snOPY snoRNA Orthological Gene Database

Family: SNORD10

CLUSTAL W (1.83) multiple sequence alignment C_elegans300039 -GCCTGTGATGCTTTTCATGCGTGTCAGCTGAG------ATCCCCTGATTAGAACCACCC D_rerio300226 GTTTTGTGATGATCCCCATGCGTGTCAACTGATCC--CAGACTCCCTGCAGTGCTCAATG H_sapiens300761 GCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTTCCCTGCCAGTGCAGCCC M_lucifugus300897 GCTCTATGATGAACCCCATGCGTGTCATCTGAGCC--TGGCTTCCCTGTCT---CAGCCC T_nigroviridis300167 GTATTGGGATGAAACCCATGCGTGTCAACTGAGTCTCTAAATCTCTTGTCGTGGTGTCGA * **** *********** **** * C_elegans300039 T--TGAGGTTGTATTAACTGAGGC------------------------------------ D_rerio300226 TCTGATGAGCGTTTTGCTCAACAGTGCATTTTGAGCCTGTA---GGACTCTGGGAACTTG H_sapiens300761 TGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTG-CCTGGCG-GGAAGGTCCTGGGCAAAG M_lucifugus300897 AGGTAGTGTTCTACTTCCCAGGGCTATTGTCTGGCCTGGCAAGGGGGGTCCCTGGCAAAG T_nigroviridis300167 CCCAGCTGGCGTTTTGC---AAGCTTGACTCGA--CAGCGAAGCAAGGCCTTAGAGAAAT * * C_elegans300039 ------------------------------ D_rerio300226 ATCTTAACTTTTAAATCTGAAAAC------ H_sapiens300761 GATCAGTCTTTGTACTCTGAGAGCAGACTA M_lucifugus300897 GATCAAAATTTGAATTCTGAGAGC------ T_nigroviridis300167 GATCAGGACTGACTTTCTGAATGC------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved