snOPY snoRNA Orthological Gene Database

Family: SNORD10

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300039 -GCCTGTGATGCTTTTCATGCGTGTCAGCTGAGATCC------CCTGATTAGAACCACCC D_rerio300226 GTTTTGTGATGATCCCCATGCGTGTCAACTGA-TCCCAGACTCCCTGCAGTGCTCAATGT H_sapiens300761 GCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTTCCCTGCCAGTGCAGCCC T_nigroviridis300167 GTATTGGGATGAAACCCATGCGTGTCAACTGAGTCTCTAAATCTCTTGTCGTGGTGTCGA ** **** *********** **** * * C_elegans300039 TTGAGGT--TGTATTAACTGAGGC------------------------------------ D_rerio300226 CTGATGAG-CGTTTTGCTCAACAGTGCATTTTGA--GCCTGTAGGACTCTGGGAACTTGA H_sapiens300761 TGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTGCCTGGCGGGAAGGTCCTGGGCAAAGGA T_nigroviridis300167 CCCAGCTGGCGTTTTGC---AAGCTTGACTCGACAGCGAAGCAAGGCCTTAGAGAAATGA * * C_elegans300039 ----------------------------- D_rerio300226 TCTTAACTTTTAAATCTGAAAAC------ H_sapiens300761 TCA-GTCTTTGTACTCTGAGAGCAGACTA T_nigroviridis300167 TCAGGACTGACT-TTCTGAATGC------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved