snOPY snoRNA Orthological Gene Database

Family: SNORD12

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300151 GCTGGTGTAAAT-GAT-GACTG--AGC-TTTTTTCCCCATCAGAT-CGACAATGCTGAGG C_familiaris300152 GCCATTGCAA-CTGAT-GACGT--AAC-TTTTTTCCCCATCAGAT-CGACCCTGTTGATC C_familiaris300217 ACAAACACAG-CTGAT-AACAT--AAC-TTTTTTCCCCATTAGAT-TAACCTTATTGATC D_rerio300032 TCTGGTAG-CAATGAT-GACTT-AATC-TTTTTTCCCCAGCAGAT-CGACTCTGTTGACT D_rerio300033 TCTGGTGC-ACGTGAT-GACT--AACC-TTTTTTCCCCAGCAGAT-CGACTCTGTTGACC D_rerio300034 TCTGGTGC-ACGTGAT-GACT--AACC-TTTTTTCCCCAGCAGAT-CGACTCTGTTGACT D_rerio300035 ---GGTGC-ACATGAT-GACT--GACC-TTTTTTCCCCAGCAGAT-CGATAGTGTTGACT D_rerio300099 ATTGTGGT-TAATGAT-GTT---GCTC-TTTTTTCCCCGTCTTAT-CGACTATGCTGATT D_novemcinctus300400 GCTGGCTT-ATATGAT-GACT--GGAC-ATTTTTCCCCAACAGAT-CCACCATGTTGATC D_novemcinctus300401 GTTGGTGTAAAT-GAT-GACTA--AGC-TTTTTTCCCCATCAGAT-CGGCAATGCTGATT D_melanogaster300007 TTTCATATGATGAAATTTTCCTATCTCAGGATTCCCTCTTCTGAGTAGAACCCTAAAACA D_melanogaster300008 TTTAGAATGATGATATTTTCCGTCCGT-GGAACTTATACAAAG-TAAAATCATGCTGACA D_melanogaster300009 TTCGAAATGATGACAATA-CAGTCCGT-GGT-TTTACACTGAGACAAAGCCATGCTG-TT E_telfairi300477 GCTGGTACCAAT-GAT-GACTT--GAC-TTTTTTCCCCATCAGAT-CGACAGTGTTGATG E_telfairi300540 GCTGGTACAAATTGATAGACTT--GAC-TTTTTTCCCCATCAGAT-CGACAGTGTTGATG E_telfairi300541 GCCATTGCAA-CTGAT-GACAT--AAC-TTTTTTCCCCATCAGAT-CGACCTTGTTGATC E_caballus300174 GCTGGTGTAAAG-GAT-GACTT--CAC-TTTTTTCCCCATCAGAT-CGACAGTGTTGATG E_caballus300175 ACTGGCAT-ATATGAT-GACT--GAAC-TTTTTTCCCCGACAGAT-CGACCATGTTGATC E_caballus300176 GCCACTGCAG-GTGAT-GACAT--AAC-TTTTTTCCCCATCAGAT-CGACCCTGTTGATC E_europaeus300171 -----------GTAGA-AAATG--CAA-AGAT-ACCCCATCAGAT-CGACCCTATTGATC F_catus300149 GCCATTGCAG-CTGAT-GACAT--AAC-TTTTTTCCCCATCAGAT-CGACCCTGTTGATC F_catus300150 ACTGGCAT-ATATGAT-GACT--GAAC-TTTTTTCCCCAACAGAT-CGACCATGTTGATC G_gallus300016 GCTGGTGTAG-GTGAT-GACTG--AAC-TTTTTTCCCCATCAGAG-CGACAGTGTTGATT G_gallus300017 GCTGGTGTAG-GTGAT-GACTG--AAC-TTTTTTCCCCATCAGAG-CGACAGTGTTGATT G_gallus300018 GCTGGTGTAG-GTGAT-GACTG--AAC-TTTTTTCCCCATCAGAG-CGACAGTGTTGATT G_gallus300019 TCTGTGGT-ATATGAT-GACTTCAAAC-TTTTTTCCCCATCAGAT-CGGCAATGCTGATA G_aculeatus300133 AATGTGGT-TGATGAT-GCT---GAAC-TTTTTTCCCCATCTTAT-CGACCATGGTGAAT G_aculeatus300134 CATGTGGT-TAATGAT-GT----ACAC-TTTTTTCCCCGTCTTAT-CGACCATGGTGAGA H_sapiens300491 GCTGGTGTAAAT-GAT-GACTT--CAC-TTTTTTCCCCATCAGAT-CGACAATGCTGACG H_sapiens300492 GCCTTTGCAG-CTGAT-GATAC--AGC-TTCTTTCCCCATCAGAT-CGACCCTGTTGATC H_sapiens300763 GCTGGCAT-ATATGAT-GACT--TAGC-TTTTTTCCCCGACAGAT-CGACTATGTTGATC L_africana300360 ----GCAT-AGATGAT-GGCT--GAGC-TTTTTCCCCCGACAGAT-GGACCATGTTTATC L_africana300430 ---GGTATTAAGTGAT-GACTT--GAC-TTTTTTCCCCATCATAT-CGACAATGCTGATG L_africana300431 GCCATTGCAG-CTGAT-GACAG--AAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC M_mulatta300524 GCCTTTGCAG-CTGAT-GATAC--AGC-TTCTTTCCCCATCAGAT-CGACCCTGTTGATC M_mulatta300525 GCTGGTGTAAAT-GAT-GACTTTTCAC-TTTTTTCCCCATCAGAT-CGACAATGCTGACG M_domestica300026 -CTGTGGTTACATGAT-GACT-AAAAC-TTTTTTCCCCAACTGAT-CGACAATGCTGAT- M_domestica300027 GCTGGTATGTAT-GAT-GACTA--AAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC M_domestica300028 ACTGGTGCAAAT-GAT-GACTT--GAC-TTTTTTCCCCATCAGAT-CGACCTTGCTGATC M_musculus300375 GTACACAT-GTGTGAT-GACA--CAAC-TTTTTTCCCCATCAGAT-CAACCATGTTGATC M_musculus300988 GCTGGTGTAAAT-GAT-GAACT--CAC-TTTTTTCCCCGTCATAT-CGACAGTGCTGATG M_musculus300989 ACAGGCAT-GTGTGAT-GACA--CAAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC M_musculus300990 GCTGGTGAA--CTGAT-GATAT--CAT-TTCTTTCCCCGTCAGAT-CGACCCTGTTGATC M_lucifugus300016 GCCATTGCAG-CTGAT-GACAT--AAC-TTTTTTCCCCATCAGAT-CGACCCTGTTGATC M_lucifugus300221 --ACCTATGA-ACCAA-GAAGT--CAC-GGTTCACCCCATCAGAC-CGACCCTGTTGATC O_anatinus303681 TCTGTGGA-AAATGAT-GACTTGGAAC-TTTTTTCCCCAACAGAT-CGACAGTGTTGAT- O_anatinus304439 CCTGGTGTAATATGAT-GACTG--CAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC O_anatinus304470 TGTCTTGTAT-ATGAT-GACTG--CAC-TTTTTTCCCCATCAGAT-CGA----------- O_anatinus304471 TGTCTTGTAT-ATGAT-GACTG--CAC-TTTTTTCCCCATCAGAT-CGA----------- O_anatinus304490 CCTGGTGTAA-GTGAT-GACTG--AAC-TTTTTTCCCCATCAGAC-C------------- O_anatinus304491 CCTGGTGTAAAT-GAT-GACTA--AAC-TTTTTTCCCCATCAGAT-CGACTGTGTTGATC O_anatinus304492 GCTGGTGTATGT-GAT-GACGA--AAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC O_anatinus304493 CCTGGTGTAT-ATGAT-GACTG--CAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC O_anatinus304516 ATCAGTGT-ATGGGAT-GACAA--AAC-TTTTTTCCCCATCAGAT-TGACGTTGAGGCCT O_cuniculus300262 GCTGGTGTACAT-GAT-GACCT--CAC-TTTTTTCCCCGTCAGAT-CGGCCATGCTGAGG O_cuniculus300263 GCTGGCGT-GTATGAT-GACT--GGA---TTTTTCCCCGGCAGAT-CGACCGTGTTGATC O_cuniculus300264 GCGCTTGCAG-GTGAT-GACAT--AAC-TTTCTTCCCCATCAGAT-CGACACTGTTGATC O_latipes300091 AATGTGGT-TGGTGAT-GCC---AAAC-TTTTTTCCCCATCATAT-CGACTATGATGTAA O_latipes300092 AATGTGGT-TAATGAT-GC----ACAC-TTTTTTCCCCGTCTTAT-CGACCATGGTGAGA O_latipes300093 GATGTGGT-TAGTGAT-GCAT--ACGC-TTTTTTCCCCGTCTTAT-CGACCATGGTGAAA P_troglodytes300735 GCTGGTGTAAAT-GAT-GACTT--CAC-TTTTTTCCCCATCAGAT-CGACAATGCTGACG P_troglodytes300736 GCCTTTGCAG-CTGAT-GATAC--AGC-TTCTTTCCCCATCAGAT-CGACCCTGTTGATC P_pygmaeus300455 GTTGATGCAAAT-GAT-GACTT--CGC-TTTTTTCCCCATCGGAT-CGACAATGCTGACG P_pygmaeus300456 GCCTTTGCAG-CTGAT-GATAC--AAC-TTCTTTCCCCATCAGAT-CGACCCTGTTGATC P_pygmaeus300633 GTTGATGTAAAT-GAT-GACTT--CGC-TTTTTTCCCCATCAGAT-CGACAATGCTGACG R_norvegicus300269 GCTGGTGTAAAT-GAT-GACCT--CAC-TTTTTTCCCCGTCATAT-CGACAGTGCTGATG R_norvegicus300270 GCAGGCAT-GTGTGAT-GACT--CAAC-TTTTTTCCCCATCAGAT-CGACCATGTTGATC R_norvegicus300271 GCTGGTGAAG-CTGAT-GATAC--CAC-TTCTTTCCCCATCAGAT-CGACCCTGTTGATC S_cerevisiae300054 ----GGCCCTGATGATAATGGTGTCTC-TTCTTTCCTCGTCCGATTCGACCATGACGACA S_araneus300275 GCCGGGGGACAG-GAT-GACCA--CTC-TTTTTTCCCCATCAGAT-CGACAATGCTGATG T_nigroviridis300048 AGTGTGGT-TAATGAT-GT----GCTC-TCTTT-CCCCGACTTAT-CGACTATGCTGACA T_nigroviridis300049 AATGTGGT-TGATGAT-GTC---CAAC-TTTTTTCCCCATCTTAT-CGACCATGGGGACT T_nigroviridis300050 GCTGTGGT-TGATGAT-GC----AAGC-TTTTTTCCCCGTCTTAT-CGACTATGGTGAAA T_belangeri300357 GCTGGTGTAAAT-GAT-GACTTC-ACC-TTTTTTCCCCATCAGAT-CGGCAATGCTGATG X_tropicalis300049 -CGATGTCTGTATGAT-GACT--AAAC-TTTTTTCCCCAGCAGAT-CGACACTGTTGACT X_tropicalis300050 GCTGACAT-GCATGAT-GACC--AAAC-TTTTTTCCCCAACAGAT-CGACAGTGTTGACT X_tropicalis300051 TCTGCTGT-ATGTGAT-GACT--AGAC-TTTTTTCCCCAGCAGAT-CGACACTGTTGACC C_familiaris300151 T-C--TTTGAACA-CTTGCCAGT-T-AGTTCTGAT-G-CACCGGC--------------- C_familiaris300152 TA---AGTGAACCATTAGCCAGTGTTTTGTCTGATGC--ATTGGC--------------- C_familiaris300217 TA---GCTGAACCATTAGCCAGTGTTTTTTCTGATGC--ATTGGA--------------- D_rerio300032 TGTGAAACGAAAA-TAAGCCAAA---TTATCTGAGC--AAACTGA--------------- D_rerio300033 TTTAAAACGAAAA-TAAGCCAAA---TTATCTGAAC--AACCAGA--------------- D_rerio300034 TGTAACACGAAAAATAAGCCAAA---TTATCTGAGC--AACCAGA--------------- D_rerio300035 CCCTTAATCAATT-TAAGCCAAT---TTATCTGAAG--CACC------------------ D_rerio300099 C--CTCTTGAAA-ATAAGCCAAA-T-CCT-CTGAAA-CCACCAC---------------- D_novemcinctus300400 T----AAAT-TCTCTAAGCCAGT-TTCTGGCTGATA--TGCCAGC--------------- D_novemcinctus300401 TAT--TTTGAACAATTTGCCAGT-T-AATTCTGAT-A-CACCGGC--------------- D_melanogaster300007 ACCGTGCTGTTCACTTTCCCTGTCTGAAATA----------------------------- D_melanogaster300008 TT-TTATGTCTTCTTTCCCCAACTGATTAT------------------------------ D_melanogaster300009 TG-ATAAGTCATTTTTCCCCAACTGATACA------------------------------ E_telfairi300477 G----CTCTGAATACTTGCCAGT-T-AGTTCTGATAA-GACCAGC--------------- E_telfairi300540 G----CTCTGAATACTTGCCAGT-T-AGTTCTGATAA-GACCAGC--------------- E_telfairi300541 TA---GCTTAACTACTAGCCAGTTTCT-GTCTGATGC--TTGGC---------------- E_caballus300174 T----CGTTGAACACTTGCCAGT-T-AGTTCTGATGC-ACCAGC---------------- E_caballus300175 T----AACT-TCTCTAAGCCAGT-TTCTGTCTGATA--TGCCAGC--------------- E_caballus300176 TC---ACTGAACTATTAGCCAGT--TTTGTCTGATGC--ATTGGC--------------- E_europaeus300171 TT---ATTAA-CCGTAAGCCAGT-TTT-GTCTGATGC--AAAAAA--------------- F_catus300149 TA---ACTGAACCATTAGCCAGTGTTTTGTCTGATGC--TTTGGC--------------- F_catus300150 T----AACT-TTTCTAAGCCAGT-TTTTGTCTGATA--TGCCAGT--------------- G_gallus300016 AC---TCATCACTCTA-GCCAGG-TCTTGTCTGATGC--ACCAGC--------------- G_gallus300017 AC---TCATCACTCTA-GCCAGA-TCTTGTCTGATGC--ACCAGC--------------- G_gallus300018 AC---TCATCACTCTA-GCCAGA-TCTTGTCTGATGC--ACCAGC--------------- G_gallus300019 --CAGACTTGTGTTTAAGCCAGA--TTTGTCTGATT-CCACAGA---------------- G_aculeatus300133 A-CTGACTTAAA-CTAAGCCAGT-T-TAGTCTGAAA-CCACATT---------------- G_aculeatus300134 A-AGCTTAAAAC--TAAGCCAGT-T-GTATCTGAAA-CCACAAA---------------- H_sapiens300491 T----CTTAT--ATTTTGCCAGT-T-AGTTCTGAT-A-CATCGGC--------------- H_sapiens300492 T-----CTACACTATTGGCCAGT--TTTGTCTGATGC--ATTGGC--------------- H_sapiens300763 T----AACT-TTTCTAAGCCAGT-TTCTGTCTGATA--TGCCAGC--------------- L_africana300360 T----AACT-TCTCTAAGTCAGT-TTCTGTCTGATA--TGC------------------- L_africana300430 T----CTTTGAACACTTGCCAGT-T-GGTTCTGATAT-ACC------------------- L_africana300431 T-----CTTAACTACTAGCCAGTTTTTTGTCTGATGC--ATTGCC--------------- M_mulatta300524 T-----CTACACTATTGGCCAGT--TTTGTCTGATGC--ATTGGC--------------- M_mulatta300525 T----CTTAT--ATTTTGCCAGT-T-AGTTCTGAT-A-CATCGGC--------------- M_domestica300026 --CAGGAATACATTTAAGCCAAA-ACTTGTCTGATTTCCATCAG---------------- M_domestica300027 C----TAATTAATCTTTGCCAGT-TTTTTTCTGACAT--ACCAGC--------------- M_domestica300028 T----CTTTGAATTTTTGCCAGT-TTGATTCTGATGC--ACCGT---------------- M_musculus300375 A----CATT-CTTTTAAGCCAGT-AT--CTTGTTTA--T--------------------- M_musculus300988 T----TTTAAAACATTTGCCAGT-T-TGTCCTGATAAACACCAGC--------------- M_musculus300989 A----CATT-CTTTTAAGCCAGT-AT--GTCTGACA--TGCCTGC--------------- M_musculus300990 TC----AAATACTAATTGCCAGT--TTTGTCTGATGC--ATCAGC--------------- M_lucifugus300016 TA---ACTAAACTATTTGCCAGT-TTTTGTCTGATGC--ATTGGC--------------- M_lucifugus300221 TA---ACTAAACTATTTGCCAGT-TTTTGTCTGATGC--ATTGGA--------------- O_anatinus303681 --CCAAGAAGCATTTTAGCCAAA-ACCTGTCTGATT-CCACCAGA--------------- O_anatinus304439 TC---ACTACACTAT--GCCAGG-TTCAATCTGATGC--ACCAGT--------------- O_anatinus304470 -----------CCGT--GTTGAT-CTCACTACACTAC--ACTACA--------------- O_anatinus304471 -----------CCGT--GTTGAT-CTCACTACACTAC--ACTACA--------------- O_anatinus304490 -----------CTTT--GCCAGT-TTCAGTTTGGTGC--ACCAGT--------------- O_anatinus304491 T----CATCGCTCTTTGGCCATT-TTCATTCTGATAC--ACCAGC--------------- O_anatinus304492 T----CAATTCCTCTTTGCCAGG-TATTTTCTGATAC--ACCAGC--------------- O_anatinus304493 TC---ACTACACTAT--GCCAGG-TTCAATCTGATGC--ACCAGT--------------- O_anatinus304516 TCCCAGAC---------------------------------------------------- O_cuniculus300262 T----CTCAGAACGCTTGCCAGT-T-GATTCTGATAC--GCCAGC--------------- O_cuniculus300263 T----ACCT-TCTCTAAGCCAGT-TTCTGTCTGACC--CGCCAGC--------------- O_cuniculus300264 TA---ACTACACGATTAGCCAGT--TTTGTCTGATGC--ATTGGC--------------- O_latipes300091 C----TCCAAGAACTAAGCCAGT-TTATGTCTGAAA-CTACATT---------------- O_latipes300092 A-AAAAAACTAAACTTTGCCAGT-T-GTGTCTGAAA-CTACATG---------------- O_latipes300093 A-GCTGCTG----ATAAGCCAGT-T-ATGTCTGAAA-CCACATC---------------- P_troglodytes300735 T----CTTAT--ATTTTGCCAGT-T-AGTTCTGAT-A-CATCGGC--------------- P_troglodytes300736 T-----CTACACTATTGGCCAGT--TTTGTCTGATGC--ATTGGC--------------- P_pygmaeus300455 T----CTTAT--ATTTTGCCAGT-T-AGTCCTGAT-A-CATCGGC--------------- P_pygmaeus300456 T-----CTACACTATTGGCCAGT--TTTGTCTGATGC--ATTGGC--------------- P_pygmaeus300633 T----CTTAT--ATTTTGCCAGT-T-AGTTCTGAT-A-CATCGGC--------------- R_norvegicus300269 T----CTTAAAACATTTGCCAGT-T-AGTTCTGATAA-CACCGGC--------------- R_norvegicus300270 A----CAGT-CTTTTAAGCCAGT-TT--ATCTGACA--TGCCTGC--------------- R_norvegicus300271 TC----ATATGCTAATAGCCAGT--TTTCTCTGATGC--ACCAGC--------------- S_cerevisiae300054 AG-GGATTTTATCTCGTTCTCTTAATGCGAATGATTTTGAAAAGATGTTGCTTCTGTGAC S_araneus300275 G----CTTATGCACTTTGCCAGT-T-GGTTCTGATCG-CACCGGC--------------- T_nigroviridis300048 C-ACTCTCGTCTTATAAGCCAAA-T-GTTGCTGAAA-CCACAAA---------------- T_nigroviridis300049 C-CAAACCAATT-TAAAGCCAAT-T-GTGTCTGAAA-CCACGTT---------------- T_nigroviridis300050 A-AAATCAGAAAACTAAGCCAGT-T-GAGTCTGAAA-CCACATGC--------------- T_belangeri300357 T-C--TTAGAACA-CTTGCCAGT-T-AGTCCTGAC-A-CACCGGC--------------- X_tropicalis300049 T---GCAATGCTTTTAAGCCAGT-T-TTGTCTGATA--CATCG----------------- X_tropicalis300050 T----TGTTGCTATTAAGCCAGT-TTT-GTCTGATA--TGTCTGT--------------- X_tropicalis300051 ---ATAATCTGATTTAAGCCAAA-CATTGTCTGA-T--ACACAGA--------------- C_familiaris300151 ------------------------------------------------------------ C_familiaris300152 ------------------------------------------------------------ C_familiaris300217 ------------------------------------------------------------ D_rerio300032 ------------------------------------------------------------ D_rerio300033 ------------------------------------------------------------ D_rerio300034 ------------------------------------------------------------ D_rerio300035 ------------------------------------------------------------ D_rerio300099 ------------------------------------------------------------ D_novemcinctus300400 ------------------------------------------------------------ D_novemcinctus300401 ------------------------------------------------------------ D_melanogaster300007 ------------------------------------------------------------ D_melanogaster300008 ------------------------------------------------------------ D_melanogaster300009 ------------------------------------------------------------ E_telfairi300477 ------------------------------------------------------------ E_telfairi300540 ------------------------------------------------------------ E_telfairi300541 ------------------------------------------------------------ E_caballus300174 ------------------------------------------------------------ E_caballus300175 ------------------------------------------------------------ E_caballus300176 ------------------------------------------------------------ E_europaeus300171 ------------------------------------------------------------ F_catus300149 ------------------------------------------------------------ F_catus300150 ------------------------------------------------------------ G_gallus300016 ------------------------------------------------------------ G_gallus300017 ------------------------------------------------------------ G_gallus300018 ------------------------------------------------------------ G_gallus300019 ------------------------------------------------------------ G_aculeatus300133 ------------------------------------------------------------ G_aculeatus300134 ------------------------------------------------------------ H_sapiens300491 ------------------------------------------------------------ H_sapiens300492 ------------------------------------------------------------ H_sapiens300763 ------------------------------------------------------------ L_africana300360 ------------------------------------------------------------ L_africana300430 ------------------------------------------------------------ L_africana300431 ------------------------------------------------------------ M_mulatta300524 ------------------------------------------------------------ M_mulatta300525 ------------------------------------------------------------ M_domestica300026 ------------------------------------------------------------ M_domestica300027 ------------------------------------------------------------ M_domestica300028 ------------------------------------------------------------ M_musculus300375 ------------------------------------------------------------ M_musculus300988 ------------------------------------------------------------ M_musculus300989 ------------------------------------------------------------ M_musculus300990 ------------------------------------------------------------ M_lucifugus300016 ------------------------------------------------------------ M_lucifugus300221 ------------------------------------------------------------ O_anatinus303681 ------------------------------------------------------------ O_anatinus304439 ------------------------------------------------------------ O_anatinus304470 ------------------------------------------------------------ O_anatinus304471 ------------------------------------------------------------ O_anatinus304490 ------------------------------------------------------------ O_anatinus304491 ------------------------------------------------------------ O_anatinus304492 ------------------------------------------------------------ O_anatinus304493 ------------------------------------------------------------ O_anatinus304516 ------------------------------------------------------------ O_cuniculus300262 ------------------------------------------------------------ O_cuniculus300263 ------------------------------------------------------------ O_cuniculus300264 ------------------------------------------------------------ O_latipes300091 ------------------------------------------------------------ O_latipes300092 ------------------------------------------------------------ O_latipes300093 ------------------------------------------------------------ P_troglodytes300735 ------------------------------------------------------------ P_troglodytes300736 ------------------------------------------------------------ P_pygmaeus300455 ------------------------------------------------------------ P_pygmaeus300456 ------------------------------------------------------------ P_pygmaeus300633 ------------------------------------------------------------ R_norvegicus300269 ------------------------------------------------------------ R_norvegicus300270 ------------------------------------------------------------ R_norvegicus300271 ------------------------------------------------------------ S_cerevisiae300054 ATTTTTTTTTAATCATTTGTGTTTGCAAACGGGAACTTTTCTTGCCAGTGTTATACAACA S_araneus300275 ------------------------------------------------------------ T_nigroviridis300048 ------------------------------------------------------------ T_nigroviridis300049 ------------------------------------------------------------ T_nigroviridis300050 ------------------------------------------------------------ T_belangeri300357 ------------------------------------------------------------ X_tropicalis300049 ------------------------------------------------------------ X_tropicalis300050 ------------------------------------------------------------ X_tropicalis300051 ------------------------------------------------------------ C_familiaris300151 ---------------- C_familiaris300152 ---------------- C_familiaris300217 ---------------- D_rerio300032 ---------------- D_rerio300033 ---------------- D_rerio300034 ---------------- D_rerio300035 ---------------- D_rerio300099 ---------------- D_novemcinctus300400 ---------------- D_novemcinctus300401 ---------------- D_melanogaster300007 ---------------- D_melanogaster300008 ---------------- D_melanogaster300009 ---------------- E_telfairi300477 ---------------- E_telfairi300540 ---------------- E_telfairi300541 ---------------- E_caballus300174 ---------------- E_caballus300175 ---------------- E_caballus300176 ---------------- E_europaeus300171 ---------------- F_catus300149 ---------------- F_catus300150 ---------------- G_gallus300016 ---------------- G_gallus300017 ---------------- G_gallus300018 ---------------- G_gallus300019 ---------------- G_aculeatus300133 ---------------- G_aculeatus300134 ---------------- H_sapiens300491 ---------------- H_sapiens300492 ---------------- H_sapiens300763 ---------------- L_africana300360 ---------------- L_africana300430 ---------------- L_africana300431 ---------------- M_mulatta300524 ---------------- M_mulatta300525 ---------------- M_domestica300026 ---------------- M_domestica300027 ---------------- M_domestica300028 ---------------- M_musculus300375 ---------------- M_musculus300988 ---------------- M_musculus300989 ---------------- M_musculus300990 ---------------- M_lucifugus300016 ---------------- M_lucifugus300221 ---------------- O_anatinus303681 ---------------- O_anatinus304439 ---------------- O_anatinus304470 ---------------- O_anatinus304471 ---------------- O_anatinus304490 ---------------- O_anatinus304491 ---------------- O_anatinus304492 ---------------- O_anatinus304493 ---------------- O_anatinus304516 ---------------- O_cuniculus300262 ---------------- O_cuniculus300263 ---------------- O_cuniculus300264 ---------------- O_latipes300091 ---------------- O_latipes300092 ---------------- O_latipes300093 ---------------- P_troglodytes300735 ---------------- P_troglodytes300736 ---------------- P_pygmaeus300455 ---------------- P_pygmaeus300456 ---------------- P_pygmaeus300633 ---------------- R_norvegicus300269 ---------------- R_norvegicus300270 ---------------- R_norvegicus300271 ---------------- S_cerevisiae300054 CATGCAGATCTGAGCC S_araneus300275 ---------------- T_nigroviridis300048 ---------------- T_nigroviridis300049 ---------------- T_nigroviridis300050 ---------------- T_belangeri300357 ---------------- X_tropicalis300049 ---------------- X_tropicalis300050 ---------------- X_tropicalis300051 ----------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved