snOPY snoRNA Orthological Gene Database

Family: SNORD121

CLUSTAL W (1.83) multiple sequence alignment O_anatinus302305 GTCCA-GAAGACAGTGATGTGGTATTTTCCAAGCACATATCTGATTGGCATGTGTGGAAA O_anatinus302306 GTCCA-GAAGACAATGATGTG-TGATTTCCAAGCACATATCCGATTTCTCCATGTGGAAA O_anatinus302307 GCCGA-AAAGACAGTGATGTT-TCCTTTCCAAGCACATATCCGAATTGTGTGTGTGGACA O_anatinus302308 CCCGAGAAAGACAATGATGCC-TGATTTCCAAGCACATATCTGACCTA-ATTTGAGGAGA * * ****** ***** * **************** ** ** *** * O_anatinus302305 TC--ATTATTTCTGAGTTTTCTGGAA O_anatinus302306 TCCAACCTCGACTGAGTTTTCTGGCC O_anatinus302307 ACT--TGAAGACTGAGTCTTTTCCTT O_anatinus302308 ACT--C-AAGACTGAGTCTTTCGGC- * ****** **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved