snOPY snoRNA Orthological Gene Database

Family: SNORD111

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300344 --TAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA C_porcellus300869 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA C_porcellus300870 --TAGCCTGAAATGATGCC-----TA---AATTTCATGTCTCTTCTCTGA C_intestinalis300003 --TCGATCACAATGATGAAACA--T-------TTCATGTCTCTTCTCTGA C_intestinalis300004 --TCGATCACAATGATGAAACA--T-------TTCATGTCTCTTCTCTGA C_intestinalis300005 --TTGATCACAATGATGAAACA--T-------TTCATGTCTCTTCTCTGA C_savignyi300017 --GTGATTACAATGATGATTTT--A-------CACATGTCTCTTCTCTGA D_rerio300137 --CTGTCA-AAATGATGAATAT--C-------TTCATGTCTCTTCTCTGA D_rerio300138 ----TAATGAAATGATGAGCTT----------TTCATGTCTCTTCTCTGA D_rerio300139 --GTGCCAGAAATGATGATTAT--C-------TTCATGTCTCTTCTCTGA D_rerio300140 --GTGCCAGAAATGATGAATAT--C-------TTCATGTCTCTTCTCTGA D_novemcinctus300570 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA E_telfairi300427 --CCGCCTGAAATGATGATTCTTCAA----ATTTCATGTCTCTTCTCTGA E_telfairi300807 --CGGCCTGAAGTGATGATTAA--CA------TTCATGTCTCTTCTCTGA E_telfairi300808 --TAGCCTGAAATGATGATTCT-TCA---AATTTCATGTCTCTTCTCTGA E_caballus300251 --CAGCCTGAAATGATGATTCT-TTA---CTTTTCATGTCTCTTCTCTGA E_caballus300252 --TGGCCTGAAGTGATGATTCA--GG------TTCATGTCTCTTCTCTGA E_europaeus300621 --CAGCCTGAAGTGATGATTTA--TA------TTCATGTCTCTTCTCTGA E_europaeus300622 --CAGCCTGAAATGATGATTCT-TTA---AATTTCATGTCTCTTCTCTGA G_gorilla300248 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA G_gorilla300247 --CAGCCTGAAATGATGACTCT-TTAAAAAATTTCATGTCTCTTCTCTGA H_sapiens300592 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA H_sapiens300593 --CAGCCTGAAATGATGACTCT-TTAAAAAATTTCATGTCTCTTCTCTGA L_africana300462 --CAGCCTGAAGTGATGACTCA--CA------TTCATGTCTCTTCTCTGA L_africana300463 --CAGCCTGAAATGATGATTCT-TTA---AATTTCATGTCTCTTCTCTGA M_mulatta300617 --CAGCCTGAAATGATGACTCT-TTA---AATTTCATGTCTCTTCTCAGA M_mulatta300618 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_murinus300459 --AAGCCT-AAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_murinus300460 --CAGCCTGAAATGATGACTCTCTTA---AATTTCATGTCTCTTCTCCGA M_domestica300136 --CAGCCTGAAATGATGATTCA--CA------TTCATGTCTCTTCTCTGA M_domestica300137 --TTGCCTGAAATGATGATTAT----------TTCATGAATCTTCTCTGA M_musculus300813 --CAGCCTGAAATGATGACCAT-TTA---A--TTCATGTCTCTTCTCTGA M_musculus300814 --CAGCCTGAAGTGATGATTCA--CA------ATCATGTCTCTTCTCTGA M_lucifugus300655 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA O_anatinus302228 --CTGCCTGAAATGATGAGTTC--AC------TTCATGTCTCTTCTCTGA O_anatinus302229 CAGCCTAAGTGATAATGATTCT--T-------CCTGTCTCTTCTCTGAGA O_anatinus303360 --AGGCCTGGAATGATGATCCA--GA------TTCATGTCTCTTCTCTGA O_anatinus303735 CAGCCTAAGAGATAATGATTCT--T-------CCTGTCTCTTCTCTGAGA O_anatinus302226 --AGGCCTGGAATGATGATCCA--GA------TTCATGTCTCTTCTCTGA O_anatinus302227 --TTGCCTGAAATGATGACTAT----------TTCATGTCTCTTCTGAGA O_cuniculus300493 --TAGTCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA O_cuniculus300494 --AAGGCTGAAATGATGACAAT-GTA---AATTTCATGTCTCTTCTCTGA O_latipes300071 -----TTGAGTGTGATGAATTT--T--------CCATGTCTCTTCTCTGA O_latipes300075 --GCTGCAGAAGTGATGAGCTC--T--------TCATGTCTCTTCTCTGA O_latipes300076 --TCTGCAGAAATTATGAGTTT--T--------TCATGTCTCTTCTCTGA O_garnettii300500 ----AACTGAAATGATGAGTCA--CA------TTCATGTCTCTTCTCTGA O_garnettii300707 --CAGCCTGAAATGATGAGTCA--CA------TTCATGTCTCTTCTCTGA P_troglodytes300690 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA P_troglodytes300691 --CAGCCTGAAATGATGACTCT-TTAAAAAATTTCATGTCTCTTCTCTGA P_pygmaeus300301 --TTTCCAGAATTATGGGTTTGACAA-----ACCAAAACGCTCATT---A P_pygmaeus300753 --CAGCCTGAAATGATGACTCT-TTA---AATTTCATGTCTCTTCTCTGA P_pygmaeus300754 --CAGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA P_pygmaeus300193 --TTTCCAGAATTATGGGTTTGACAA-----ACCAAAACACTCATT---A R_norvegicus300598 --GGTCCTGAAGTGATGACTCA-----------CAATGTTTCTTCTCTGA R_norvegicus300981 --CAGCCTGAAATGATGACTAT-TTA---A--TTCGTGTCTCTTCTCTGA S_araneus300095 -TAGCAAAAAGATGTTTATTTT--A-------TTCATGTCTCTTCTCT-- S_araneus300955 --GGGCCTGAAGTGATGATTCA--CA------TTCATGTCTCTTCTCTGA S_araneus300956 --CAGCCTGACAGGATGATCAT-TTA---AATTTCATGTCTCTTCTCTGA S_tridecemlineatus300007 --GTGCCAGAAATGATGATTTTAGAT-----TTTAACGAATTAATTTTGA S_tridecemlineatus300335 --CAGC-TGAAGTGATGAT-CA--CA------T-CATGTCTCTTCTCTGA T_nigroviridis300060 GTGCTGTAAAGCTGATGAGTTT-----------TCATGTCTCTTCTCTGA T_nigroviridis300061 -TGCTGTGGACGTGATGAGCTC--C--------TCATGTCTCTTCTCTGA T_nigroviridis300169 ----TTGAAAAGTGATGAGTTT--G-------TTCATGTCTCTTCTCTGA X_tropicalis300041 ---GCAACAAAGTGATGAG-TT----------TTCATGTCTCTTCTCTGA * C_familiaris300344 TAAA---TCTTTTGAAGG--AAATTCT-GTGT-----ATCTGATCAGGCC C_porcellus300869 TAAA---T-T-TTGAAGA--AAATTCT-GTGT-----GTCTGATCAGGCT C_porcellus300870 CAATT--TTGTCTGGAGA--TGGTTTTTGCCTTATTGATCTGATCAGGCT C_intestinalis300003 TTAA---GAATGAAAG-----ATATTTTTAT-TAT---TCTGAGTGATCA C_intestinalis300004 TTAA---GAATGAAAG-----ATATTTTTAT-TAT---TCTGAGTGATCA C_intestinalis300005 TAAA---GAATGAAAG-----ATATTTTTAT-TAT---TCTGAGTGATCT C_savignyi300017 TTAA---AAATGAAACGA--TACATTTTTATACTT---TCTGAGTAATCA D_rerio300137 CTGT---TTG---GTGGA--GAGATTGTCTT-GAT--ATCTGATTTTCAT D_rerio300138 --CT---ATTTGACTGG----AGACGCATAAAGAC--CTCTGATCATAAT D_rerio300139 CTGT---TTG---GTGAA--GAGAGATTTGT-GAT--ATCTGATCTTCAT D_rerio300140 TTGT---TTA---GTGAA--GAGAGATTTGT-GAT--ATCTGATCTTCAT D_novemcinctus300570 TAAA---TCTCTTGAAGA--CAGTTCT-GTGT-----ATCTGATCAGGCC E_telfairi300427 TATGT--TTCTCTGAAGA--TACATTTCGCCATACTGATCTGATCAGGCT E_telfairi300807 TAAA---TGTCTTGAAGA--TAATGTT-GTG------ATCTGACCAGGCC E_telfairi300808 CATGT--TTCTCTGGAGA--TAATTCTTGCCTTACTGATCTGATCAGGCT E_caballus300251 CGTTT--TTCTCTGGAGA--TAGTTCTTGCCTTAC-AATCTGATCAGGCT E_caballus300252 TAAA---C-CTCTTGAAG--AAAATCT-GTGT-----ATCTGATCAGGCC E_europaeus300621 TAAA---TCTCTTGAAGA--AACTTCT-GTGT-----ATCTGATCAGGCC E_europaeus300622 CAT----TTCTCTGGAGA--TAGTTTTTGCCTTACTGTTCTGATCAGGCT G_gorilla300248 TAAA---T-TCTTGAAGA--AAATTTTTGTGT-----GTCTGATCAGGCC G_gorilla300247 CATTT--TTCTCTGGAGA--CAGTTTTTGCCTTATGAATCTGATCAGGCT H_sapiens300592 TAAA---T-TCTTGAAGA--AAATTTTTGTGT-----GTCTGATCAGGCC H_sapiens300593 CATTT--TTCTCTGGACA--CAGTTTTTGCCTTATGAATCTGATCAGGCT L_africana300462 TGGA---TGTCTTGAAGA--AATTTTT-GTGT-----ATCTGACCAGGAC L_africana300463 CATGT--TTCTCTGGAGA--TACTGCTTGCCTTACTGATCTGATCAGGCT M_mulatta300617 CATTT--TTCTCTGGAGA--TAATTTTTGCCTTATGGATCTGATCAGGCT M_mulatta300618 TAAA---T-TTTTGAAGA--CAATTTT-GTGT-----ATCTGATCAGGCC M_murinus300459 TATA---T-TCTTGAAGA--AAATTCG-GTGT-----ATCTGATC-GGCC M_murinus300460 CATTT--TTCTGTGGAGA--TAGCTTTTGCCTTATTGATCTGATCAGGCT M_domestica300136 GATT---TCTTCTGGAGA--AAATATG-GTGT-----AACTGATCAGGCT M_domestica300137 AACTTTTTTCTCTGAAGACAAAAACTTACCTCTCTGAATCTGATCGGGCA M_musculus300813 CATTC--TCCTCTGGAGA--TGATTTTTGCCTTATTGATCTGATCAGGCT M_musculus300814 AGAA---TTC----ATGG--AGATTCT-GTGT-----ATCTGATCAGGCC M_lucifugus300655 CAAA---TCTCTTGAAGA--CAATTCT-GTGT-----ATCTGATCAGGCC O_anatinus302228 AATC---TTCCCTGGAGA--CACAATTAACCTCGCTGATCTGATCAGGCT O_anatinus302229 TTTG---CTATGAAGAGG--CTTGTATTTTTATTC--CTCTGATCAGACT O_anatinus303360 GATT---TCCTCTGGAGA--AAATCCT-GTTT-----ATCTGATCGGGCC O_anatinus303735 TTTG---CTATGAAGAGG--CTTGTATTTTTATTC--CTCTGATCAGACT O_anatinus302226 GATT---TCCTCTGGAGA--AAATCCT-GTTTTTT--ATCTGATCGGGCC O_anatinus302227 CTCCT--GAAGCTCTGGA--GATAGCACTTACCTC---TCTGATCAGGCA O_cuniculus300493 TAAA---T-TCTTGAAGA--AAATTCT-GTGT-----ATCTGATCAGGCT O_cuniculus300494 CATTT--TCCTCTGGAGA--TAGTTTCTGCCTCACTGGTCTGATCAGGCT O_latipes300071 CTGT---TAC----TGGA--GAAAGATTTGA-T----TTCTGATCTCAG- O_latipes300075 TGAA---TCAT--GAGCA--GAGAATTTTGA------CTCTGATCTGAGC O_latipes300076 TTCA---GCATCTGTGGG--GAGAACTTTTA-GAC--CTCTGATCTGCAG O_garnettii300500 TAAA---TTC-CTGAAGA--AAATTCT-GTGTA----AAAAAATAATAAT O_garnettii300707 TAAA---TTC-TTGAAGA--AAATTCT-GTGTA----TCTGATCGGGCCT P_troglodytes300690 TAAA---T-TCTTGAAGA--AAATTTTTGTGT-----GTCTGATCAGGCC P_troglodytes300691 CATTT--TTCTCTGGAGA--CAGTTTTTGCCTTATGAAACTGATCAGGCT P_pygmaeus300301 TTTTC--TTCTCTAGAGA--GAGTTTTTACCTTATGGATCTGATCAGGAA P_pygmaeus300753 CATTT--TTCTCTGGAGA--CAGTTTTTGCCTTATGGATCTGATCAGGCT P_pygmaeus300754 TAAA---T-TCTTGAAGA--AAATTTT-GTGT-----GTCTGATCAGGCC P_pygmaeus300193 TTTTC--TTCTCTAGAGA--GAGTTTTTACCTTATGGATCTGATCAGGAA R_norvegicus300598 TTAA---T-TCTTGAGGG--AAAGTGT-GTGT-----ATCTCATCAGGCC R_norvegicus300981 CATTC--TCCTCTGGAGA--TGATTTTTGCCTTGCTGATCTGATGAGGCT S_araneus300095 TTAC---TGCTTGTAT-----ATTTTTCTTTTCAT--GTCTGAACATGCC S_araneus300955 TGAA---TCTCATGAAGA--AACTTCT-GTGT-----ATCTGATCAGCCT S_araneus300956 CATTG--TTCTTTGGAGA--T-ATTCATGCCTTATTGATCTGATCAGGTT S_tridecemlineatus300007 TATTC--TACTGAAAAAA--AAATTTAAATTAGATATATTTAATAGGCCA S_tridecemlineatus300335 TAAA---T-TTTTGAAGG--AAATTCT-GTGT-----ATCTGATCAGGCC T_nigroviridis300060 CTAA---ACATCAATGAA--GAGGACTTTCA-CCA--CTCTGATCTCAGC T_nigroviridis300061 ATAA---AAACCAATGAA--GAGAACTTTCA-CAA--CTCTGATCTCAGC T_nigroviridis300169 GTCA---AAA---GTGAA--GAGTG-TTGAA-TGT--CTCTGATTTCAG- X_tropicalis300041 GATA---AAATATGAAG----AGAACAAAAAATGC--ATCTGATCA-GCT C_familiaris300344 T---- C_porcellus300869 T---- C_porcellus300870 G---- C_intestinalis300003 ATTGT C_intestinalis300004 ATTGT C_intestinalis300005 A---- C_savignyi300017 C---- D_rerio300137 GCAT- D_rerio300138 A---- D_rerio300139 GCAC- D_rerio300140 GCAC- D_novemcinctus300570 T---- E_telfairi300427 A---- E_telfairi300807 T---- E_telfairi300808 G---- E_caballus300251 G---- E_caballus300252 T---- E_europaeus300621 T---- E_europaeus300622 G---- G_gorilla300248 T---- G_gorilla300247 G---- H_sapiens300592 T---- H_sapiens300593 G---- L_africana300462 TT--- L_africana300463 G---- M_mulatta300617 G---- M_mulatta300618 T---- M_murinus300459 T---- M_murinus300460 A---- M_domestica300136 T---- M_domestica300137 C---- M_musculus300813 G---- M_musculus300814 T---- M_lucifugus300655 T---- O_anatinus302228 G---- O_anatinus302229 G---- O_anatinus303360 T---- O_anatinus303735 G---- O_anatinus302226 T---- O_anatinus302227 T---- O_cuniculus300493 T---- O_cuniculus300494 G---- O_latipes300071 ----- O_latipes300075 TGT-- O_latipes300076 A---- O_garnettii300500 T---- O_garnettii300707 ----- P_troglodytes300690 T---- P_troglodytes300691 G---- P_pygmaeus300301 A---- P_pygmaeus300753 G---- P_pygmaeus300754 T---- P_pygmaeus300193 A---- R_norvegicus300598 T---- R_norvegicus300981 G---- S_araneus300095 A---- S_araneus300955 C---- S_araneus300956 G---- S_tridecemlineatus300007 ----- S_tridecemlineatus300335 T---- T_nigroviridis300060 AT--- T_nigroviridis300061 A---- T_nigroviridis300169 ----- X_tropicalis300041 GC---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved