snOPY snoRNA Orthological Gene Database

Family: SNORD111

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300344 --TAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA C_porcellus300869 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA C_porcellus300870 --TAGCCTGAAATGATGCC-----TA---AATTTCATGTCTCTTCTCTGA C_intestinalis300003 --TCGATCACAATGATGAAAC---AT------TTCATGTCTCTTCTCTGA C_intestinalis300004 --TCGATCACAATGATGAAAC---AT------TTCATGTCTCTTCTCTGA C_intestinalis300005 --TTGATCACAATGATGAAAC---AT------TTCATGTCTCTTCTCTGA C_savignyi300017 --GTGATTACAATGATGATTT---TA------CACATGTCTCTTCTCTGA D_rerio300137 --CTGTCA-AAATGATGAATA---TC------TTCATGTCTCTTCTCTGA D_rerio300138 ----TAATGAAATGATGAGCT---T-------TTCATGTCTCTTCTCTGA D_rerio300139 --GTGCCAGAAATGATGATTA---TC------TTCATGTCTCTTCTCTGA D_rerio300140 --GTGCCAGAAATGATGAATA---TC------TTCATGTCTCTTCTCTGA D_novemcinctus300570 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA E_telfairi300427 --CCGCCTGAAATGATGATTCTTCAA----ATTTCATGTCTCTTCTCTGA E_telfairi300807 --CGGCCTGAAGTGATGATTAA--CA------TTCATGTCTCTTCTCTGA E_telfairi300808 --TAGCCTGAAATGATGATTCT-TCA---AATTTCATGTCTCTTCTCTGA E_caballus300251 --CAGCCTGAAATGATGATTCT-TTA---CTTTTCATGTCTCTTCTCTGA E_caballus300252 --TGGCCTGAAGTGATGATTCA--GG------TTCATGTCTCTTCTCTGA E_europaeus300621 --CAGCCTGAAGTGATGATTTA--TA------TTCATGTCTCTTCTCTGA E_europaeus300622 --CAGCCTGAAATGATGATTCT-TTA---AATTTCATGTCTCTTCTCTGA H_sapiens300592 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA H_sapiens300593 --CAGCCTGAAATGATGACTCT-TTAAAAAATTTCATGTCTCTTCTCTGA L_africana300462 --CAGCCTGAAGTGATGACTCA--CA------TTCATGTCTCTTCTCTGA L_africana300463 --CAGCCTGAAATGATGATTCT-TTA---AATTTCATGTCTCTTCTCTGA M_mulatta300617 --CAGCCTGAAATGATGACTCT-TTA---AATTTCATGTCTCTTCTCAGA M_mulatta300618 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_murinus300459 --AAGCCT-AAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_murinus300460 --CAGCCTGAAATGATGACTCTCTTA---AATTTCATGTCTCTTCTCCGA M_domestica300136 --CAGCCTGAAATGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_domestica300137 --TTGCCTGAAATGATGATT----AT-----TTCATGAATCTTCTCTGAA M_musculus300813 --CAGCCTGAAATGATGACCAT-TTA---A--TTCATGTCTCTTCTCTGA M_musculus300814 --CAGCCTGAAGTGATGATTCA--CA------ATCATGTCTCTTCTCTGA O_anatinus302226 --AGGCCTGGAATGATGATCCA--GA------TTCATGTCTCTTCTCTGA O_anatinus302227 --TTGCCTGAAATGATGACTAT----------TTCATGTCTCTTCTGAGA O_anatinus302228 --CTGCCTGAAATGATGAGTTC--AC------TTCATGTCTCTTCTCTGA O_anatinus302229 CAGCCTAAGTGATAATGATTC---TT------CCTGTCTCTTCTCTGAGA O_anatinus303360 --AGGCCTGGAATGATGATCCA--GA------TTCATGTCTCTTCTCTGA O_anatinus303735 CAGCCTAAGAGATAATGATTC---TT------CCTGTCTCTTCTCTGAGA O_cuniculus300493 --TAGTCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA O_cuniculus300494 --AAGGCTGAAATGATGACAAT-GTA---AATTTCATGTCTCTTCTCTGA O_latipes300071 -----TTGAGTGTGATGAATT---TT-------CCATGTCTCTTCTCTGA O_latipes300075 --GCTGCAGAAGTGATGAGCT---CT-------TCATGTCTCTTCTCTGA O_latipes300076 --TCTGCAGAAATTATGAGTT---TT-------TCATGTCTCTTCTCTGA O_garnettii300500 ----AACTGAAATGATGAGTCA--CA------TTCATGTCTCTTCTCTGA O_garnettii300707 --CAGCCTGAAATGATGAGTCA--CA------TTCATGTCTCTTCTCTGA P_troglodytes300690 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA P_troglodytes300691 --CAGCCTGAAATGATGACTCT-TTAAAAAATTTCATGTCTCTTCTCTGA P_pygmaeus300193 --TTTCCAGAATTATGGGTTTGACAA-----ACCAAAACACTCATT---A P_pygmaeus300301 --TTTCCAGAATTATGGGTTTGACAA-----ACCAAAACGCTCATT---A P_pygmaeus300753 --CAGCCTGAAATGATGACTCT-TTA---AATTTCATGTCTCTTCTCTGA P_pygmaeus300754 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA R_norvegicus300598 --GGTCCTGAAGTGATGACTCA-----------CAATGTTTCTTCTCTGA R_norvegicus300981 --CAGCCTGAAATGATGACTAT-TTA---A--TTCGTGTCTCTTCTCTGA S_araneus300095 -TAGCAAAAAGATGTTTATTT---TA------TTCATGTCTCTTCTCT-- S_araneus300955 --GGGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA S_araneus300956 --CAGCCTGACAGGATGATCAT-TTA---AATTTCATGTCTCTTCTCTGA S_tridecemlineatus300007 --GTGCCAGAAATGATGATTTTAGAT-----TTTAACGAATTAATTTTGA S_tridecemlineatus300335 --CAGC-TGAAGTGATGAT-CA--CA------T-CATGTCTCTTCTCTGA T_nigroviridis300060 GTGCTGTAAAGCTGATGAGTT---T--------TCATGTCTCTTCTCTGA T_nigroviridis300061 -TGCTGTGGACGTGATGAGCT---CC-------TCATGTCTCTTCTCTGA T_nigroviridis300169 ----TTGAAAAGTGATGAGTT---TG------TTCATGTCTCTTCTCTGA X_tropicalis300041 ---GCAACAAAGTGATGAG-T---T-------TTCATGTCTCTTCTCTGA C_familiaris300344 ---TAAA-TCTTTTGAAGGAAATTCT-GT---GT--ATCTGATCAGGCCT C_porcellus300869 ---TAAA-T-T-TTGAAGAAAATTCT-GT---GT--GTCTGATCAGGCTT C_porcellus300870 ---CAATTTTGTCTGGAGATGGTTTTTGCCTTATTGATCTGATCAGGCTG C_intestinalis300003 ---TTAA-GAATGAAAG---ATATTTTTAT-TAT---TCTGAGTGATCAA C_intestinalis300004 ---TTAA-GAATGAAAG---ATATTTTTAT-TAT---TCTGAGTGATCAA C_intestinalis300005 ---TAAA-GAATGAAAG---ATATTTTTAT-TAT---TCTGAGTGATCTA C_savignyi300017 ---TTAA-AAATGAAACGATACATTTTTATACTT---TCTGAGTAATCAC D_rerio300137 ---CTG----TTTGGTGGAGAGATTGTCTT-GAT--ATCTGATTTTCATG D_rerio300138 -----CT-ATTTGACTGG--AGACGCATAAAGAC--CTCTGATCATAATA D_rerio300139 ---CTG----TTTGGTGAAGAGAGATTTGT-GAT--ATCTGATCTTCATG D_rerio300140 ---TTG----TTTAGTGAAGAGAGATTTGT-GAT--ATCTGATCTTCATG D_novemcinctus300570 ---TAAA-TCTCTTGAAGACAGTTCT-GT---GT--ATCTGATCAGGCCT E_telfairi300427 ---TATGTTTCTCTGAAGATACATTTCGCCATACTGATCTGATCAGGCTA E_telfairi300807 ---TAAA-TGTCTTGAAGATAATGTT-GT---G---ATCTGACCAGGCCT E_telfairi300808 ---CATGTTTCTCTGGAGATAATTCTTGCCTTACTGATCTGATCAGGCTG E_caballus300251 ---CGTTTTTCTCTGGAGATAGTTCTTGCCTTAC-AATCTGATCAGGCTG E_caballus300252 ---TAAA-C-CTCTTGAAGAAAATCT-GT---GT--ATCTGATCAGGCCT E_europaeus300621 ---TAAA-TCTCTTGAAGAAACTTCT-GT---GT--ATCTGATCAGGCCT E_europaeus300622 ---CAT--TTCTCTGGAGATAGTTTTTGCCTTACTGTTCTGATCAGGCTG H_sapiens300592 ---TAAA-T-TCTTGAAGAAAATTTTTGT---GT--GTCTGATCAGGCCT H_sapiens300593 ---CATTTTTCTCTGGACACAGTTTTTGCCTTATGAATCTGATCAGGCTG L_africana300462 ---TGGA-TGTCTTGAAGAAATTTTT-GT---GT--ATCTGACCAGGACT L_africana300463 ---CATGTTTCTCTGGAGATACTGCTTGCCTTACTGATCTGATCAGGCTG M_mulatta300617 ---CATTTTTCTCTGGAGATAATTTTTGCCTTATGGATCTGATCAGGCTG M_mulatta300618 ---TAAA-T-TTTTGAAGACAATTTT-GT---GT--ATCTGATCAGGCCT M_murinus300459 ---TATA-T-TCTTGAAGAAAATTCG-GT---GT--ATCTGATC-GGCCT M_murinus300460 ---CATTTTTCTGTGGAGATAGCTTTTGCCTTATTGATCTGATCAGGCTA M_domestica300136 ---GATT-TCTTCTGGAGAAAATATG-GT---GT--AACTGATCAGGCTT M_domestica300137 ACTTTTTTCTCTGAAGACAAAAACTTACCTCTCTGAATCTGATCGGGCAC M_musculus300813 ---CATTCTCCTCTGGAGATGATTTTTGCCTTATTGATCTGATCAGGCTG M_musculus300814 ---AGAA-TTC----ATGGAGATTCT-GT---GT--ATCTGATCAGGCCT O_anatinus302226 ---GATT-TCCTCTGGAGAAAATCCT-GTTTTTT--ATCTGATCGGGCCT O_anatinus302227 ---CTCCTGAAGCTCTGGAGATAGCACTT---ACCTCTCTGATCAGGCAT O_anatinus302228 ---AATC-TTCCCTGGAGACACAATTAACCTCGCTGATCTGATCAGGCTG O_anatinus302229 ---TTTG-CTATGAAGAGGCTTGTATTTTTATTC--CTCTGATCAGACTG O_anatinus303360 ---GATT-TCCTCTGGAGAAAATCCT-GT---TT--ATCTGATCGGGCCT O_anatinus303735 ---TTTG-CTATGAAGAGGCTTGTATTTTTATTC--CTCTGATCAGACTG O_cuniculus300493 ---TAAA-T-TCTTGAAGAAAATTCT-GT---GT--ATCTGATCAGGCTT O_cuniculus300494 ---CATTTTCCTCTGGAGATAGTTTCTGCCTCACTGGTCTGATCAGGCTG O_latipes300071 ---CT-----GTTACTGGAGAAAGATTT---GAT--TTCTGATCTCAG-- O_latipes300075 ---TGAA-TCAT--GAGCAGAGAATTTT----GA--CTCTGATCTGAGCT O_latipes300076 ---TTCA-GCATCTGTGGGGAGAACTTTTA-GAC--CTCTGATCTGCAGA O_garnettii300500 ---TAAA-TTC-CTGAAGAAAATTCT-GT---GT--AAAAAAATAATAAT O_garnettii300707 ---TAAA-TTC-TTGAAGAAAATTCT-GT---GT--ATCTGATCGGGCCT P_troglodytes300690 ---TAAA-T-TCTTGAAGAAAATTTTTGT---GT--GTCTGATCAGGCCT P_troglodytes300691 ---CATTTTTCTCTGGAGACAGTTTTTGCCTTATGAAACTGATCAGGCTG P_pygmaeus300193 ---TTTTCTTCTCTAGAGAGAGTTTTTACCTTATGGATCTGATCAGGAAA P_pygmaeus300301 ---TTTTCTTCTCTAGAGAGAGTTTTTACCTTATGGATCTGATCAGGAAA P_pygmaeus300753 ---CATTTTTCTCTGGAGACAGTTTTTGCCTTATGGATCTGATCAGGCTG P_pygmaeus300754 ---TAAA-T-TCTTGAAGAAAATTTT-GT---GT--GTCTGATCAGGCCT R_norvegicus300598 ---TTAA-T-TCTTGAGGGAAAGTGT-GT---GT--ATCTCATCAGGCCT R_norvegicus300981 ---CATTCTCCTCTGGAGATGATTTTTGCCTTGCTGATCTGATGAGGCTG S_araneus300095 ---TTAC-TGCTTGTAT---ATTTTTCTTTTCAT--GTCTGAACATGCCA S_araneus300955 ---TGAA-TCTCATGAAGAAACTTCT-GT---GT--ATCTGATCAGCCTC S_araneus300956 ---CATTGTTCTTTGGAGAT-ATTCATGCCTTATTGATCTGATCAGGTTG S_tridecemlineatus300007 ---TATTCTACTGAAAAAAAAATTTAAATTAGATATATTTAATAGGCCA- S_tridecemlineatus300335 ---TAAA-T-TTTTGAAGGAAATTCT-GT---GT--ATCTGATCAGGCCT T_nigroviridis300060 ---CTAA-ACATCAATGAAGAGGACTTTCA-CCA--CTCTGATCTCAGCA T_nigroviridis300061 ---ATAA-AAACCAATGAAGAGAACTTTCA-CAA--CTCTGATCTCAGCA T_nigroviridis300169 ---GTCA-AAA---GTGAAGAGTG-TTGAA-TGT--CTCTGATTTCAG-- X_tropicalis300041 ---GATA-AAATATGAAG--AGAACAAAAAATGC--ATCTGATCA-GCTG * C_familiaris300344 ---- C_porcellus300869 ---- C_porcellus300870 ---- C_intestinalis300003 TTGT C_intestinalis300004 TTGT C_intestinalis300005 ---- C_savignyi300017 ---- D_rerio300137 CAT- D_rerio300138 ---- D_rerio300139 CAC- D_rerio300140 CAC- D_novemcinctus300570 ---- E_telfairi300427 ---- E_telfairi300807 ---- E_telfairi300808 ---- E_caballus300251 ---- E_caballus300252 ---- E_europaeus300621 ---- E_europaeus300622 ---- H_sapiens300592 ---- H_sapiens300593 ---- L_africana300462 T--- L_africana300463 ---- M_mulatta300617 ---- M_mulatta300618 ---- M_murinus300459 ---- M_murinus300460 ---- M_domestica300136 ---- M_domestica300137 ---- M_musculus300813 ---- M_musculus300814 ---- O_anatinus302226 ---- O_anatinus302227 ---- O_anatinus302228 ---- O_anatinus302229 ---- O_anatinus303360 ---- O_anatinus303735 ---- O_cuniculus300493 ---- O_cuniculus300494 ---- O_latipes300071 ---- O_latipes300075 GT-- O_latipes300076 ---- O_garnettii300500 T--- O_garnettii300707 ---- P_troglodytes300690 ---- P_troglodytes300691 ---- P_pygmaeus300193 ---- P_pygmaeus300301 ---- P_pygmaeus300753 ---- P_pygmaeus300754 ---- R_norvegicus300598 ---- R_norvegicus300981 ---- S_araneus300095 ---- S_araneus300955 ---- S_araneus300956 ---- S_tridecemlineatus300007 ---- S_tridecemlineatus300335 ---- T_nigroviridis300060 T--- T_nigroviridis300061 ---- T_nigroviridis300169 ---- X_tropicalis300041 C---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved