snOPY snoRNA Orthological Gene Database

Family: SNORD110

CLUSTAL W (1.83) multiple sequence alignment C_elegans300028 --GCAATGAT--GTCATACTC---AAATCTGTCAGTCCTCAGACCATCCC C_familiaris300453 TTGCAGTGAT--GACTTG-------AGTCTGTCAATCCCCTGAGTGCAAT C_porcellus300827 TTGCAGTGAT--GACTTGAG----AAATCTGTCAATCCCCTGAATGTAAT D_novemcinctus300579 TTGCGGTGAT--GACTTGCG----A-ATCTGTCAATCCCCTGAGTGCAGT E_telfairi300861 TTGCAGTGAT--GACTGT--------ATCTGTCAATCCCCTGAGTGCAGT E_caballus300259 TTGCAGTGAT--GACTTGA-------GTCTGTCAATCCCCTGAGTGCAGT E_europaeus300598 TTGCACTGAT--GACTTGA-------TTCTGTCAATCCCCTGAGTGCAAT E_europaeus300601 TTGCAATGAT--GACTTGA-------TTCTGTCAATCCCCTGAGTGCAAT G_gorilla300353 TTGCAGTGAT--GACTTGCGAATCAAATCTGTCAATCCCCTGAGTGCAAT H_sapiens300475 TTGCAGTGAT--GACTTGCGAATCAAATCTGTCAATCCCCTGAGTGCAAT L_africana300443 TTGCAGTGAT--GACTTGT-------GTCTGTCAATCCCCTGAGTGCAGT M_murinus300454 TTGCAGTGAT--GACTTTGG----T-ATCTGTCAATCCCCTGAGTGCAGT M_musculus300980 TTGCAATGAT--GACTTATAT-----ATCTGTCAATCCCCTGAGAG--AT M_lucifugus300834 TTGCAGTGAT--GACTTG-------AATCTGTCAATCCCCTGAGTGCAAT O_cuniculus300413 TTGCAATGAT--GACTCAAAA---TAATCTGTCAATCCCCTGAGTCCTGT O_garnettii300654 TTGCAGTGAT--GACTTTTC----TTATCTGTCAATCCCCTGAGTGCAGT P_troglodytes300720 TTGCAGTGAT--GACTTGCGAATCAAATCTGTCAATCCCCTGAGTGCAAT R_norvegicus300949 TTGCAATGAT--GACTTGAAA----AATCTGTCAATCCCCTGAGTG--AT S_araneus300381 TTGCAATGAT--GACTTGG-------ATCTGTCAATCCCGTGAGTGCACT S_tridecemlineatus300309 TTGCAGTGATCCGACTTGTG----AAATCTGTCAATCCCCTGAGTGTGAT T_belangeri300336 TTGCAGTGAT--GACTTGT-----TAATCTGTCAATCCCCTGAGTGCAGT ** **** * * ******* *** ** C_elegans300028 TGGTGATAACACGGTTTTCCGGAGTGCTGAGC C_familiaris300453 CACTGATGTCTCCATGTCTCTGAGCAA----- C_porcellus300827 CACTGATGTCTCCATGTCTCTGAGCAA----- D_novemcinctus300579 CGCTGATGTCTCCATGTCTCTGAGCAA----- E_telfairi300861 CACTGATGTCTCTATGTCTCTGAGCAA----- E_caballus300259 CACTGATGTCTCCATGTCTCTGAGCAA----- E_europaeus300598 CGCAGATGTCAGAGTGTATATGAGCAA----- E_europaeus300601 CGCTGATGTCAGAGTGTCTCTGAGCAA----- G_gorilla300353 CACTGATGTCTCCATGTCTCTGAGCAA----- H_sapiens300475 CACTGATGTCTCCATGTCTCTGAGCAA----- L_africana300443 CACTGATGTCTCCATGTCTCTGAGCAA----- M_murinus300454 CACTGATGTCTCTGTGTCTCTGAGCAA----- M_musculus300980 CACTGACGACTCCATGTGTCTGAGCAA----- M_lucifugus300834 CATTGATGTCTCTATGTCTCTGAGCAA----- O_cuniculus300413 CACTGATGTCTCCATGTCTCTGAGCAA----- O_garnettii300654 CACTGATGTCTCTGTGTCTCTGAGCAA----- P_troglodytes300720 CACTGATGTCTCCATGTCTCTGAGCAA----- R_norvegicus300949 CGATGATGACTCCATGTTTCTGAGCAA----- S_araneus300381 CATTGAAGTCAACCTGTCCCTGAGCAA----- S_tridecemlineatus300309 CATTGATGTCTCAATGTCTCTGAGCAA----- T_belangeri300336 CACTGATGTCTCCATGTCTCTGAGCAA----- ** * * * ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved