snOPY snoRNA Orthological Gene Database

Family: SNORD102

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300369 AGCTTAATGATGATTG--TCTTTTTGATTGCTT-------GAAGCAATGTGAAAAACA-C D_novemcinctus300001 AGTTTGATGATGATTG--TCTTTTTGATTGCTTT------AAAGCAATGTGAAAAACA-C E_telfairi300320 AGCTTGATGATGATTG------TTTGATTGCTTT------GAAGCAACATGAAAAATC-C E_caballus300350 AGCTTAATGATGATTG--CCTTTTTGATTGCTT-------GAAGCAACGTGAAAAACA-C E_europaeus300410 AGCTTAATGATGAGTA--TCTTGTTGAT-GCTT-------AAAGCAATGTGAAAAAAGAC H_sapiens300597 AGCTTAATGATGACTG-TTTTTTTTGATTGCTT-------GAAGCAATGTGAAAAACA-C L_africana300437 AGCTTGATGATGATTG--TCTTTTTGATTGCTTT------GAAGCAATGTGAAAAACA-C M_mulatta300736 AGCTTAATGATGATTGGTTTTTTTTGATTGCTT-------GAAGCAATGTGAAAAACA-C M_murinus300424 AGCTTAATGATGATTA--TCTTTTTGATTGCTC-------GAAGCAAAGTGAAAAACA-C M_musculus300778 AACTTAATGATGATTG--TCTGTTTGATTGCTT-------GATGCAATGTGAAAACCA-C M_lucifugus300639 AGCTTAATGATGATTG--TCTTTTTGATTGCTC-------AAAGCAACGTGAAAAATG-C O_anatinus303877 TGCTCGATGATGATTG-TCTCGTGTGATTGTTCTTTTGCAAGAGCAGAATGAACA-TACC O_cuniculus300415 AGCTTAATGATGATTG--TCTTTTTGATTGCTT-------GAAGCAATATGAAAAACA-C P_troglodytes300737 AGCTTAATGATGACTGGTTTTTTTTGATTGCTT-------GAAGCAATGTGAAAAACA-C P_pygmaeus300712 AGCTTAATGATGACTGGTTTTTTTTGATTGCTT-------GAAGCAATGTGAAAAACA-C R_norvegicus301020 AACTTAATGATGATTG--TCTATTTGATTGCTT-------GATGCAATGTGAAAACCA-C S_araneus301025 AGTTTAATGATGATTA--TCTTTTTGATTGCTTTT-----GAAGCAATATGAAAAACA-C * ******* * **** * * *** **** * * C_familiaris300369 ATTTCACCGGCTCTGAAAGCT D_novemcinctus300001 ATTTCACCGGCTCTGAAAGCT E_telfairi300320 ATTTCACCGGCTCTGAGAGCT E_caballus300350 ATTTCACCGGCTCTGAAAGCT E_europaeus300410 ATTTCACCGGCTCTGAAAGCT H_sapiens300597 ATTTCACCGGCTCTGAAAGCT L_africana300437 ATTTCACCGGCTCTGAAAGCT M_mulatta300736 ATTTCACCGGCTCTGAAAGCT M_murinus300424 ATTTCACCGGCTCTGAAAGCT M_musculus300778 ATTTCACCGGCTCTGAGAGTT M_lucifugus300639 ATTTCACCGGCTCTGAAAGCT O_anatinus303877 ATTTCACCGGCTCTGAGAGCT O_cuniculus300415 ATTTCACCGGCTCTGAAAGCT P_troglodytes300737 ATTTCACCGGCTCTGAAAGCT P_pygmaeus300712 ATTTCACCGGCTCTGAAAGCT R_norvegicus301020 ATTTCACCGGCTCTGAGAGTT S_araneus301025 ATTTCACCGGCTCTGAAAGCT **************** ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved