snOPY snoRNA Orthological Gene Database

Family: SNORD14

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300032 --TGATATGATGAGGTGT----ACT----GAGCATGATGAAGT-GTAGCT D_novemcinctus300023 GGATTTATGATGAGATATGTTTACT----GAGCCTGATGAAAAGAAAGCT D_novemcinctus300111 GGATTTATGATGAGATATGTTTACT----GAGCCTGATGAAAAGAAAGCT E_europaeus300138 GGATTTATGATGAGCTATGTTTACT----GAGCATGATGAAAT-GAAGCT F_catus300214 GGATTTATGATGAGTTATGTTTACT----GAGTATGATGAAGT-GAAACT H_sapiens300402 GGATTTGTGATGAGCTGTGTTTACT----GAGCATGATGAAGT-AAAGCT L_africana300055 TCACCAAAGAAGACATACAAATAGCCAATGAGCATTATGAAAA-GATGCT L_africana300359 GGACTTATGATGAGATATGCTGACTA--TGAGCATGATGAAGT-GAAGCT M_mulatta300546 GGATTTGTGATGAGCTGTGTTTACT----GAGCATGATGAAGT-AAAGCT M_mulatta300589 GGATTTATAATGATCTGTGTTTACT----GAGCATGATGAAGC-AAAGTT M_murinus300184 GGATTTATGGTGAGCTGTGTTTACT----GAGCATAATGAAGT-GAAGCT M_musculus300537 GGACTTATGATGAGCTATGTTTACT----GAGCATGATGAAAT-GATGCT O_cuniculus300041 GGATTTATGATGAGCTGTATTTACT----GAGCATAATGAAGG-GAGGCT O_garnettii300331 GGATTCATGATGAGCTGT--TTAGT----AAGGATAAATAAGT-GAAGTT O_garnettii300497 GGATTTATGATGAGCTGTGTTTAGT----GAGCATGATGAAGT-AAAGCT P_troglodytes300233 GGATTTGTGATGAGCTGTGTTTACT----GAGCATGATGAAGT-AAAGCT P_troglodytes300533 GGATTTATAATGAGCTGTGTTTACT----GAGCATTATGAAGT-AAAGTT P_pygmaeus300088 GGATTTATAATGAGCTGTGTTTACT----GAGCATTATGAAGT-AAAGTT P_pygmaeus300563 GGATTTGTGATGAGCTGTGTTTACC----GAGCATGATGAAGT-AAAGCT R_norvegicus300436 GGATTAATGATGAGCTGTGTTTACT----GAGCATAATGAAAT-GACGCT S_araneus300743 GAATTCATGATGAGCTATGTCTACT----GAGCATGATGAAGT-AAAGCT S_tridecemlineatus300160 GGATTTATGATGAGCTATGTTTACT----GAGCATGATGAAGT-GAAGCT ** * * ** * * ** * C_familiaris300032 CAATGT--AAGTACTCTAAAGTCC D_novemcinctus300023 CACTGT--GATTACTCTGAAGTCC D_novemcinctus300111 CACTGT--GATTACTCTGAAGTCC E_europaeus300138 TGATAT--GAGAACTCTGAGGTCC F_catus300214 CAGTGT--GAGTACTCTGAAGTCC H_sapiens300402 CAACGT--GATTACTCTGAAGTCC L_africana300055 CAATGT--GTTTAGTCATTGGTGA L_africana300359 CAATAT--GATTTCTCTGAATTCC M_mulatta300546 CAATGT--GATTACTCTGAAGTCC M_mulatta300589 CAATAT--TATTACTCTGAAGTCT M_murinus300184 CAAAAT--GATTAATCTGAAGTCC M_musculus300537 CAAAAT--GATTACTCTGAAGTCT O_cuniculus300041 CCATGT--GATTACTCTGAAGTCC O_garnettii300331 CAAAAT--GATTATTCTGAAGTTC O_garnettii300497 CAATGT--GATTACTCTGAAGTCC P_troglodytes300233 CAACGT--GATTACTCTGAAGTCC P_troglodytes300533 CAATAT--GATTACTCTGAAGTCT P_pygmaeus300088 CAATAT--GATTACTCTGAAGTCT P_pygmaeus300563 CAACGT--GATTACTCTGAAGTCC R_norvegicus300436 CAAAAT--AATTACTCTGAAGTCT S_araneus300743 CGGTGTTTGAGTGCTCTGAAGTCC S_tridecemlineatus300160 CAATAT--GATTACTCTGAGGTCC * ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved