snOPY snoRNA Orthological Gene Database

Family: SNORD114

CLUSTAL W (1.83) multiple sequence alignment H_sapiens300012 TGAACTA-GTGGTGATGGCTTGTGGCATATTTAGTCACAGATGATGAATAAATAC---AT H_sapiens300013 TTGATGATATGATGGCCACTGGTGGCTTATG-AGTCTTATACAGTGAAT----AC---AT H_sapiens300014 TGGATCG-ATGATGACTGCTGGTGGCGTATG-AGTCTTACATGATGAAT----AC---GT H_sapiens300015 AAGATCA-ATGATGACTACTGTTAGTGTATG-AGTTACACATGATGAAT----AC---AT H_sapiens300016 TGGACCA-GTGATGGTGACTGGTGGTGTGTG-AGTCATGCACAGTGAATAT-CAT---GT H_sapiens300017 TGGACCA-ATGATGACAAATACCGGCGTATG-AGTCTTGGATGATGAATAA-TAC---GT H_sapiens300018 TGGACCA-GTGATGACCACTGGTGGCATATG-AGTCATACACA-TGAACAC-CAT---GT H_sapiens300019 TGGACCA-ATGATGACAACTGCCGGCGTATG-AGTGTTGGGTGATGAATAA-TAC---GT H_sapiens300020 TGGATCG-ATGATGACCACTGGTGGCGTATG-AGTCATACATGATGAAT----AT---GT H_sapiens300021 TGGACCA-ATTATGACTACTGGT-----GTG-AGTCACGCATAATGAACAC-CAC---GT H_sapiens300022 TGGACCA-ATGATGACAAATGGTGGCATTGG-AGTTATGGACGATGAATGA-TAT---GT H_sapiens300023 TAGATCA-GTGATGACTACTGTTGGTGTATG-AGTCATATACGATGAAT----AC---AT H_sapiens300024 TGGATCA-ATGATAAAACTTGCTGGCATATG-AATCTTGGATAATGGATGA-TAC---GT H_sapiens300028 TGGATCG-ATGATGACTACTGGTGGCGTATG-AGTCATCTACAGTGAAT----AC---GT H_sapiens300029 TGGATCA-ATGATGACCACTGGTGGCGTATG-AGTCATATGTGATGAAT----AC---GT H_sapiens300030 TGGATCG-ATGATGACTACCGGTGGCGTATG-AGTCATATGTGATGAAT----AC---GT H_sapiens300031 TGGATCG-ATGATGACTACTGGTGGCGTATG-AGTCATAGACAATGAAT----AC---GT H_sapiens300032 TGGATCG-ATGGTGACTGTTGATGGCATATG-ACTCACATATGATGAGT----AC---GT H_sapiens300033 TGGATCG-ATGATGACTACTGGTGGCGTATG-AGTCTTTTGCGATGAAT----AC---GT H_sapiens300034 TGGATCG-ATGATGAGCACTGGTGGAGTATG-AGTCACATACGATGAAT----AC---GT H_sapiens300035 TGGTTCA-GTGTTGACTACTGGTGTCGTGTG-AGTCATA--CAATGAAT----AC---AT H_sapiens300036 TGGATCG-ATGATGACTGCTGGTGGCGTATG-AGTCATATGCGATGAAT----AC---GT H_sapiens300037 TGGATCG-ATGATGACTACTGGTAGC--ATG-AGTCATATACAGTGAAT----AC---AT H_sapiens300038 TGGATCA-ATCATGACTACTGGTATTGGATG-GGTCTTCGTCAGTGAAT----GC---CT H_sapiens300039 TGAGCAA-GCGATGACAGCCGGTGGTGTGTG-AGTCATGGAGGATGAATAC-TAA---GT H_sapiens300410 TGGACCT-ATGATGATGACTGGTGGCGTATG-AGTCATTGACGGTGAATA--CAG----- H_sapiens300411 GGGACCA-ATGATAATGACTGTTGGGGTATG-AGTCAGTGAGGTTGAATAA-CAGTTTGT H_sapiens300412 TGGACCA-ATGATGACCACTGGTGGCGTTTG-AGTCATGGACGATGAATAC-TAC---GT H_sapiens300413 TGAGCCA-GTGATGAAAACTGGTGGCATAGA-AGTCAAGGATGCTGAATAA-TGT---GT H_sapiens300414 TGGATTG-ATGATGACCACTGGTGGCCTATG-AGTCAT--ACAATGAAT----AC---GT H_sapiens300416 TGGATCA-ATGATGTCCACTGGTGGCGTATA-AATCATATTTGGTGAAT----AT---AT * * ** H_sapiens300012 GCCTGAGACTCTGAGGTTAGT H_sapiens300013 GTTTGAAACTCTGAGGTCTGT H_sapiens300014 GTCTGGAACTCTGAGGTCCAT H_sapiens300015 GTCTGAAACTCTGAGGTCCAT H_sapiens300016 GTCTGGAACTCTGAGGTCCAA H_sapiens300017 GTCTGGAACTCTGAGGTCCAT H_sapiens300018 TTCTAGAACTCTGAGGTCCAA H_sapiens300019 GTCTAGAACTCTGAGGTCCAA H_sapiens300020 GTCTGGAACTCTGAGGTCCTT H_sapiens300021 GTCTGGAACTCTGAGGTCCAA H_sapiens300022 GTCTGAAACTCTGAGGTCCAA H_sapiens300023 GTCTGAAATTCTGAGGTCCAA H_sapiens300024 GTGTGGAACTCTGAGGTCCAA H_sapiens300028 CTCTGGAACTCTGAGGTCTGT H_sapiens300029 GTCTGGAACTCTGAGGTCCAC H_sapiens300030 GTTTGGAACTCTGAGGTCCAT H_sapiens300031 GTCTGGAACTCTGAGGTCCAT H_sapiens300032 ATCTGGAACTCTGAGGTCTGT H_sapiens300033 GTCTAGAACTCTGAGGTCCGT H_sapiens300034 GTCTGGAACTCTGAGGTCCAT H_sapiens300035 GTCTGGAACTCTGAGGCCCAT H_sapiens300036 GTCTAGAACTCTGAGGTCCAT H_sapiens300037 GTCTGGAACTCTGAGGTCTGT H_sapiens300038 ATCTGGAACTCTGAGGTCCAT H_sapiens300039 GCCTGGAACTCTGAGGTTCAA H_sapiens300410 GTCTGGAAGTCTGAGGTCCA- H_sapiens300411 ATCTGGAAATCTGAGGTCCAA H_sapiens300412 GTCTGAAACTCTGAGGTCCAA H_sapiens300413 GTCTAGAACTCTGAGGTTCAA H_sapiens300414 GTCTAGAACTCTGAGGTCCAT H_sapiens300416 GTCTGGAACTCTGAGGTCCAA * * *******

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved