snOPY snoRNA Orthological Gene Database

Family: SNORD103

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300027 ---TGGCAATGATCGAATTATCATTGAGCCAATCCTTTTCTGAATTCTGTGAGGATGTAA C_elegans300047 GGTTGGCTGTGAC--GATTACTATT--CCCAACGCTTGGAATGAACCAAAGTGATTATTA **** *** **** *** **** *** * * * * * * * C_elegans300027 ATGA---TAGGTCTGAGCCA--- C_elegans300047 ACCAATCCTTTTCTGAGCCAATC * * *********

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved