snOPY snoRNA Orthological Gene Database

Family: SNORD109

CLUSTAL W (1.83) multiple sequence alignment C_porcellus300975 GGATCGATGATGAGAAAACTTGTCTGAGGACGCTGAGGGACTAATTACAGATGGCAATCT C_porcellus300985 GGATCGATGATGAGAAAACTTGTCTGAGGACGCTGAGGGACTAATTACAGATGGCAATCT C_porcellus300997 GGATCGATGATGAGAAAACTTGTCTGAGGACGCTGAGGGACTAATTACAGATGGCAATCT H_sapiens300792 GGATCGATGATGAGAATAATTGTCTGAGGATGCTGAGGGACTCATTCCAGATGTCAATCT **************** * *********** *********** *** ****** ****** C_porcellus300975 GAGGTCC C_porcellus300985 GAGGTCC C_porcellus300997 GAGGTCC H_sapiens300792 GAGGTCC *******

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved