGATGG-----------------CC-----AAG M_domestica300152 ----TTGAAA-AACTAATGTTGG-----------------CATT---AAG M_domestica300153 ----TCTTG---ACTTGTGTTGG-----------------C------AAG M_musculus300562 ----GACTTT----CC---ATGT-----------------TGGG-TTGA- M_musculus300887 -----------GTACTGTGTTGG-----------------CTA------G M_musculus300888 -----------ATGCTGTGTTGG-----------------CTA------G M_musculus300889 ----GCAAGG----CAGTGTTGG-----------------CA-GTTA--- M_lucifugus300015 ----TC--------CTGTGTTGG-----------------CCA------A M_lucifugus300621 ----GGTTTT----CCTTAGTGT-----------------TGGG-TGAA- M_lucifugus300989 ----GGCTTT-ACCTTATGTTGG-----------------CCAG------ O_anatinus304073 ----CT-----GACACATGTTGG-----------------CTTA--AAAG O_anatinus304074 ----TCCCGA-GACTCATGTTGG-----------------CTC----AAG O_anatinus304075 ----TTGAGA---CATGTGTTGG-----------------CCC----AAG O_anatinus304076 ----GTG-----ACTGATGATGG-----------------CT-----AAG O_anatinus304077 ----TT-----GACTAATGATGG-----------------CAA----AG- O_anatinus304379 ----GGTTTTA---TCTTTGTGT-----------------TG-GCTAAA- O_anatinus304380 ----AGTCTTT-TTCCTTAATGT-----------------TGGC-TAAA- O_cuniculus300220 -----CTTG---GCTAACAAATG-----------------GCA------- O_cuniculus300254 -----CTTG---GCTAATGGTGG-----------------CC-------- O_cuniculus300337 -----CTTG---GCTAATGATGG-----------------CC-------- O_cuniculus300368 ----TC--------ATGTGTTGG-----------------A-A------G O_cuniculus300468 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAA- O_cuniculus300500 ----T--------CTTATGTTGG-----------------C------AAG O_cuniculus300501 -----CTTG---GCTAATGA-TG-----------------GCA------- O_cuniculus300517 ----TCAA------CGTTGTTGG-----------------CA-GTTA--- O_cuniculus300518 ----T--------CTTATGTTGG-----------------C------AAG O_cuniculus300519 -----CTTG---GCTAATGA-TG-----------------GCA------- O_sativa300168 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAGTGCTG--CTAA O_sativa300160 TCTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--TTAA O_sativa300169 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAGTGCTG--CTAA O_sativa300001 TTTCGCCT----TGCCAGGTTTGA--------GAGCTAATGCTG--CTAA O_sativa300000 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--TTAA O_sativa300113 TTTCGCCT----CGCCAGGCTTGA--------GAGCTTATGCTG--TTAA O_sativa300114 TTTCGCCT----TGCCGGGCTTGA--------GAGCTAATGCTG--CTAA O_sativa300115 TTTCGCCT----TGCCGGGCTTGA--------GAGCTAATGCTG--CTAG O_sativa300161 TCTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--TTAA O_sativa300162 TCTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--TTGA O_sativa300163 TCTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--TTAA O_sativa300166 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAGTGCTG--CTAA O_sativa300167 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAGTGCTG--CTAA O_latipes300010 ----TCTAAC-GACCAGAGACGG-----------------CCC----AA- O_latipes300011 ----TCTAAC-GACCAAAGACGG-----------------TCC----AA- O_latipes300012 ----TCTAAC-GGCCAAAGACGG-----------------TCC----AA- O_latipes300013 ----TCTAAC-GGCCAAAGATGG-----------------TCC----AA- O_garnettii300744 ----GGTCTT-TCCTTGTGTTGG-----------------CCAG------ O_garnettii300745 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAA-- P_troglodytes300003 ----TCAAG-------GTGTTGG-----------------CA-ACTA--- P_troglodytes300128 ---TGATTTTCATGCTTCTTTAA-----------------AGCAAAGGTT P_troglodytes300129 ---TGATTTTCATGCTTCTTTAA-----------------AGCAAAGGTT P_troglodytes300593 ----GATTTT----CCTTAGTGT-----------------TCGG-TAAA- P_troglodytes300662 ----TGTTTT-TCCTTATGTTGG-----------------CCAG------ P_troglodytes300663 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAA- P_troglodytes300676 ----TCAAG-------GTGTTGG-----------------CA-ACT---- P_troglodytes300677 ----GTC-------TTATGTTGG-----------------CCA------G P_troglodytes300678 -----CTTG---GCTAATGATGG-----------------CAA------- P_patens300014 TTTCGTCT----TGCGGGACTAGA--------GAGCTAATGCAGCTTCCA P_patens300016 TTTCGCCC----CGCCGGGCTTGA--------GAGCTGATGCAGCTTCCA P_patens300021 TTTCGGCC----CGCTGGGCTTGA--------GAGCTGATGCAGCTTCCA P_patens300030 TTTCGCCC----TGTCGGGCTTGA--------GAGTTAATGAAGCTTCCA P_patens300049 TTTCGCCC----CGCCGGGCTGGA--------GAGCTAATGCAGCTTCCA P_patens300052 TTTCGCCC----CGCCGGGCTGGA--------GAGCTAATGCAGCTTCCA P_patens300055 TTTCGCCC----CGCCGGGCTGGA--------GAGCTAATGCAGCTTCCA P_patens300058 TTTTGTCC----CGCTAGGCTGGA--------GAGCTAATGCAACTTTCA P_patens300071 TTTCGCCC----CGCCGGGCTTGA--------GAGCTAATGCAGCTTCCA P_patens300074 TTTCGCCC----CGCCGGGCTTGA--------GAGCTAATGCAGCTTCCA P_patens300008 TCTCGCCT----GGCCGGGCTTGA--------GAGTTAATGCTGCTTCCA P_pygmaeus300132 -----CTTG---GCTAATGATGG-----------------CAA------- P_pygmaeus300189 ----CTTGAT-TATG---GGAAT-----------------AATA-----A P_pygmaeus300679 ----GATTTT----CCTTAGTGT-----------------TGGG-TAAA- P_pygmaeus300734 ----GGTTTT----CCTTAGTGT-----------------TGGG-TAAA- P_pygmaeus300742 ----TCAAG-------GTGTTGG-----------------CA-ACTA--- P_pygmaeus300743 ----GTC-------TCATGTTGG-----------------CCA------G P_pygmaeus300744 -----CTTG---GCTAATGATGG-----------------CAA------- P_pygmaeus300735 ----CGTTTT-TCCTCATGTTGG-----------------CCAG------ P_pygmaeus300094 ---TGATTTTCATGCTTCTTTAA-----------------AGCAATGGTT P_pygmaeus300131 ----GTC-------TCATGTTGG-----------------CCA------G R_norvegicus300867 -----------ATGCTGTGTTGG-----------------CTA------G R_norvegicus300868 -----------GTACTGTGTTGG-----------------CTA------G R_norvegicus300869 ----GGACA-------GTGTTGG-----------------CA-GTTA--- R_norvegicus301089 ----GACATT----CT---GTGT-----------------TGGG-TAGA- S_cerevisiae300053 TACGCTTACGAACCCATCGTTAGTACTCTCGGTGACCGCTCTTCTTTAGA S_pombe300079 ---GCATACGAACCCAATTTT----------GCCGCAGATGTCGTGCATA S_araneus300960 ----TCCAG-------GTGTTGG-----------------CA-ACTA--- S_araneus300961 ----TC-------TTTGTGTTGG-----------------C-------AA S_araneus300962 -----TTTA---GCTAATGATGG-----------------CC-------- S_tridecemlineatus300323 -----------ATTTTGTGTTGG-----------------CTA------G S_tridecemlineatus300091 ----CTTGGA-AATGCTTGTTAA-----------------ATTG-----A S_tridecemlineatus300260 ----GGTTTT-TCCTCATGTTGG-----------------CCAT------ S_tridecemlineatus300321 ----TTGAC-------ATGTAGG-----------------CA-GTTTAC- S_tridecemlineatus300322 ----------AATTTTGTGTTGG-----------------CCA------G T_nigroviridis300161 ----TCACAT-GACCAAAGACGG-----------------TTC----AA- T_nigroviridis300163 ----TCACAT-GACCAAAGACGG-----------------TTC----AA- T_nigroviridis300164 ----TCACAT-GACCAAAGACGG-----------------TTC----AA- T_dicoccoides300006 TTTCGCCC----AGCCAGGCTTGA--------GAGCTAATGCTG--ATAA T_dicoccoides300010 TTTCGCCC----TGCCAGGTTTGA--------GAGCTAATGCTG--CTAA T_dicoccoides300042 TTTCGCCC----TGCCAGGCTTGA--------GAGCTAATGCTG--CTAA T_dicoccoides300036 TTTCGCCA----AGCCAGGCTTGA--------GAGCTAATGCTG--CTAA T_belangeri300318 ----TC--------TTGGTGTTG-----------------GCA------G T_belangeri300319 -----CTTA---GCTGCTGATGG-----------------CC-------- T_belangeri300393 ----GGTAT-----CCTTAGTGT-----------------TGGG-TAAAA X_tropicalis300000 ----G--TTC----TCCTGCTGT-----------------TGGACTGTAA X_tropicalis300070 ----G--TTC----TCCTGCTGT-----------------TGGACTGTAA X_tropicalis300113 ----CCAAAA-GGCTGATGATGG-----------------TCT----AG- X_tropicalis300114 ----TCGCAA-GACTCATGATGG-----------------CTC----TT- X_tropicalis300115 ----TCGCAA-GACTTATGATGG-----------------TTT----AT- X_tropicalis300131 ----G--TTC----TCCTGCTGT-----------------TGGACTGTAA A_thaliana300141 T-CCTTCCTT-GGATGTCTGAAA--- A_thaliana300142 T-CCTTCCTT-GGATGTCTGAAA--- A_thaliana300143 T-CCTTCCTT-GGATGTCTGAGA--- A_thaliana300144 T-CCTTCCTT-GGATGTCTGAGA--- C_elegans300051 ---CTTCCTT-GGACGTCTGAGCCGC C_familiaris300226 TTCCTTCCTT-GGATGTCTGAGCGA- C_familiaris300335 CAACTTCCTT-GGATGTCTGAGCGA- C_familiaris300336 CTCCTTCCTT-GGATGTCTGAGCGA- C_familiaris300337 T-CCTTCCTT-GGATGTCTGAGTGA- C_porcellus300675 -TTTTTCTTT-GGATGTCTGAAAAA- C_porcellus300905 TTCCTTCCTT-GGATGTCTGAGTGA- C_porcellus300940 -TC-TTCCTT-GGATGTCTGAGTGA- C_intestinalis300009 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300010 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300011 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300012 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300013 TTCCTTCCAT-GGATGTCTGAGCAG- C_intestinalis300014 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300015 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300022 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300023 TTCCTTCCTT-GGATGTCTGAGCAG- C_intestinalis300024 TTCCTTCCTT-GGATGTCTGAGCAG- C_savignyi300003 TTCCTTCCTT-GGATGTCTGAGCAG- C_savignyi300004 TTCCTTCCTT-GGATGTCTGAGCAA- C_savignyi300005 TTCCTTCCTT-GGATGTCTGAGCAA- C_savignyi300006 TTCCTTCCTT-GGATGTCTGAGCTT- D_rerio300120 TACCTTCCTT-GGATGTCTGAGCGA- D_rerio300121 CACCTTCCTT-GGATGTCTGAGCGA- D_rerio300123 TACCTTCCTT-GGATGTCTGAGCGT- D_novemcinctus300109 TTCCTTCCTT-GGATGTCTGAGTGA- D_novemcinctus300252 TTCCTTCCTT-GGATGTCTGAGTGA- D_novemcinctus300473 -TTCTTCCCG-GGATGTCTGAGTGA- D_novemcinctus300601 TTCCTTCCTT-GGATGTCTGAGTGA- D_melanogaster300046 GGCGTCTGAC-T-------------- D_melanogaster300047 GGCGTCTGAC-T-------------- E_telfairi300200 TTCCTTCCTT-GGATGTCTGAGTGA- E_telfairi300412 AAACTTCCTT-GGATGTCTGAGAAA- E_telfairi300572 --TCTTCCTT-GGATGTCTGAGTGA- E_telfairi300688 TTCCTTCCTT-GGATGTCTGAGGGA- E_telfairi300689 TTCCTTCCTT-GGATGTCTGAGCGA- E_telfairi300690 AAACTTCCTT-GGATGTCTGAGCGA- E_caballus300298 TTCCTTCCTT-GGATGTCTGAGTGA- E_caballus300299 TTCCTTCCTT-GGATGTCTGAGCGA- E_caballus300300 CAACTTCCTT-GGATGTCTGAGCGA- E_caballus300310 -TTCTTCCTT-GGATGTCTGAGTGA- E_caballus300311 --CCTTCCTT-GGATGTCCGAGTGA- E_europaeus300152 -TC-TTCCTT-GGGTGTCTGAGTGA- E_europaeus300283 TTCCTTCCTT-GGATGTCTGAGCGA- E_europaeus300329 ---CCTCCTT-GGATGCATGAGTGA- E_europaeus300499 --CCTTCCTT-GGATGTCTGAGTGA- E_europaeus300632 AAACTTCCTT-GGATGTCTGAGCGA- F_catus300225 -TTCTCCCTT-AGATGAGTGA----- F_catus300226 --CCAACCTT-GGATGTCTGAGTGA- F_catus300317 TTCCTTCCTT-GGATGTCTGAGTGA- F_catus300318 TTCCTTCCTT-GGATGTCTGAGCGA- F_catus300319 TAACTTCCTT-GGATGTCTGAGCGA- G_gallus300068 -------------------------- G_gallus300069 -------------------------- G_gallus300070 -------------------------- G_aculeatus300083 -ACCTTCCTT-GGATGTCTGAGCGA- G_aculeatus300084 -ACCTTCCTT-GGATGTCTGAGCGA- G_aculeatus300085 -ACCTTCCTT-GGATGTCTGAGCGA- G_aculeatus300086 -ACCTTCCTT-GGATGTCTGAGCGA- G_aculeatus300107 -ACCTTCCTT-GGATGTCTGAGCGA- H_sapiens300494 --CCTTCCTT-GGATGTCTATGAGA- H_sapiens300736 -TTCTTCCTT-GGATGTCTGAGTGA- H_sapiens300737 --CCTTCCTT-GGATGTCTGAGTGAG H_sapiens300754 TTCCTTCCTT-GGATGTTTGAGCGA- L_africana300364 -ATCTTCCTT-GGATGTCTGAGTGA- M_mulatta300632 --CCTTCCTT-GGATGTCTGTGA--- M_mulatta300647 --CCTTCCTT-GGATGTCTGAGTGA- M_mulatta300648 -TTCTTCCTT-GGATGTCTGAGTGA- M_mulatta300666 --CCTTCCTT-GGATGTCTGAGTGA- M_mulatta300667 TTCCTTCCTT-GGATGTCTGAGCGA- M_mulatta300668 CACCTTCCTT-GGATGTCTGAGCGA- M_murinus300488 -TTCTTCCTT-GGATGTCTGAGTGA- M_murinus300489 --CCTTCCTT-GGATGTCTGAGTGA- M_murinus300509 --TCTTCCTT-GGATGTCTGAGTGA- M_murinus300510 TTCCTTCCTT-GGATGTCTGAGCGA- M_murinus300511 TAACTTCCTT-GGATTTCTGAGCAA- M_domestica300150 AACCTTCCTT-GGATGTCTGAGCGA- M_domestica300151 TACCTTCCTT-GGATGTCTGAGCGA- M_domestica300152 TTCCTTCCTT-GGCTGTCTGAGCGA- M_domestica300153 ATCCTTCCTT-GGATGTCTGAGCGA- M_musculus300562 --CCTTCCTT-GGATGTCTGAGTGA- M_musculus300887 TTCCTTCCTT-GGATGTCTGAGCGA- M_musculus300888 TTCCTTCCTT-GGATGTCTGAGCGA- M_musculus300889 --CCTTCCTT-GGATGTCTGAGTGA- M_lucifugus300015 TTCCTTCCTT-GGATGTCTGAGCGG- M_lucifugus300621 --CCTTCCTT-GGATGTCTGAGTGA- M_lucifugus300989 -TTCTTCCTT-GGATGTCTGAGTGA- O_anatinus304073 TTCCTTCCTT-GGATGTCTGAGCGA- O_anatinus304074 TTCCTTCCTT-GGATGTCTGAGCGG- O_anatinus304075 TTCCTTCCTT-GGATGTCTGAGCGA- O_anatinus304076 TTCCTTCCTT-GGATGTCTGAGCGA- O_anatinus304077 TACCTTCCTT-GGATGTCTGAGCGA- O_anatinus304379 --CCTTCCTT-GGATGTCTGAGTGA- O_anatinus304380 --CCTTCCTT-GGATGTCTGAGTGA- O_cuniculus300220 TACCTTCCTT-GGATGTATGAGCGA- O_cuniculus300254 CAACTTACTT-GGATGTCTGAGTGA- O_cuniculus300337 CAACTGCCTT-AGATATC-AAGTGA- O_cuniculus300368 TTCCTTCCTT-GGATGTCTGAGTGA- O_cuniculus300468 --CCTTCCTT-GGATGTCTGAGTGA- O_cuniculus300500 TTCCTTCCTT-GGATGTCTGAGCGT- O_cuniculus300501 AACCTTCCTT-GGATGTCTGAGCGA- O_cuniculus300517 --CCTTCCTT-GGATGTCGAAGTGA- O_cuniculus300518 TTCCTTCCTT-GGATGTCTGAGCGT- O_cuniculus300519 AACCTTCCTT-GGATGTCTGAGCGA- O_sativa300168 TACCTTCCTT-GGATGTCTGATGCA- O_sativa300160 TTCCTTCCTT-GGATGTCTGAGCCA- O_sativa300169 TTCCTTCCTT-GGATGTCTGATGCC- O_sativa300001 TTCCTTCCTT-GGATGTCTGATGCA- O_sativa300000 TTCCTTCCTT-GGATGTCTGAGCCA- O_sativa300113 ATCCTTCCTT-GGATGTCTGAGGGC- O_sativa300114 CTCCTTCCTT-GGATGTCTGAGCCA- O_sativa300115 ATCCTTCCTT-GGATGTCTGATGCC- O_sativa300161 TTCCTTCCTT-GGATGTCTGAGCCA- O_sativa300162 TTCCTTCCTT-GGATGTTTGAGCCA- O_sativa300163 TTCATTCCTT-GGATGTCTGAGCCA- O_sativa300166 TTCCTTCCTT-GGATGTCTGATGCA- O_sativa300167 TACCTTCCTT-GGATGTCTGATGCA- O_latipes300010 -ACCTTCCTT-GGATGTCTGAGTGA- O_latipes300011 -ACCTTCCTT-GGATGTCTGAGCGA- O_latipes300012 -ACCTTCCTT-GGATGTCTGAGCGA- O_latipes300013 -ACCTTCCTT-GGATGTCTGAGCGA- O_garnettii300744 -TTCTTCCTT-GGATGTTTGAGTGA- O_garnettii300745 --CCTTCCTT-GGATGTCTGAGTGA- P_troglodytes300003 --CCTTCCTT-GGATGTCTGAGTGA- P_troglodytes300128 GTTCTTGCTT-GGATGTCTGAGCTT- P_troglodytes300129 GTTCTTGCTT-GGATGTCTGAGCTT- P_troglodytes300593 --CCTTCCTT-GGATGTCTATGAGA- P_troglodytes300662 -TTCTTCCTT-GGATGTCTGAGTGA- P_troglodytes300663 --CCTTCCTT-GGATGTCTGAGTGA- P_troglodytes300676 --CCTTCCTT-GGATGTCTGAGTGA- P_troglodytes300677 TTCCTTCCTT-GGATGTCTGAGCGA- P_troglodytes300678 CACCTTCCTT-GGATGTCTGAGCGA- P_patens300014 AACCTTCCTT-GGACGTCTGAGACT- P_patens300016 AACCTTCCTT-GGATATCTGAGACT- P_patens300021 AACCTTCCAT-GGATATTTGAGACT- P_patens300030 AATCTTCCTT-GGATATCTGAGACT- P_patens300049 AACCTTCCTT-GGATATCTGAGACT- P_patens300052 AACCTTCCTT-GGATATCTGAGACT- P_patens300055 AACCTTCCTT-GGATATCTGAGACT- P_patens300058 AACCTTCCCT-GGATATCTGAGACT- P_patens300071 AACCTTCCTT-GGATATCTGAGACT- P_patens300074 AACCTTCCTT-GGATATCTGAGACT- P_patens300008 AACCTTCCTT-GGATATCTGAGACC- P_pygmaeus300132 CACCTTCCTT-GGATGTCTGAGCGA- P_pygmaeus300189 CACCTTGATT-TAACCCTCAGGGA-- P_pygmaeus300679 --CCTTCCTT-GGATGTCTGTGAGA- P_pygmaeus300734 --CCTTCCTT-GGATGTCTGAGTGA- P_pygmaeus300742 --CCTTCCTT-GGATGTCTGAGTGA- P_pygmaeus300743 TTCCTTCCTT-GGATGTCTGAGCGA- P_pygmaeus300744 CGCCTTCCTT-GGATGTCTGAGCGA- P_pygmaeus300735 -TTCTTCCTT-GGATGTCTGAGTGA- P_pygmaeus300094 GTTCTTGCTT-GGATGTCTGAGCTT- P_pygmaeus300131 TTCCTTCCTT-GGATGTCTGAGCGA- R_norvegicus300867 TTCCTTCCTT-GGATGTCTGAGCGA- R_norvegicus300868 TTCCTTCCTT-GGATGTCTGAGCGA- R_norvegicus300869 --CCTTCCTT-GGATGTCTGAGTGA- R_norvegicus301089 --CCTTCCTT-GGATGTCTGAGTGA- S_cerevisiae300053 GACCTTCCTA-GGATGTCTGAGTGA- S_pombe300079 GTCCTTCCTTTGGATGTCTGA-TGTT S_araneus300960 --CCTTCCTT-GGATGTCTGAGTGA- S_araneus300961 CTCCTTCCTT-GGATGTCTGAGCGA- S_araneus300962 TAACTTCCTT-GGATGTCTGAGCGA- S_tridecemlineatus300323 TTCCTTCCTT-GGATGTCTGAGCGA- S_tridecemlineatus300091 AATATTCCTT-GGTTGGTTTAGTTT- S_tridecemlineatus300260 -TCCTTCCTT-GGATGTCTGAGTGA- S_tridecemlineatus300321 ---CTTCCTT-GGATGTCTGAGTGA- S_tridecemlineatus300322 TTCCTTCCTT-GGATGTCTGAGCGA- T_nigroviridis300161 -AGCTTCCTT-GGATGTCTGAGCGA- T_nigroviridis300163 -AGCTTCCTT-GGATGTCTGAGCGA- T_nigroviridis300164 -AGCTTCCTT-GGATGTCTGAGCGA- T_dicoccoides300006 TTCCTTCCTT-GGATGTCTGAGCCT- T_dicoccoides300010 TTCCTTCCCT-AGTTTATTTTGTTG- T_dicoccoides300042 TTCCTTCCTT-GGATGTCTGAGCCA- T_dicoccoides300036 TTCCTTCCTT-GGATGTCTGAGCCT- T_belangeri300318 TTCCTTCCTT-GGATGTCTGAGCGA- T_belangeri300319 TGACTTCCTT-GGATGTCTGAGCGA- T_belangeri300393 --TCCTCCTT-GGATGTCTGAATGG- X_tropicalis300000 --CCTTCCTT-GGATGTCTGAGTGA- X_tropicalis300070 --CCTTCCTT-GGATGTCTGAGTGA- X_tropicalis300113 CACCTTCCTT-GGATGTCTGAGCGA- X_tropicalis300114 TACCTTCCTT-GGATGTCTGAGCGA- X_tropicalis300115 TACCTTCCTT-GGATGTCTGAGCGA- X_tropicalis300131 --CCTTCCTT-GGATGTCTGAGTGA-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved