snOPY snoRNA Orthological Gene Database

Family: SNORD100

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300480 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAACT---GCAGTG C_porcellus300885 ---GCTGTGCATGATGACAACT-GGCTCCCTCTACCGAAC---TGTCTTG D_rerio300164 ---TGTATCTGTGATGATAATTTGGCTCCCTCTACTGA-AG---TCTCTG D_novemcinctus300599 ---GCTGTACGTGATGACAACT-GGCTCCCTCTACTGAAC----CTGGTG D_melanogaster300204 CCTGTCATGCTGAATTTTAATGTGGCTCCCTTTCCTGATGT---ATGATT E_telfairi300678 ---GCTGTAAATGATGACAACT-GGCTCCCTCTACTGAGTC----TAGTG E_caballus300327 ---GCTGTGCATGATGACAACT-GGCTCCCTCTACTGAAT---TGCCTTG E_europaeus300002 ---TCTGTACATGATAACAACT-AGCTCCCTCTACCGAACT---GTCATG E_europaeus300334 ---ACTGTACATGATGACAACT-GGCTCCTTCTACTGAACT---GTCATG E_europaeus300541 ---TACGTACATGATGACAACT-GGCTCCCTCTACCAGACT---ATCATG E_europaeus300657 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAC---TGTCATG G_gorilla300865 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAC---TGCCATG H_sapiens300536 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAC---TGCCATG M_mulatta300568 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAC---TGCCATG M_murinus300517 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAACT---GCTGTG M_domestica300092 ---GCTGTACATGATGACAACTTGGCTCCCTCTACTGATA----ATAATG M_musculus300843 ---GCTGTACATGATGAAAACA-GTCTCCCTCTTCTGAATC---TCGCTG M_lucifugus300596 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAATT---GGTGTG O_anatinus303407 ---GCTGTACATGATGATAGCTTGGCTCCCTCTACTGAAA----ATGGTG O_anatinus302238 ---GCTGTACATGATGATAGCTTGGCTCCCTCTACTGAAA----ATGGTG O_cuniculus300522 ---GCTGTGAATGATGACAACT-GGCTCCCTCTACTGAGC---TGCCTTG O_latipes300080 ---TGTATCACTGATGATAATTTGGCTCCCTCTACTGA-CC---TCTGTG O_garnettii300710 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAT---TGTCATG P_troglodytes300493 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAC---TGCTATG P_pygmaeus300706 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAACCCATGCCATG R_norvegicus301068 ---GCTGCACATGATGACAACT-GGCTCCCTCTACTGAGTC---GCAGTG S_araneus300951 ---GCTGTGCATGATGACAACT-GGCTCCCTCTACTGAACC---ACTCTG S_tridecemlineatus300331 ---GCTGTACATGATGACAACT-GGCTCCCTCTACTGAAT---TGCCATG T_nigroviridis300093 ---CATGTCGCTGATGATATCTTGGCTCCCTCTACTGAGTT---TTAATG T_nigroviridis300094 ---GGCATCACTGATGATAATCTGGCTCCCTCTACTGA-TT---ATGGTG T_belangeri300203 ---TGGGTGCATAATGACAACT-GGCTCCTCCTACTGAGCT---GCTATG X_tropicalis300071 ---TTTACCTATGATGAGAATTTGGCTCCCTCTTCTGA-AA---CTAGTG X_tropicalis300093 ---GTATGCTATGATGATAACTTGGCTCCCTCTACTGA-AT---GCTATG X_tropicalis300094 ---TTTACCTATGATGAGAATTTGGCTCCCTCTTCTGA-AA---CTAGTG ** * **** * * * C_familiaris300480 AGGA-AACTG-CCAT--GTCACCC------TATCTGA--TTACAGC---- C_porcellus300885 AGGA-AAATG-CCAT--GTCACCC------TT-CTGA--TGACAGC---- D_rerio300164 AGGAAAACTG-CCATTCGTTACCCAATTTCTTACTGA-GATACT------ D_novemcinctus300599 AGGAAAACTG-CCAC--GTCACCA------TTTCTGA-CTTACAGC---- D_melanogaster300204 TGATAATTTATAATTAAAATAAACAAACAATGCAGGACATCATAAGTGTT E_telfairi300678 AGGA-AATTG-CCAT--GTCACCAA------TTCTGA--CTACAGC---- E_caballus300327 AGGA-AACTG-CCAT--GTCACCC------TATCTGA--CTACAGC---- E_europaeus300002 AGGTAAACG--CCATGTGTAAAAAAAAAA--AAAAAA------------- E_europaeus300334 AGGA-AAATGCCAAAAAAAAAAAAAAAAATCAGC---------------- E_europaeus300541 AGGAAAATT--CCATGAGAAAAAGAAAGAAAGAAAGAAAGAACGAA---- E_europaeus300657 AGGA-AAATG-CCAT--GTCACCC------AATCTGA--CTGCAGC---- G_gorilla300865 AGGA-AACTG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- H_sapiens300536 AGGA-AACTG-CCAT--GTCACCC------TT-CTGA--TTACAGC---- M_mulatta300568 AGGA-AACTG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- M_murinus300517 AGGAAAAT-G-CCAT--GTCACCC-------TTCTGA--CTACAGC---- M_domestica300092 AAGAGAACAG-CCAT--GTCACCCAACA--TATCTGAGCGTACAGC---- M_musculus300843 AGGA-AACTG-C-AC--GTCACCC-------TCCTGA---AACAGC---- M_lucifugus300596 AGGA-AACTG-CC-T--GTCACCC------TATCTGA--CTACAGT---- O_anatinus303407 AGGATAATAG-CCAT--GTCACCCAATAT-TATCTGAACGTACAGC---- O_anatinus302238 AGGATAATAG-CCAT--GTCACCCAATAG-TATCTGAACGTACAGC---- O_cuniculus300522 AGGA-AACTG-CCAT--GTCACCC------TA-CTGA--CTACAGC---- O_latipes300080 AAGAGAT-GG-CCATT-GTTACCCAATTTCTGTCTGA-GATGCA------ O_garnettii300710 AAGA-AACTG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- P_troglodytes300493 AGGA-AACTG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- P_pygmaeus300706 AGGA-AACTG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- R_norvegicus301068 AGGA-AACTG-CCAT--GTCACCC-------TTCTGA---CGCTGC---- S_araneus300951 AGGA-AACTG-CCAT--GTCACCCAG-----TCTGAC---AACAGC---- S_tridecemlineatus300331 AGGA-AAATG-CCAT--GTCACCC------TT-CTGA--CTACAGC---- T_nigroviridis300093 TGGAAGTCTG-CCATT-GTTACCCAATTTCTATCTGA-GATGTT------ T_nigroviridis300094 AGGAAAG-TG-CCACT-GTTACCCAATTT-TGTCTGA-GATGCA------ T_belangeri300203 AGGGAAAAAA-------ATTGCTAAA-----TTCAGGACATTTA------ X_tropicalis300071 AGGAAATTG--CCAATTGTTACCCAATAA-TCTCTGA-GGTGCA------ X_tropicalis300093 AGGAGAAAAGCCTAAATGTTACCCAATAC-TTCCTGA-GTTTAC------ X_tropicalis300094 AGGAAATTG--CCAATTGTTACCCAATAA-TCTCTGA-GGTGCA------ C_familiaris300480 --------------------- C_porcellus300885 --------------------- D_rerio300164 --------------------- D_novemcinctus300599 --------------------- D_melanogaster300204 TGCTACTCCGAATCTGAAAGT E_telfairi300678 --------------------- E_caballus300327 --------------------- E_europaeus300002 --------------------- E_europaeus300334 --------------------- E_europaeus300541 --------------------- E_europaeus300657 --------------------- G_gorilla300865 --------------------- H_sapiens300536 --------------------- M_mulatta300568 --------------------- M_murinus300517 --------------------- M_domestica300092 --------------------- M_musculus300843 --------------------- M_lucifugus300596 --------------------- O_anatinus303407 --------------------- O_anatinus302238 --------------------- O_cuniculus300522 --------------------- O_latipes300080 --------------------- O_garnettii300710 --------------------- P_troglodytes300493 --------------------- P_pygmaeus300706 --------------------- R_norvegicus301068 --------------------- S_araneus300951 --------------------- S_tridecemlineatus300331 --------------------- T_nigroviridis300093 --------------------- T_nigroviridis300094 --------------------- T_belangeri300203 --------------------- X_tropicalis300071 --------------------- X_tropicalis300093 --------------------- X_tropicalis300094 ---------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved