snOPY snoRNA Orthological Gene Database

Family: SNORD14

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300066 -AGCACTGTATTGAAGC-CTGTGG-AATAGAAT-CGTCCCCA--TTCTTG C_familiaris300418 -AGCACTATATTTAAAC-CTGTGG-ATGGGAAT-TTTCCCCA--TTCTTG C_porcellus300919 -AGCACTATATTTAAAC--TATGG-ATGGGAAT-TTTCCCCA--TTCTTG D_novemcinctus300150 -ACCACTATATTTAAACCCTGTGG-ATAGGAAT-TTTCCTCA--TTCTTG D_novemcinctus300524 -AGCACTATATTTAAAC-CTATGG-ATGGGAAT-TTTCCCCA--TTCTTG E_telfairi300063 -AACGCTATACTTAAAC-CAATGG-ATGGGCAT-TTTCCCCA--TTCTCG E_telfairi300124 -AGCACTATATTTAAAC-CAATGG-ATGGACAT-TTTCCCCA--TTCTCG E_telfairi300126 -AGCGCTATATTTAAAC-CAATGGGATGGACCT-TTTCCCCCATTTCTAG E_telfairi300858 -AGCACTATATTTAAAC-CAATGG-ATGGACAT-TTTCCCCA--TTCTCG E_caballus300248 -AGCACTATGTTTAAGC-CTGTGG-ATGGGAAT-TTTCCCCA--TTCTTG E_europaeus300586 -AGCACTATATTTAAA--CTGTGG-ACGGGAAC-CCTCCCTG--TTCTTG E_europaeus300687 -CGCACTATATTTAAAC--TGTGG-ATGGGAAT-CTTTACCA--TTCTTA F_catus300165 -CACTATATATCTAAAC-CTGTCA-ATGGGAAT-TGTCCCCT--TTCTTG F_catus300253 -TGCACTATTCTTTAAACCTGTGG-ATGGGAAT-TTTCCCCA--TTCTTG G_gallus300044 -AGCACTATTTTTAAAC-CTGTTG-GTGGATTTTCCTGGCCA--TCATGG H_sapiens300589 -AGCACTATATTTAAAC-CTGTGG-ATGGGAAT-ATTCCCCA--TTCTTG H_sapiens300720 -------------AATCTTACTAG---AAAAGTGAATGGCCA--TTCTTG L_africana300483 -AGCACTATATTTAAAC-CAATGA-ATGGAAAT-TTTCCCCG--TTCTTG M_mulatta300558 ---------AGTGAATCTTAGCAG---AAAAGTGAATGGCCA--TTCTTG M_mulatta300613 -AGCACTATATTTAAAC-CTGTGG-ATGGAAAT-ATTCCCCA--TTCTTG M_murinus300528 ------GTTATTAAAATGTTACCC------CAT-TTTCCCCA--TTCTTG M_murinus300538 -AGCACTATATTTAAAC-CTGTGG-ATGGGAAT-TTTCCCCA--TTCTTG M_musculus300354 -AGCACTATATTTAAAC-CTATGG-ATGGGAAA-TTTCCCCA--CTCTGG M_musculus300400 CAGAAGT-TGGGTAAGC--CATGA-ATGGGAAA-TTTCCTCA--TTCTTG M_musculus300809 -AGCACTATATTTAAAC-CTATGT-ATGGGAAA-TTTCCCCA--TTCTTG O_anatinus304514 -AGCACTATTTTTAAAC-CTATTG-ATGGAAAA-CCTCACCA--TCCTAG O_cuniculus300370 -AGCACTATATTTAAAC-CTACCG-ATGAGAAT-TTTCCTCA--TTCTTG O_cuniculus300484 -AGCACTATATTTAAAC-CTATGG-ATGAGAAT-TTTCCTCA--TTCTTG O_garnettii300463 -AGCACTATATTTAAGC-CTATGG-ACAGGAAT-CTTCCCCA--TTCTTG O_garnettii300601 -AGCACTATATTTAAAA-CTGTGG-GTGGGAAT-TTTCCTCA--TTGTTG P_troglodytes300557 -------------AATCTTACTAG---AAAAGTGAATGGCCA--TTCTTG P_troglodytes300687 -AGCACTATATTTAAAC-CTGTGG-ATGGGAAT-ATTCCCCA--TTCTTG P_pygmaeus300749 -AGCACTATATTTAAAC-CTGTGG-ATGGGCGT-ATTCCCCA--TTCTTG P_pygmaeus300788 ---------AGTGACTCTTACTAG---AAAAGTGAATGGCCA--TTCTTA R_norvegicus300374 -AGCACTATATTTAAAC-CTATGG-ATGGGAAA-TGTCCCCA--TTCTAG S_araneus300291 -TTCTCTTTATTTAAAC-CAAAGT-ATGGGACT-CTTCCCCA--TTCTTG S_araneus300903 -AACACTGTATTTAAAC-GAACGG-A-TAGGGT-TCTCCT-------TTG S_araneus300957 -AGCACTATATTTAAAC-CAATGG-ATGGGACT-CTTCCCCA--TTCTTG S_tridecemlineatus300337 -AGCACTATATTTAAAC-CTGTGG-ATGGGAAT-TTTCCCCA--TTCTTG T_belangeri300212 -AGTTTTATATTTAAGC-CTGTGG-ATGGGAAC-TTTCCCCA--TTCTTG T_belangeri300289 -AGCACTATATTTAAGC-CGATGG-ATGGGAAC-TTTCCCCA--TTCTTG * * C_familiaris300066 GTTATGCTGT-AGTGTGAAAGAATTGC---TGGC-----TCTCTGTTGCA C_familiaris300418 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTTTATGC---TGCA C_porcellus300919 GTTACGCTGT-AGTGCAAAAGAATTCCT---GGCTCTATC-----TTAAA D_novemcinctus300150 ATTATGCTGC-AGTACAAAATAATTCC---TTGG--CTCCTTCCCTTGCA D_novemcinctus300524 GTTACGCTGT-AGTGCAAAAGAATTCCTT--GGCTCTTTCCA---TTGCA E_telfairi300063 GTTACGCTGT-AGTGCTAACCAATTTCCCT-GGCTCTCCGTCCCCAGGCA E_telfairi300124 GTTACGCTGT-AGTGCTAAAGAATTCCCT--GGCTCTTCTTCCCCAGGCA E_telfairi300126 GTTATGCTGT-AGTGCTAAAGAATTTCCCTGGGCTCTTCTTCCCCACACA E_telfairi300858 GTTACGCTGT-AGTGCTAAAGAATTCCCT--GGCTCTTCTTCCCCAGGCA E_caballus300248 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTTTCTGT---TGCA E_europaeus300586 GTTACGCTGT-AGTGCGAAAGGATTCC---TTGG--CCTGCTGTGCTGCA E_europaeus300687 GTTACGCTGT-AGTGCAAAATAATTTC---TTGAGGTTTCTTGTGTTGCA F_catus300165 GTCCCACTCT-TGTGTGAAAGAATTCC---TGGCTCTTTCT---GTCGCA F_catus300253 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTTTCTC---TTGCA G_gallus300044 GTTACGCTGT-AGTGCAAAAGAATCTCCT--GGCTCTTCAG-----AGTA H_sapiens300589 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTCTGT-----TGCA H_sapiens300720 GTTACTCTGT-AGCACAGAAGAATTCC---TGGC--TTCTTTGTGTTGCA L_africana300483 GTTACGCTGT-AGTGCTAAAGAATTCCTT--GGCTCTTCCTC---TTGCA M_mulatta300558 GTTACTCTGT-AGCACAGAAGAATTCC---TGGC--TTCTTTCTGTTGCA M_mulatta300613 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTCTGT-----TGCA M_murinus300528 GTTTCGCTGT-AGTGCAAAAGAATTCC---TGGCTCTTTCTC---TTGCA M_murinus300538 GT-ACGCTGT-AGTGCAAAAGAATTCC---TGGC---TCTATCTCTTGCA M_musculus300354 ATTACGCTGT-AGTGCAAAAAGAATTCCT--GGCTCTGTGT-----TGCA M_musculus300400 GTTACACTATAGTTCGAAAAGAATTCC---TGGCTTCTTGT-----TGCA M_musculus300809 GTTACGCTGT-AGTGCAAAAAGAATTCCT--GGCTCCTTGT-----AGCA O_anatinus304514 GTTACGCTAT-GGTGCAAAATAATTTCTT--GGCTCTCCT------AGCA O_cuniculus300370 GTTACGCTGTTAGTGCAAAAGAATGTCCG-TGGC---TCCGTCAGTTGCA O_cuniculus300484 GTTACGCTGT-AGTGCAAAAGAAAACC---TGGC---TCCATCTGTTGCA O_garnettii300463 GTTACACTGT-GAAGCAAAAGAATTCC---TGGT---TTTCTC--TTGCA O_garnettii300601 GTTATGCTGT-AGTGTGAAAGAATTCC---TGGC--CTTTTTTCTCCACA P_troglodytes300557 GTTACTCTGT-AGCACAGAAGAATTCC---TGCC--TTCTTTGTGTTGCA P_troglodytes300687 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTCTGT-----TGCA P_pygmaeus300749 GTTACGCTGT-AGTGCAAAAGAATTCC---TGGCTCTCTGT-----TGCA P_pygmaeus300788 GTTACTCTAT-AGCACAGAATTATCCC---TGGC--TTCTTTGTGTTGCA R_norvegicus300374 GTTACGCTGT-AGTGCGAGAAGAATTCCT--GGCGCCTCAT-----TGCA S_araneus300291 GTTACTCTAT-AGTGCAAACGAATTCCT---GGCTCTCCAT------GCA S_araneus300903 GTCATGCTGT-AGTGCAAAAGAATTCC---TGG------TTTTTGTTGCA S_araneus300957 GTTACGCTGT-AGTGCAAAAGAATTCCT---GGCTCTTCAT------GCA S_tridecemlineatus300337 GTTACGCTGT-AGTGCGAAATAATTCC---TGTC---TCT-TCTGTTGCA T_belangeri300212 GTTATGCTGT-AGTACAAAAGAATTCC---TGAC---TCCTTTGGCTGCA T_belangeri300289 GTTACGCTGT-AGTGCAAAAGAATTCC---TGAC---TCTTT--GATGCA * ** * * * C_familiaris300066 CAGCCAACTTTGTGCCATTCTGCTGTTGCT-GTACGGAGTTAAGGAA-TG C_familiaris300418 CAGCTGACATTGTGCCATTCTGCTGTTGCT-GAATAGAGTTAAGGAA-CA C_porcellus300919 CAGCTGACT-TGTCTCATTCTGCTGTTGCT-TTGTGGAGTTAAGGTA-CA D_novemcinctus300150 CAGTTGACTATGTGCAAATTTGCTGTTCCT-CTGTGGAATTAATAAA-CA D_novemcinctus300524 CAGCTGACTATGTGCCATTCTGCTGTTGCT-CTTTGGAGTTAAGGAA-CA E_telfairi300063 CCGCTGACTGCC--AGTTGG--CTGTTGCT-TTGTGCAGTGAAGGAA-CA E_telfairi300124 CAGCTGACTGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CA E_telfairi300126 CAGCTGACTGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CA E_telfairi300858 CAGCTGACCGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CA E_caballus300248 CAGCTGACTTTGTGCCAGTCTGCTGGTGCT-GTATGGAGTTAAGGAA-CA E_europaeus300586 CA-CGGATTGTCTGTCAGTCTGCTGT-CCT-GCCTGGTGCCAAGAAA-CA E_europaeus300687 CAGCTGACTT--TGCCAATCTGCTGTTGCT-ATATGAAGTTAAGGAA-CA F_catus300165 CAGCTGACTTCGTGCCATTCTGCTGTTGCT-GTATAGAGTTAGGGAA-CA F_catus300253 CAGCTGACC---TGCCATTCTGCTGTTGCT-ATGTAGAGTTAAGGAA-CA G_gallus300044 TAGTTGGCCTTC--TGTTTG-GCTGATGCTGCTCTGAAGCTAAGGGA-CA H_sapiens300589 CAGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CA H_sapiens300720 CAGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CA L_africana300483 CAGCTGACTCTGTGCCATTCTGCTGTTGCT-GTATGGAGTTAAGGAA-CA M_mulatta300558 CAGCTGACT-TGTACCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CA M_mulatta300613 CAGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATGGAGTTAAGGAA-CA M_murinus300528 CAGCTGACT-TGTACTATTCTGCTGTTGCT-ATATGGAGTTAAGGAA-CA M_murinus300538 AAGCTTACT-TATACTATACTGCTGTGGCT-ATATGGAGTAAAGGA--CA M_musculus300354 CAGCTGATTCATG-CCATGGCTCCGTG----------------------- M_musculus300400 CAGCTGACT-CATGCCATTTTGCTGCT----TCATGGAGTTAAGGAA-CA M_musculus300809 CAGCTGACTGATG-CCATTTTGCTGTTGCTTTATGGAGTTAAGGGACATG O_anatinus304514 CAGCTGACTGTT--CCTTTATACTGATGCTGTGGTGGAGTTAAAGAAACA O_cuniculus300370 TAGCTGACT-TGGGCCATTCTGCTGTTGCT-TAATGGAGTTAAG-AA-CG O_cuniculus300484 CAGCTTACT-TGTACCATTCTGCTGTTGCT-TAATGGAGTTAAGGAA-CA O_garnettii300463 CAGCTGACT-TGTACCATTCTGGTGT---T-CAATGGAGTTAAGGAG-CT O_garnettii300601 -A-CTGACT-TACACCATTCTGCTGTTCCT-ATATGGAATTAAGGAG-CA P_troglodytes300557 CAGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CA P_troglodytes300687 CAGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CA P_pygmaeus300749 CAGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CA P_pygmaeus300788 CAGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGCTGAGAAA-CA R_norvegicus300374 CAGCTGACTCGCGCCGTTTG-GCTGTTGCT-CTGTG-AGCTAAGGGA-CA S_araneus300291 CGGCTGACTTTCTGCCATTCTGCTGTTGCG-ATATTGAGTTAAGGAA-CA S_araneus300903 CAGCCACCTTTCTGCCAATTTGCTGTTGCT-ATACAGAGCTAAAGAG-CA S_araneus300957 CAGCTGACTTTCTGCCATTCTGCTGTTGCA-ATATTGAGTTAAGGAA-CA S_tridecemlineatus300337 CAGCTGACT-TGTATAATTCTGCTGTTGCT-TTATGGAGTTAAGGAA-CA T_belangeri300212 CGGCCAACT-TGCACCATTCTGCTGTTGCT-CTATGGAGTTGAGGAA-CA T_belangeri300289 TAGCTGACT-TGCACCATTCTGCTGTTGCA-TTATGGAGTTAAGGAA-CA * C_familiaris300066 TAA- C_familiaris300418 TAA- C_porcellus300919 GAA- D_novemcinctus300150 TGA- D_novemcinctus300524 CAA- E_telfairi300063 CAG- E_telfairi300124 CAG- E_telfairi300126 CAG- E_telfairi300858 CAG- E_caballus300248 TAA- E_europaeus300586 TGT- E_europaeus300687 TAT- F_catus300165 TAC- F_catus300253 TAA- G_gallus300044 GAG- H_sapiens300589 TGG- H_sapiens300720 TGA- L_africana300483 TAA- M_mulatta300558 TGA- M_mulatta300613 TGG- M_murinus300528 TGA- M_murinus300538 TGA- M_musculus300354 ---- M_musculus300400 TGA- M_musculus300809 A--- O_anatinus304514 TTA- O_cuniculus300370 TTGG O_cuniculus300484 TTG- O_garnettii300463 TTA- O_garnettii300601 TGG- P_troglodytes300557 TGA- P_troglodytes300687 TGG- P_pygmaeus300749 TGG- P_pygmaeus300788 TGA- R_norvegicus300374 TGA- S_araneus300291 TGT- S_araneus300903 CTT- S_araneus300957 TGT- S_tridecemlineatus300337 TGA- T_belangeri300212 TAC- T_belangeri300289 TAT-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved