snOPY snoRNA Orthological Gene Database

Family: SNORD12

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300151 -----------------------------------GCTGGTGTAAAT-GAT-GACTG--A C_familiaris300152 -----------------------------------GCCATTGC-AACTGAT-GACG--TA C_familiaris300217 -----------------------------------ACAAACAC-AGCTGAT-AACA--TA D_rerio300032 -----------------------------------TCTGGTAG-CAATGAT-GACTT-AA D_rerio300033 -----------------------------------TCTGGTGC-ACGTGAT-GACT--AA D_rerio300034 -----------------------------------TCTGGTGC-ACGTGAT-GACT--AA D_rerio300035 --------------------------------------GGTGC-ACATGAT-GACT--GA D_rerio300099 -----------------------------------ATTGTGGT-TAATGAT-GTT---GC D_novemcinctus300400 -----------------------------------GCTGGCTT-ATATGAT-GACT--GG D_novemcinctus300401 -----------------------------------GTTGGTGTAAAT-GAT-GACTA--A D_melanogaster300007 ----------------------------------------TTTCATATGATGAAAT---- D_melanogaster300008 ----------------------------------------TTTAGAATGAT-GATAT--- D_melanogaster300009 ----------------------------------------TTCGAAATGAT-GACAA--- E_telfairi300477 -----------------------------------GCTGGTACCAAT-GAT-GACTT--G E_telfairi300540 -----------------------------------GCTGGTACAAATTGATAGACTT--G E_telfairi300541 -----------------------------------GCCATTGC-AACTGAT-GACA--TA E_caballus300174 -----------------------------------GCTGGTGTAAAG-GAT-GACTT--C E_caballus300175 -----------------------------------ACTGGCAT-ATATGAT-GACT--GA E_caballus300176 -----------------------------------GCCACTGC-AGGTGAT-GACA--TA E_europaeus300171 ---------------------------------------------GTAGAA-AATG--CA F_catus300149 -----------------------------------GCCATTGC-AGCTGAT-GACA--TA F_catus300150 -----------------------------------ACTGGCAT-ATATGAT-GACT--GA G_gallus300016 -----------------------------------GCTGGTGT-AGGTGAT-GACT--GA G_gallus300017 -----------------------------------GCTGGTGT-AGGTGAT-GACT--GA G_gallus300018 -----------------------------------GCTGGTGT-AGGTGAT-GACT--GA G_gallus300019 -----------------------------------TCTGTGGT-ATATGAT-GACTTCAA G_aculeatus300133 -----------------------------------AATGTGGT-TGATGAT-GCT---GA G_aculeatus300134 -----------------------------------CATGTGGT-TAATGAT-GT----AC H_sapiens300491 -----------------------------------GCTGGTGTAAAT-GAT-GACTT--C H_sapiens300492 -----------------------------------GCCTTTGC-AGCTGAT-GATA--CA H_sapiens300763 -----------------------------------GCTGGCAT-ATATGAT-GACT--TA L_africana300360 ---------------------------------------GCAT-AGATGAT-GGCT--GA L_africana300430 --------------------------------------GGTATTAAGTGAT-GACTT--G L_africana300431 -----------------------------------GCCATTGC-AGCTGAT-GACA--GA M_mulatta300524 -----------------------------------GCCTTTGC-AGCTGAT-GATA--CA M_mulatta300525 -----------------------------------GCTGGTGTAAAT-GAT-GACTTTTC M_domestica300026 ------------------------------------CTGTGGTTACATGAT-GACT-AAA M_domestica300027 -----------------------------------GCTGGTAT-GTATGAT-GACT--AA M_domestica300028 -----------------------------------ACTGGTGCAAAT-GAT-GACTT--G M_musculus300375 -----------------------------------GTACACAT-GTGTGAT-GACA--CA M_musculus300988 -----------------------------------GCTGGTGTAAAT-GAT-GAACT--C M_musculus300989 -----------------------------------ACAGGCAT-GTGTGAT-GACA--CA M_musculus300990 -----------------------------------GCTGGTGA-A-CTGAT-GATA--TC O_anatinus303681 -----------------------------------TCTGTGGA-AAATGAT-GACTTGGA O_anatinus304439 -----------------------------------CCTGGTGTAATATGAT-GACT--GC O_anatinus304470 -----------------------------------TGTCTTGTAT-ATGAT-GACT--GC O_anatinus304471 -----------------------------------TGTCTTGTAT-ATGAT-GACT--GC O_anatinus304490 -----------------------------------CCTGGTGTAA-GTGAT-GACT--GA O_anatinus304491 -----------------------------------CCTGGTGT-AAATGAT-GACT--AA O_anatinus304492 -----------------------------------GCTGGTGT-ATGTGAT-GACG--AA O_anatinus304493 -----------------------------------CCTGGTGTAT-ATGAT-GACT--GC O_anatinus304516 -----------------------------------ATCAGTGT-ATGGGAT-GACA--AA O_cuniculus300262 -----------------------------------GCTGGTGTACAT-GAT-GACCT--C O_cuniculus300263 -----------------------------------GCTGGCGT-GTATGAT-GACT--GG O_cuniculus300264 -----------------------------------GCGCTTGC-AGGTGAT-GACA--TA O_latipes300091 -----------------------------------AATGTGGT-TGGTGAT-GCC---AA O_latipes300092 -----------------------------------AATGTGGT-TAATGAT-GC----AC O_latipes300093 -----------------------------------GATGTGGT-TAGTGAT-GCAT--AC P_troglodytes300735 -----------------------------------GCTGGTGTAAAT-GAT-GACTT--C P_troglodytes300736 -----------------------------------GCCTTTGC-AGCTGAT-GATA--CA P_pygmaeus300455 -----------------------------------GTTGATGCAAAT-GAT-GACTT--C P_pygmaeus300456 -----------------------------------GCCTTTGC-AGCTGAT-GATA--CA P_pygmaeus300633 -----------------------------------GTTGATGTAAAT-GAT-GACTT--C R_norvegicus300269 -----------------------------------GCTGGTGTAAAT-GAT-GACCT--C R_norvegicus300270 -----------------------------------GCAGGCAT-GTGTGAT-GACT--CA R_norvegicus300271 -----------------------------------GCTGGTGA-AGCTGAT-GATA--CC S_cerevisiae300054 GGCCCTGATGATAATGGTGTCTCTTCTTTCCTCGTCCGATTCGACCATGAC-GACAAGGG S_araneus300275 -----------------------------------GCCGGGGGACAG-GAT-GACCA--C T_nigroviridis300048 -----------------------------------AGTGTGGT-TAATGAT-GT----GC T_nigroviridis300049 -----------------------------------AATGTGGT-TGATGAT-GTC---CA T_nigroviridis300050 -----------------------------------GCTGTGGT-TGATGAT-GC----AA T_belangeri300357 -----------------------------------GCTGGTGTAAAT-GAT-GACTTC-A X_tropicalis300049 ------------------------------------CGATGTCTGTATGAT-GACT--AA X_tropicalis300050 -----------------------------------GCTGACAT-GCATGAT-GACC--AA X_tropicalis300051 -----------------------------------TCTGCTGT-ATGTGAT-GACT--AG ** C_familiaris300151 GCTTTTTTCCCCA----TCAGATCGACAATGCTGAGGT---CTTTGAACA-CTTGCCAGT C_familiaris300152 ACTTTTTTCCCCA----TCAGATCGACCCTGTTGATCT---AAGTGAACCATTAGCCAGT C_familiaris300217 ACTTTTTTCCCCA----TTAGATTAACCTTATTGATCT---AGCTGAACCATTAGCCAGT D_rerio300032 TCTTTTTTCCCCA----GCAGATCGACTCTGTTGACTTGTGAAACGAAAA-TAAGCCAAA D_rerio300033 CCTTTTTTCCCCA----GCAGATCGACTCTGTTGACCTTTAAAACGAAAA-TAAGCCAAA D_rerio300034 CCTTTTTTCCCCA----GCAGATCGACTCTGTTGACTTGTAACACGAAAAATAAGCCAAA D_rerio300035 CCTTTTTTCCCCA----GCAGATCGATAGTGTTGACTCCCTTAATCAATT-TAAGCCAAT D_rerio300099 TCTTTTTTCCCCG----TCTTATCGACTATGCTGATTC--CTCTTGAAA-ATAAGCCAAA D_novemcinctus300400 ACATTTTTCCCCA----ACAGATCCACCATGTTGATCT----AAAT-TCTCTAAGCCAGT D_novemcinctus300401 GCTTTTTTCCCCA----TCAGATCGGCAATGCTGATTTA--TTTTGAACAATTTGCCAGT D_melanogaster300007 -TTTCCTATCTCAGG-ATTCCCTCTTCTGAGTAGAACC---CTAAAACAACCGTGCTGTT D_melanogaster300008 -TTTCCGTCCGTGGAACTTATACAAAG-----TAAAATCATGCTGACATTTTATGTCTTC D_melanogaster300009 -TA-CAGTCCGTGGT-TTTACACTGAGA----CAAAGCCATGCTG-TTTGATAAGTCATT E_telfairi300477 ACTTTTTTCCCCA----TCAGATCGACAGTGTTGATGG----CTCTGAATACTTGCCAGT E_telfairi300540 ACTTTTTTCCCCA----TCAGATCGACAGTGTTGATGG----CTCTGAATACTTGCCAGT E_telfairi300541 ACTTTTTTCCCCA----TCAGATCGACCTTGTTGATCT---AGCTTAACTACTAGCCAGT E_caballus300174 ACTTTTTTCCCCA----TCAGATCGACAGTGTTGATGT----CGTTGAACACTTGCCAGT E_caballus300175 ACTTTTTTCCCCG----ACAGATCGACCATGTTGATCT----AACT-TCTCTAAGCCAGT E_caballus300176 ACTTTTTTCCCCA----TCAGATCGACCCTGTTGATCT---CACTGAACTATTAGCCAGT E_europaeus300171 AAG--ATACCCCA----TCAGATCGACCCTATTGATCT---TATTA-ACCGTAAGCCAGT F_catus300149 ACTTTTTTCCCCA----TCAGATCGACCCTGTTGATCT---AACTGAACCATTAGCCAGT F_catus300150 ACTTTTTTCCCCA----ACAGATCGACCATGTTGATCT----AACT-TTTCTAAGCCAGT G_gallus300016 ACTTTTTTCCCCA----TCAGAGCGACAGTGTTGATTA----CTCATCACTCTAGCCAGG G_gallus300017 ACTTTTTTCCCCA----TCAGAGCGACAGTGTTGATTA----CTCATCACTCTAGCCAGA G_gallus300018 ACTTTTTTCCCCA----TCAGAGCGACAGTGTTGATTA----CTCATCACTCTAGCCAGA G_gallus300019 ACTTTTTTCCCCA----TCAGATCGGCAATGCTGATA--CAGACTTGTGTTTAAGCCAGA G_aculeatus300133 ACTTTTTTCCCCA----TCTTATCGACCATGGTGAATA-CTGACTTAAA-CTAAGCCAGT G_aculeatus300134 ACTTTTTTCCCCG----TCTTATCGACCATGGTGAGAA-AGCTTAAAAC--TAAGCCAGT H_sapiens300491 ACTTTTTTCCCCA----TCAGATCGACAATGCTGACGT----CTTAT--ATTTTGCCAGT H_sapiens300492 GCTTCTTTCCCCA----TCAGATCGACCCTGTTGATCT-----CTACACTATTGGCCAGT H_sapiens300763 GCTTTTTTCCCCG----ACAGATCGACTATGTTGATCT----AACT-TTTCTAAGCCAGT L_africana300360 GCTTTTTCCCCCG----ACAGATGGACCATGTTTATCT----AACT-TCTCTAAGTCAGT L_africana300430 ACTTTTTTCCCCA----TCATATCGACAATGCTGATGT----CTTTGAACACTTGCCAGT L_africana300431 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCT-----CTTAACTACTAGCCAGT M_mulatta300524 GCTTCTTTCCCCA----TCAGATCGACCCTGTTGATCT-----CTACACTATTGGCCAGT M_mulatta300525 ACTTTTTTCCCCA----TCAGATCGACAATGCTGACGT----CTTAT--ATTTTGCCAGT M_domestica300026 ACTTTTTTCCCCA----ACTGATCGACAATGCTGAT---CAGGAATACATTTAAGCCAAA M_domestica300027 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCC----TAATTAATCTTTGCCAGT M_domestica300028 ACTTTTTTCCCCA----TCAGATCGACCTTGCTGATCT----CTTTGAATTTTTGCCAGT M_musculus300375 ACTTTTTTCCCCA----TCAGATCAACCATGTTGATCA----CATT-CTTTTAAGCCAGT M_musculus300988 ACTTTTTTCCCCG----TCATATCGACAGTGCTGATGT----TTTAAAACATTTGCCAGT M_musculus300989 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCA----CATT-CTTTTAAGCCAGT M_musculus300990 ATTTCTTTCCCCG----TCAGATCGACCCTGTTGATCT----CAAATACTAATTGCCAGT O_anatinus303681 ACTTTTTTCCCCA----ACAGATCGACAGTGTTGAT---CCAAGAAGCATTTTAGCCAAA O_anatinus304439 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCT-----CACTACACTATGCCAGG O_anatinus304470 ACTTTTTTCCCCA----TCAGATCGA------------------------CCGTGTTGAT O_anatinus304471 ACTTTTTTCCCCA----TCAGATCGA------------------------CCGTGTTGAT O_anatinus304490 ACTTTTTTCCCCA----TCAGACC--------------------------CTTTGCCAGT O_anatinus304491 ACTTTTTTCCCCA----TCAGATCGACTGTGTTGATCT----CATCGCTCTTTGGCCATT O_anatinus304492 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCT----CAATTCCTCTTTGCCAGG O_anatinus304493 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCT-----CACTACACTATGCCAGG O_anatinus304516 ACTTTTTTCCCCA----TCAGATTGACGTTGAGGCCTT----CCCAGAC----------- O_cuniculus300262 ACTTTTTTCCCCG----TCAGATCGGCCATGCTGAGGT----CTCAGAACGCTTGCCAGT O_cuniculus300263 A--TTTTTCCCCG----GCAGATCGACCGTGTTGATCT----ACCT-TCTCTAAGCCAGT O_cuniculus300264 ACTTTCTTCCCCA----TCAGATCGACACTGTTGATCT---AACTACACGATTAGCCAGT O_latipes300091 ACTTTTTTCCCCA----TCATATCGACTATGATGTAAC----TCCAAGAACTAAGCCAGT O_latipes300092 ACTTTTTTCCCCG----TCTTATCGACCATGGTGAGAA-AAAAAACTAAACTTTGCCAGT O_latipes300093 GCTTTTTTCCCCG----TCTTATCGACCATGGTGAAAA-GCTGCTG----ATAAGCCAGT P_troglodytes300735 ACTTTTTTCCCCA----TCAGATCGACAATGCTGACGT----CTTAT--ATTTTGCCAGT P_troglodytes300736 GCTTCTTTCCCCA----TCAGATCGACCCTGTTGATCT-----CTACACTATTGGCCAGT P_pygmaeus300455 GCTTTTTTCCCCA----TCGGATCGACAATGCTGACGT----CTTAT--ATTTTGCCAGT P_pygmaeus300456 ACTTCTTTCCCCA----TCAGATCGACCCTGTTGATCT-----CTACACTATTGGCCAGT P_pygmaeus300633 GCTTTTTTCCCCA----TCAGATCGACAATGCTGACGT----CTTAT--ATTTTGCCAGT R_norvegicus300269 ACTTTTTTCCCCG----TCATATCGACAGTGCTGATGT----CTTAAAACATTTGCCAGT R_norvegicus300270 ACTTTTTTCCCCA----TCAGATCGACCATGTTGATCA----CAGT-CTTTTAAGCCAGT R_norvegicus300271 ACTTCTTTCCCCA----TCAGATCGACCCTGTTGATCT----CATATGCTAATAGCCAGT S_cerevisiae300054 ATTTTATCTCGTTCTCTTAATGCGAATGATTTTGAAAAGATGTTG--CTTCTGTGACATT S_araneus300275 TCTTTTTTCCCCA----TCAGATCGACAATGCTGATGG----CTTATGCACTTTGCCAGT T_nigroviridis300048 TCTCTTT-CCCCG----ACTTATCGACTATGCTGACAC-ACTCTCGTCTTATAAGCCAAA T_nigroviridis300049 ACTTTTTTCCCCA----TCTTATCGACCATGGGGACTC-CAAACCAATT-TAAAGCCAAT T_nigroviridis300050 GCTTTTTTCCCCG----TCTTATCGACTATGGTGAAAA-AAATCAGAAAACTAAGCCAGT T_belangeri300357 CCTTTTTTCCCCA----TCAGATCGGCAATGCTGATGT---CTTAGAACA-CTTGCCAGT X_tropicalis300049 ACTTTTTTCCCCA----GCAGATCGACACTGTTGACTT---GCAATGCTTTTAAGCCAGT X_tropicalis300050 ACTTTTTTCCCCA----ACAGATCGACAGTGTTGACTT----TGTTGCTATTAAGCCAGT X_tropicalis300051 ACTTTTTTCCCCA----GCAGATCGACACTGTTGACC---ATAATCTGATTTAAGCCAAA * C_familiaris300151 -T-AGTTCTGAT-G-CACCGGC-------------------------------------- C_familiaris300152 GTTTTGTCTGATG--CATTGGC-------------------------------------- C_familiaris300217 GTTTTTTCTGATG--CATTGGA-------------------------------------- D_rerio300032 ---TTATCTGAGC--AAACTGA-------------------------------------- D_rerio300033 ---TTATCTGAAC--AACCAGA-------------------------------------- D_rerio300034 ---TTATCTGAGC--AACCAGA-------------------------------------- D_rerio300035 ---TTATCTGAAG--CACC----------------------------------------- D_rerio300099 -T-CCT-CTGAAA-CCACCAC--------------------------------------- D_novemcinctus300400 -TTCTGGCTGATA--TGCCAGC-------------------------------------- D_novemcinctus300401 -T-AATTCTGAT-A-CACCGGC-------------------------------------- D_melanogaster300007 CACTTTCCCTGTCTGAAATA---------------------------------------- D_melanogaster300008 --TTTCCCCAACTGATTAT----------------------------------------- D_melanogaster300009 --TTTCCCCAACTGATACA----------------------------------------- E_telfairi300477 -T-AGTTCTGATAA-GACCAGC-------------------------------------- E_telfairi300540 -T-AGTTCTGATAA-GACCAGC-------------------------------------- E_telfairi300541 -TTCTGTCTGATG--C-TTGGC-------------------------------------- E_caballus300174 -T-AGTTCTGATGC-A-CCAGC-------------------------------------- E_caballus300175 -TTCTGTCTGATA--TGCCAGC-------------------------------------- E_caballus300176 --TTTGTCTGATG--CATTGGC-------------------------------------- E_europaeus300171 --TTTGTCTGATG--CAAAAAA-------------------------------------- F_catus300149 GTTTTGTCTGATG--CTTTGGC-------------------------------------- F_catus300150 -TTTTGTCTGATA--TGCCAGT-------------------------------------- G_gallus300016 -TCTTGTCTGATG--CACCAGC-------------------------------------- G_gallus300017 -TCTTGTCTGATG--CACCAGC-------------------------------------- G_gallus300018 -TCTTGTCTGATG--CACCAGC-------------------------------------- G_gallus300019 --TTTGTCTGATT-CCACAGA--------------------------------------- G_aculeatus300133 -T-TAGTCTGAAA-CCACATT--------------------------------------- G_aculeatus300134 -T-GTATCTGAAA-CCACAAA--------------------------------------- H_sapiens300491 -T-AGTTCTGAT-A-CATCGGC-------------------------------------- H_sapiens300492 --TTTGTCTGATG--CATTGGC-------------------------------------- H_sapiens300763 -TTCTGTCTGATA--TGCCAGC-------------------------------------- L_africana300360 -TTCTGTCTGATA--TGC------------------------------------------ L_africana300430 -T-GGTTCTGATAT-ACC------------------------------------------ L_africana300431 TTTTTGTCTGATG--CATTGCC-------------------------------------- M_mulatta300524 --TTTGTCTGATG--CATTGGC-------------------------------------- M_mulatta300525 -T-AGTTCTGAT-A-CATCGGC-------------------------------------- M_domestica300026 -ACTTGTCTGATTTCCATCAG--------------------------------------- M_domestica300027 -TTTTTTCTGACA--TACCAGC-------------------------------------- M_domestica300028 -TTGATTCTGAT--GCACCGT--------------------------------------- M_musculus300375 -AT--CTTGTTTA--T-------------------------------------------- M_musculus300988 -T-TGTCCTGATAAACACCAGC-------------------------------------- M_musculus300989 -AT--GTCTGACA--TGCCTGC-------------------------------------- M_musculus300990 --TTTGTCTGATG--CATCAGC-------------------------------------- O_anatinus303681 -ACCTGTCTGATT-CCACCAGA-------------------------------------- O_anatinus304439 -TTCAATCTGATG--CACCAGT-------------------------------------- O_anatinus304470 -CTCACTACACTA--CACTACA-------------------------------------- O_anatinus304471 -CTCACTACACTA--CACTACA-------------------------------------- O_anatinus304490 -TTCAGTTTGGTG--CACCAGT-------------------------------------- O_anatinus304491 -TTCATTCTGATA--CACCAGC-------------------------------------- O_anatinus304492 -TATTTTCTGATA--CACCAGC-------------------------------------- O_anatinus304493 -TTCAATCTGATG--CACCAGT-------------------------------------- O_anatinus304516 ------------------------------------------------------------ O_cuniculus300262 -T-GATTCTGAT--ACGCCAGC-------------------------------------- O_cuniculus300263 -TTCTGTCTGACC--CGCCAGC-------------------------------------- O_cuniculus300264 --TTTGTCTGATG--CATTGGC-------------------------------------- O_latipes300091 -TTATGTCTGAAA-CTACATT--------------------------------------- O_latipes300092 -T-GTGTCTGAAA-CTACATG--------------------------------------- O_latipes300093 -T-ATGTCTGAAA-CCACATC--------------------------------------- P_troglodytes300735 -T-AGTTCTGAT-A-CATCGGC-------------------------------------- P_troglodytes300736 --TTTGTCTGATG--CATTGGC-------------------------------------- P_pygmaeus300455 -T-AGTCCTGAT-A-CATCGGC-------------------------------------- P_pygmaeus300456 --TTTGTCTGATG--CATTGGC-------------------------------------- P_pygmaeus300633 -T-AGTTCTGAT-A-CATCGGC-------------------------------------- R_norvegicus300269 -T-AGTTCTGATAA-CACCGGC-------------------------------------- R_norvegicus300270 -TT--ATCTGACA--TGCCTGC-------------------------------------- R_norvegicus300271 --TTTCTCTGATG--CACCAGC-------------------------------------- S_cerevisiae300054 --TTTTTTTAATCATTTGTGTTTGCAAACGGGAACTTTTCTTGCCAGTGTTATACAACAC S_araneus300275 -T-GGTTCTGATCG-CACCGGC-------------------------------------- T_nigroviridis300048 -T-GTTGCTGAAA-CCACAAA--------------------------------------- T_nigroviridis300049 -T-GTGTCTGAAA-CCACGTT--------------------------------------- T_nigroviridis300050 -T-GAGTCTGAAA-CCACATGC-------------------------------------- T_belangeri300357 -T-AGTCCTGAC-A-CACCGGC-------------------------------------- X_tropicalis300049 -T-TTGTCTGATA--CATCG---------------------------------------- X_tropicalis300050 -TTT-GTCTGATA--TGTCTGT-------------------------------------- X_tropicalis300051 -CATTGTCTGATA--CACAGA--------------------------------------- C_familiaris300151 --------------- C_familiaris300152 --------------- C_familiaris300217 --------------- D_rerio300032 --------------- D_rerio300033 --------------- D_rerio300034 --------------- D_rerio300035 --------------- D_rerio300099 --------------- D_novemcinctus300400 --------------- D_novemcinctus300401 --------------- D_melanogaster300007 --------------- D_melanogaster300008 --------------- D_melanogaster300009 --------------- E_telfairi300477 --------------- E_telfairi300540 --------------- E_telfairi300541 --------------- E_caballus300174 --------------- E_caballus300175 --------------- E_caballus300176 --------------- E_europaeus300171 --------------- F_catus300149 --------------- F_catus300150 --------------- G_gallus300016 --------------- G_gallus300017 --------------- G_gallus300018 --------------- G_gallus300019 --------------- G_aculeatus300133 --------------- G_aculeatus300134 --------------- H_sapiens300491 --------------- H_sapiens300492 --------------- H_sapiens300763 --------------- L_africana300360 --------------- L_africana300430 --------------- L_africana300431 --------------- M_mulatta300524 --------------- M_mulatta300525 --------------- M_domestica300026 --------------- M_domestica300027 --------------- M_domestica300028 --------------- M_musculus300375 --------------- M_musculus300988 --------------- M_musculus300989 --------------- M_musculus300990 --------------- O_anatinus303681 --------------- O_anatinus304439 --------------- O_anatinus304470 --------------- O_anatinus304471 --------------- O_anatinus304490 --------------- O_anatinus304491 --------------- O_anatinus304492 --------------- O_anatinus304493 --------------- O_anatinus304516 --------------- O_cuniculus300262 --------------- O_cuniculus300263 --------------- O_cuniculus300264 --------------- O_latipes300091 --------------- O_latipes300092 --------------- O_latipes300093 --------------- P_troglodytes300735 --------------- P_troglodytes300736 --------------- P_pygmaeus300455 --------------- P_pygmaeus300456 --------------- P_pygmaeus300633 --------------- R_norvegicus300269 --------------- R_norvegicus300270 --------------- R_norvegicus300271 --------------- S_cerevisiae300054 ATGCAGATCTGAGCC S_araneus300275 --------------- T_nigroviridis300048 --------------- T_nigroviridis300049 --------------- T_nigroviridis300050 --------------- T_belangeri300357 --------------- X_tropicalis300049 --------------- X_tropicalis300050 --------------- X_tropicalis300051 ---------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved