snOPY snoRNA Orthological Gene Database

Family: SNORD14

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300095 TCTGCAGGCAACGGATTGTCTGCTGCCTTAACTCGTGGCTCAGCACAGCTCAACGTCTGC D_melanogaster300096 TCTGCAGGCAACGGATTGACTGC-GCTCAAACTC-TGACACAGATCAGCTCAACACCTGC D_melanogaster300097 CCTGCAAGAAACGGATTGTCTGCCGCG-ATTCTCCAGCGACTGAACATCTCAACACTTGC ***** * ********* **** ** *** * * * ** ****** *** D_melanogaster300095 AGAGATCAACAGTGTCGATTTCGTGAACTGAACAAGTTTAGATACTTGAAATGTTCGGTC D_melanogaster300096 GGATAGAAACTGTGTCAATTTCGTGAACTGAACAAGTTCATTCCATAGAAGTGTTCGGTC D_melanogaster300097 AAAGATCAGCTGTGGCAGCT--GGTAATTGCCCTGGCCTATTATTCAGGACTGGAGGCTT * * * * *** * * * ** ** * * * * * ** * * D_melanogaster300095 TTTAA-AGTTGTCCACAATC D_melanogaster300096 TTTAA-ATTTGTCCACATCT D_melanogaster300097 CTTGTCAGTTGTCCACAAGG ** * *********

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved