snOPY snoRNA Orthological Gene Database

Family: SNORA9

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300048 ---------------------------------CTGCAAGCCCC--CAGC C_familiaris300206 ---------------------------------CGGCAAGCGTCC--AGC C_familiaris300398 ---------------------------------TTGCAAGCTTTC-CAGC C_porcellus300125 -----------------------------------TAGTAAGCCT-CCAG C_porcellus300811 ------------------------------------CAAGGTGCA-CAGA D_rerio300266 ---------------------------------TTGCAGGCTGTT-CAGC D_rerio300267 ---------------------------------CTGCAGGCTGTT-CAGC D_novemcinctus300002 ---------------------------------TTGCAAGCCTC--CAGA D_novemcinctus300035 ---------------------------------TTGCCAGCCTC--CAGT D_novemcinctus300073 ---------------------------------TTGCA-GCCTC--CAGC D_novemcinctus300112 ---------------------------------TTGCCAGCCTC--CAGT D_novemcinctus300117 ---------------------------------CTGCAAGCCTC--CAGC D_novemcinctus300118 ---------------------------------TTGCAAGCCTC--CAGA D_novemcinctus300126 ---------------------------------TTGCAAGCCTC--CAGT D_novemcinctus300137 ---------------------------------TTGCAAGGCTC--CAGC D_novemcinctus300138 ---------------------------------TTGCAAGCCTC--CAGT D_novemcinctus300144 ---------------------------------TTGCAAGCCTT--CAGC D_novemcinctus300165 ---------------------------------TTGCCAGCCTC--CAGT D_novemcinctus300182 ---------------------------------TTGCAAGGCTC--CAGC D_novemcinctus300194 ---------------------------------TTGCAAGCCTCT-CAGC D_novemcinctus300199 ---------------------------------ATGCCAGCCTC--CAGC D_novemcinctus300213 ---------------------------------CTGCAAGGCTC--CAGC D_novemcinctus300242 ---------------------------------TTGCAAGCCTC--CAGT D_novemcinctus300270 ---------------------------------TTGCAAGCCTC--CAGC D_novemcinctus300281 ---------------------------------TTGCCAGCCTC--CAGC D_novemcinctus300327 ---------------------------------TTGCCAGCCTC--CAGT D_novemcinctus300358 ---------------------------------TTGCCAGCCTC--CAGT D_novemcinctus300364 ---------------------------------TTGCAAGCCTC--TAGC D_novemcinctus300418 ---------------------------------CTGCAAGCCTC--CAGC D_novemcinctus300425 ---------------------------------TTGCAAGCCTC--CAGC D_novemcinctus300453 ---------------------------------TTGCAAGGCTC--CAGC D_novemcinctus300475 ---------------------------------TTGCAAGCCTT--CAGC D_novemcinctus300488 ---------------------------------TTGCAAGGCTC--CAGC D_novemcinctus300507 ---------------------------------TTGCAAGCCTC--CAGC D_novemcinctus300605 ---------------------------------TTGCAAGCCTTC-GAG- D_melanogaster300038 ----------------------------------------ATTCC--AAT E_telfairi300141 ---------------------------------TTGCAAGCCTC--CAGC E_telfairi300172 ---------------------------------TTGCTTGCCTC--CAGC E_telfairi300211 --------------------------------TTGAAAGTGAAAA-TATT E_telfairi300337 ---------------------------------TGGCAAGCCTC--CAGC E_telfairi300426 ---------------------------------TTGCAAGCCTC--CAAT E_telfairi300509 ---------------------------------CTGCAAGCCTC--CAGC E_telfairi300591 ---------------------------------CTGCAAGCCTC--CAGC E_telfairi300666 ---------------------------------TGGCAAGCCTA--TAGC E_telfairi300761 ---------------------------------CTGCAAGCCTC--CAGC E_telfairi300791 ---------------------------------TTGCAAGCCTC--CAGC E_telfairi300837 ---------------------------------CTGCAAGCCTC--CAGC E_telfairi300838 ---------------------------------CTGCAAGCCTC--CAGC E_caballus300102 ---------------------------------CTGCAAGCCTCC--AGC E_caballus300277 ---------------------------------TTGCAAGCCTTC-CAGC E_europaeus300256 ---------------------------------CTGCAAGCCTC--CAGC F_catus300213 ---------------------------------CGGCAAGCCTCC--AGC F_catus300247 ---------------------------------TTGCAAACCTTC-CAGC H_sapiens300418 ---------------------------------TAGCAAGCCTCC--AGC H_sapiens300696 ---------------------------------TAGCAAGCCTCC--AGC L_africana300060 ---------------------------------TTGCAAGCCTC--CAGC M_mulatta300040 ---------------------------------TAGCAAGCCTCC--AGC M_mulatta300268 ---------------------------------TAGCAAGTCTCC--AGC M_mulatta300278 --------------------------------------TCTCAAT--TAA M_mulatta300423 ---------------------------------TAGCAAGCCTCC--AGC M_mulatta300486 ---------------------------------TGGCAAACCTCC--AGC M_mulatta300629 ---------------------------------TAGCAAGCCTCC--AGC M_murinus300139 -------------------------------------AAACAAAC-AAAC M_murinus300295 ---------------------------------TAGCAAGCCTCC--AGC M_musculus300304 ---------------------------------TAGCAAGCC--C--AGC M_musculus300578 ---------------------------------TAGCAAGCCTCC--AGC M_musculus300619 ---------------------------------TAGCAAGCCACC--AGC O_anatinus303362 ---------------------------------GCGCGAGGCTTC-CAGC O_anatinus303363 ---------------------------------GCGCGAGGCTTC-CAGC O_anatinus303364 ---------------------------------TCGCAAGCCTAC-CAGC O_cuniculus300161 -------------------------------------AAGCTACC-TCAG O_cuniculus300198 ---------------------------------CCGCAAGCCTCC--AGC O_cuniculus300251 ---------------------------------CGGCACACCTGC--AGC O_cuniculus300261 ---------------------------------TAGCAAGCCTCC--AGC O_cuniculus300441 ---------------------------------CAGCAAGCCTCC--AGC O_garnettii300223 ----------------------------------------GGGCA-AGTG O_garnettii300409 ----------------------------------AATTTGAAAGG--AAC O_garnettii300426 ---------------------------------TAGCAAGCCTCC--AGC P_troglodytes300200 ---------------------------------TAGCAAGCCTCC--AGC P_troglodytes300218 ---------------------------------TGGCAAGCCTCC--AGC P_troglodytes300282 ---------------------------------TAGCAAGCCTCC--AGC P_troglodytes300654 ---------------------------------TAGCAAGCCTCC--AGC P_pygmaeus300126 ---------------------------------TGGCAAGCCTCC--AGC P_pygmaeus300266 ---------------------------------TAGCAAGCCTCC--AGC P_pygmaeus300307 ---------------------------------TAGCAAGCCTCC--AGC P_pygmaeus300654 ---------------------------------TAGCAAGCCTCC--AGC R_norvegicus300003 ---------------------------------TAGCAAGCCTCC--AGT R_norvegicus300190 ---------------------------------TAGCAAGCCTCC--AGC R_norvegicus300645 ---------------------------------TAGCAAGCCTCC--AGC R_norvegicus301010 ---------------------------------TAGCAAGCCTCC--AGC R_norvegicus301074 ---------------------------------TCCCAAGCCCC---ATC S_cerevisiae300043 AAGCTTAATGCCCTCTTTGTACGATGGTGTCACTCTAAAATTATTTACGT S_araneus300000 ---------------------------------AGGCAAGCCTCC--AGC S_araneus300001 -------------------------------------AAGCAAAT-AAAT S_araneus300016 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300026 ---------------------------------CTGCCAGCCTGC--AGC S_araneus300090 ---------------------------------CTGCAAACACGC--AGC S_araneus300110 ---------------------------------CTGCAAGCTTCC--AGC S_araneus300111 ---------------------------------CAGCAAGCCTTC--AGC S_araneus300123 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300160 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300268 ---------------------------------CTGCAAGCCTCC--AG- S_araneus300426 ---------------------------------GTGCAAGCCTCC--AGC S_araneus300446 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300467 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300471 ---------------------------------TAACAATTCCTT-TCTT S_araneus300492 ---------------------------------------GAAATC-CTAG S_araneus300499 ---------------------------------GTGCAAGCCTCC--AGC S_araneus300519 ---------------------------------CTTCAAGCCTCC--AGC S_araneus300536 ---------------------------------CTGCAAACTTCC--TGC S_araneus300621 ---------------------------------GTGCAAGCCTCT--AGT S_araneus300699 ---------------------------------ATTTTAGCCTTC--AGC S_araneus300707 ---------------------------------CTGCAAGCCTCT--GGC S_araneus300720 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300730 ---------------------------------TGGCAAGCCTCC--AGC S_araneus300770 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300789 ---------------------------------GTGCAAGCCTCC--AGC S_araneus300835 ---------------------------------TGGCAAGCCTCC--AGC S_araneus300837 -----------------------------------AAGTATCAGC-ATAA S_araneus300924 ---------------------------------TGGCAAGCCTCC--AGC S_araneus300966 ---------------------------------CTGCAAGCCTCC--AGC S_araneus300992 -----------------------------------------GGGC-GGGC S_araneus301011 ---------------------------------CTGCAAGCCTCC--AGC S_araneus301019 ---------------------------------CTGCAAGCCTCC--AGC S_araneus301067 ---------------------------------TGGCAAGCCTCC--AGC S_araneus301068 ---------------------------------TGGCAAGCCTCC--AGC S_araneus301073 ---------------------------------GTGCAAGCCTCC--AGC S_tridecemlineatus300079 ---------------------------------TAACAAGCCTCC--GGC S_tridecemlineatus300085 -----------------------------------------AAAC-AAAC S_tridecemlineatus300092 ---------------------------------TAGCAAGCCTCC--AGC S_tridecemlineatus300224 -----------------------------ATGACAGCAAGCTGCA---GC S_tridecemlineatus300225 --------------------------------GAGCCAGACTCTA---GT T_nigroviridis300114 ---------------------------------GTGCAGACGTTTCCAGC T_nigroviridis300115 ---------------------------------GTGCAGGCTTTTGCAGC T_belangeri300257 ---------------------------------TAGCAAGCCTCC--AGC C_familiaris300048 A---TGGTTGGGTCTG----GGGTGA-------CCCTGC-ACGTTCCTGC C_familiaris300206 G---TGCTGGGGTCTG----CGGTGA-------CCCTGT-GCATTCCTGC C_familiaris300398 A---TGCTTGGGTCTC----GGGTGA-------CTCTGT-GCGTTTCTGC C_porcellus300125 CG--TGCTTGGATCTGG---TGTGAA---------CCTGTGCATTCCTAA C_porcellus300811 G---TGGTGGGGTCTG----CAGTGG-------CCCTGT-GCAGTCCGAC D_rerio300266 G---AGGTTGAGTCTT-----TGTGA-------CTCTTG-CCTTTCCTGT D_rerio300267 G---AGGCTGAGTCTC----CTGTGA-------CTCTGT-CCTTTCCTTT D_novemcinctus300002 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300035 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300073 G---TGCTTGGGTCTG----CAGTGA-------CCCTGA-GCATTCCTAC D_novemcinctus300112 G---TGCTTGGGTCTA----CAGTGA-------CCCTTT-GCATTCCTAC D_novemcinctus300117 G---TGCCAGGGTCTG----GGGTGA-------CCCTGT-ACATTCCCAC D_novemcinctus300118 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300126 G---TACTTGG-TCTT----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300137 G---TGCTTGGATCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300138 G---TGCTTGCGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300144 A---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300165 G---TGCTTGGGTCTA----CAGTGA-------CCCTTT-GCATTCCTAC D_novemcinctus300182 G---TGCTTGGGTCTG----CAGTGAAA-----CCCTGT-GCATTCCTAC D_novemcinctus300194 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300199 G---TGCTTGGGTCTG----CAGTGAAA-----CCCTGT-GCATTGCTAC D_novemcinctus300213 A---TGCTTGGGTCTG----CAGTGAAA-----CCCTGT-GCATTCCTAC D_novemcinctus300242 G---TGCTTGGGTCTG----CAGTGA-------CCCTGA-GCATTCCTAC D_novemcinctus300270 A---TGTTTGGGTCTA----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300281 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300327 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300358 G---TGCTTGGGTCTG----CAGTGA-------CACTGT-GCATTCCTAC D_novemcinctus300364 A---TGGTTGGGTATG----CACTGA-------CCTTGT-GCATTCCTAA D_novemcinctus300418 G---TGCCAGGGTCTG----GGGTGA-------CCCTGT-ACATTCCCAC D_novemcinctus300425 A---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300453 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300475 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300488 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC D_novemcinctus300507 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCCTTCCTAC D_novemcinctus300605 A---TGCTTGAGTCTG----GGGTGA-------CTGGGT-GCATTCCTGC D_melanogaster300038 GC--TGATCCAAGCCAA---CAACGA--------AATGTTAAAGTTTGAG E_telfairi300141 G---TGCCTGGGTTTG----GAGTAA-------CCCTGT-GCATTCCTAC E_telfairi300172 C---TGCTTGAATCTG----GAGTGG-------TTCTGG-GCATTCCTAC E_telfairi300211 AT--CTCAAAGTGAAAA---TTG--A---------AAGCTGAGACCACC- E_telfairi300337 A---TGCCTGAGTCTG----AAGTGA-------CCCTGT-AT-TTCCTTC E_telfairi300426 G---TGCCTGGGTTTG----GAGTAA-------CCTTGT-GCATTCCTAC E_telfairi300509 G---TGTCTGGGTCTG----GAGTGA-------CCCTGT-ATGTTCCTAC E_telfairi300591 G---TGTCTGGGTCTG----GCGTGA-------CCTTGT-GCATTCCTAC E_telfairi300666 A---TGCCTGGGTCTG----GAGTGA-------CCCTGT-GC-TTCCTTC E_telfairi300761 G---TGTCTGGGTCTG----GAGTGA-------CCTTGT-GCATTCCTTC E_telfairi300791 A---TGCCTGGGTTTG----GAGTAA-------CCCTGT-GCATTCCTAC E_telfairi300837 G---TGTCTGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC E_telfairi300838 G---TGTCTGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC E_caballus300102 G---TGCTTGGGTCTG----GGGTGA-------CCCTGT-GCATTCCTAC E_caballus300277 A---TGCTGGGGTCTA----GGGTGA-------CTCAGT-GCATTCCTGC E_europaeus300256 G---TGCCTGGGCCTG----TGGTGA-------CCCAGT-GCATTCCTAT F_catus300213 G---TGCCTGGGTCTG----GGGTGG-------CCCCGT-GCATTCCTTT F_catus300247 A---TGCTGGGGTCTA----GGGTAA-------CTCAGT-GTATTCCTCC H_sapiens300418 G---TGCTTGGGTCTG----CGGTGA-------CCCTAT-GCATTCCTTC H_sapiens300696 G---TGCTTGGGTCTG----CAGTGA-------CCCCGT-GGATTCCTAC L_africana300060 A---TGCTTGGGTCTG----GAGTGG-------CCCTGT-GCATTCCTCC M_mulatta300040 G---TGCTTGGGTCTG----CAGTGA-------CCCTAT-GCATTCCTTC M_mulatta300268 A---TGCTTAGGTCTG----CAGTGA-------CCCTAT-GCATTCCTAC M_mulatta300278 AA--AAAGGTTTCTTAA---TTAAGA---------AAA------ACCTTA M_mulatta300423 A---TGCTTGGGTCTG----TGGTGA-------CCCTAT-GCATTCCTTC M_mulatta300486 G---TGCTTGGGTCTG----TGGTGA-------CC-TGT-GCATTCCTAC M_mulatta300629 G---TGCTTGGGTCTG----CAGTGA-------CCCCGT-GCATTCCTAC M_murinus300139 AA--AACAA--AAACCA---ACAA-A---------AGTATAGATTCTTAT M_murinus300295 G---TGCCTGGGTCTG----CGGTGA-------CCCTGT-GCATTCCTAC M_musculus300304 A---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC M_musculus300578 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC M_musculus300619 A---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATCCCTAA O_anatinus303362 A---TACCAGAGTCCCTCCTCTGTGA-------CCCTGA-GCATTCCTGA O_anatinus303363 A---TACCAGAGTCCCTCCTCTGTGA-------CCCTGA-GCATTCCTGA O_anatinus303364 A---TGTCTCGGCCTG----ACGTGG-------CCCTGG-GTATTCCTTT O_cuniculus300161 GA--GTTCTCCACCCTG---CTGTGA---------CCCCGTGCACCCTAC O_cuniculus300198 G---TGCCTGGGCCTG----CCGTGA-------CCCTGT-GCATTCCTGC O_cuniculus300251 A---TGCCTGGCT-------CTGCGA-------CCCTGT-GCGTTCCTAC O_cuniculus300261 A---CATGTGGGCTAG----CTGTGA-------CTCTGT-GCATTCCTAC O_cuniculus300441 A---TGCTTGGGTCTG----CTGTGA-------CCCTGT-GCATTCCTGC O_garnettii300223 AG--ACTGTCTCCA-AA---AATGTG---------TAGATTCCTAC---C O_garnettii300409 AA--TATTTGGGTCTG----TGGTGAGCCTGTGCCCTGT-GCATTCCTCG O_garnettii300426 A---CGCTTGGGTCTG----TGGTGA--------CCTGT-GTATTCCTAC P_troglodytes300200 G---TGCTTGGGTCTG----CGGTGA-------CCCTAT-GCATTCCTTC P_troglodytes300218 G---TGCGTGGGTCTG----TGGTGA-------TG-TGT-GCATTCCTAC P_troglodytes300282 A---TGCTTAGGTCTG----CAGTGA-------CCCTAT-GCATCCCTAC P_troglodytes300654 G---TGCTTGGGTCTG----CAGTGA-------CCCCGT-GGATTCCTAC P_pygmaeus300126 G---TGCGAGGGTCTG----TGGTGA-------TG-TGT-GCATTCCTAC P_pygmaeus300266 A---TGCTTAAGTCTG----CAGTGA-------CCCTAT-GCATCCCTAC P_pygmaeus300307 G---TGCTTGGGTCTG----CGGTGA-------CCCTAT-GCATTCCTTT P_pygmaeus300654 G---TGCTTGGGTCTG----CAGTGA-------TCCCGT-GCATTCCTAC R_norvegicus300003 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC R_norvegicus300190 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC R_norvegicus300645 G---TGCTTGGGTCTG----CAGTGA-------CCCTGT-GCATTCCTAC R_norvegicus301010 G---TGCTTGGGTCTG----CCGTGA-------CCCTGT-GCATTCCTAC R_norvegicus301074 A---TGCC-AGGTCTG----CAGTGA-------GCCTTT-GCCTTCCTAC S_cerevisiae300043 AATTTAATTGGATGTGA---TATCAAGCACTAGTTTTGT-TTGGAGGAGC S_araneus300000 A---TCCTGGGGTATG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300001 AA--ATAAGTGAAGTGA---AAAA-C---------AAGCCAGTATCCTAG S_araneus300016 A---TGCTGGG-TCTG----GAGTGA-------CACTAT-GCCTTCTTAC S_araneus300026 G---TGCTTGGGTATG----GAACGA-------CCCTGT-GTGTTCCTAT S_araneus300090 A---TGCATGGGTCTA----GAGTAA-------ACCCGA-GCATGCCTAT S_araneus300110 A---TACTTGGGTCTG----GGGTGA-------CCCTGT-AAATTCCTTC S_araneus300111 A---TGCTTGGATCTG----GGGTGA-------CTCTTT-GCATGTCTAC S_araneus300123 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300160 G---TGCTGGCGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300268 G---TGCCGGGCTCTG----GAGCGA-------CCCTGT-GCATTCC-AC S_araneus300426 G---TGCTTGGGATTG----GAGTGA-------CTCTG---CATTACTAC S_araneus300446 G---TGCTTGGGTCTGG---GGGTGA-------CCCTAT-GCATTCCTGT S_araneus300467 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300471 TT--ACCTTCTCCTTAG---AATTTA---------CAGATGCCCCCTTAC S_araneus300492 AG--ACATTAATTCT-----TTAACA---------AAATTT----TTTTT S_araneus300499 A---TGCTTGGGTCTT----GGGTGA-------GCCGGT-GCTTTC---- S_araneus300519 G---TGCTGGGGTCTG----GAGTGA-------CCCCGT-GGATTCTTAC S_araneus300536 G---TGCCTGGGTCTG----GGGTGA-------CCCTGT-ACATTCCTAA S_araneus300621 G---TGCTTAGGTCTG----GGGTGA-------TG--------------- S_araneus300699 A---TGCTTGGGTCTG----GAGTGA-------CCCTGT-GAATTCCTAC S_araneus300707 A---TCCTTGCATCT-----GAGTGA-------CCCTGT-GCATTCCTAT S_araneus300720 G---CACTTGGGTCTG----GGGGAA-------CCCTGT-GCATTTCTAC S_araneus300730 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300770 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300789 G---TATTTGGGTCTG----TGGTGA-------CCCTGT-GCATTCGTAC S_araneus300835 G---TGCTGGGGTCTG----TAGTGA-------CCCTGT-GCATTCCTAC S_araneus300837 AG--ACTGTTTTTCTCA---TTCAAG---------AGATTTAGTATCTAT S_araneus300924 G---TGCTGGGGTCTG----GAGTGG-------CCCTGT-GCATTCCTAT S_araneus300966 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus300992 GT--TAAACTGGCAGAG---CTGACA---------CAG-TGCGTTCCTAT S_araneus301011 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus301019 G---TGCTGGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_araneus301067 G---TGCTGGGGTCTG----GAGTGG-------CCCTGT-GCATTCCTAC S_araneus301068 G---TGCTGGGGTCTG----GAGTGG-------CCCTGT-GCATTCCTAC S_araneus301073 G---TGCTTGGGTCTG----GAGTGA-------CCCTGT-GCATTCCTAC S_tridecemlineatus300079 A---TGCTTGGGTCTG----CAGTGA-------CCCTGTCGCATTCCTAC S_tridecemlineatus300085 AA--CTCATTGTAAAAA---TGGGCA---------AAGATGCATTCCTAC S_tridecemlineatus300092 G---TGCTTGGGTCTG----CAGTGA-------CCCTATTGCATTCCTAC S_tridecemlineatus300224 G---TGCTGGG-TCTG----CAGTGA-------CCCTGC-TGCATCCTAC S_tridecemlineatus300225 G---TGCTTGAGTCTG----CAGTGA-------CCCTAT-GCATTCCTAC T_nigroviridis300114 G---AGGCCCAGCCTG----ATGTGG-------CTGCGT-CCT----TCT T_nigroviridis300115 G---AGGCCCAGCCTG----ATGTGG-------CTGCGT-CCTCCCCTCC T_belangeri300257 G---TGCTTGGGTCTG----TGGTGA-------CCCTTT-GCATTCCTAC C_familiaris300048 AGTGCTT-GAAAGAACA-T-TGTGAAAT-GGTTTGACGCC-TTGCTTTGC C_familiaris300206 ACCGCTT-GCCACAGCA-T-CCTGAGAC-GGTTTGAGGCC-TTGCCCTGC C_familiaris300398 AGTGCTT-GCTAGAATGTC--CTGAAAT-GGTTTGAGGCT-GTGCCCTAT C_porcellus300125 AGCGCTT-GCTAGAGCAGC-TTTGAAAT-GGTTTGAGGCC-TTGCCCTGC C_porcellus300811 AGTGCTT-GATAGAACACT-TTTGAAAT-GGCTTGA---------CCTGC D_rerio300266 AAAGTCT-GCTAGAGAGAT--TTGAGGT-GGTTTGAGGC--CTGCTGGG- D_rerio300267 -ATGTCT-GCTAGATAGAC--ATGGAGT-GGTTTGAGACC-CTGTTGTCT D_novemcinctus300002 AGTGCTT-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300035 AGTGCTT-GCGAGAACAGT-TTTGAAAT-GGTTTGACGCC-TTGTTCTGC D_novemcinctus300073 AGTGCTT-GCGAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300112 AGTGCTT-GCAAGAACAGT-TTTGAAAG-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300117 AGAGCTT-GCAAAAACAGT-GTTGAAAT-GGTTTGAGGCT-TTGCTCTGC D_novemcinctus300118 AGTGCTT-GCAAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300126 ACTGCTT-GCAAGAACAAT-TTTGAAAC-GGTTTGAGATC-TTGTTCTAT D_novemcinctus300137 AGTGCTT-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300138 AGTGCTT-GCGAGAAGAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300144 AGTGCCA-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300165 AGTGCTT-GCAAGAACAGT-TTTGAAAG-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300182 AGTGCTT-GCAAGAACAGT-TTTGAAAT-GGTTTGAGACC-TTGCTCTGC D_novemcinctus300194 AGTGCTT-GCAAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300199 AGTGCTT-GCAAGAACAGT-TTTGAAAT-GGTTTGAGACC-TTGCTCTGC D_novemcinctus300213 AGTGCTT-GCAAGAACAGT-TTTGAAAT-GGTTTGAGACC-TTGCTCTGC D_novemcinctus300242 AGTGCCA-GCGAGAACAGA-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300270 AGTGCCT-GCGAGAAAAGT-TTTGAAAT-GGTCTAAGGCC-T----CTGC D_novemcinctus300281 AGTGCCT-GCGAGAACACG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300327 AGTGCTT-GCGAGAACAGT-TTTGAAAT-GGTTTGACGCC-TTGTTCTGC D_novemcinctus300358 AGTGCTT-GCGAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGTTCTGC D_novemcinctus300364 AGTGCTT-GAAAGAACAGT-TTTGAAAT-GGTTTAAGGCC-TTGCTCTGC D_novemcinctus300418 AGAGCTT-GCAAAAACAGT-GTTGAAAT-GGTTTGAGGCT-TTGCTCTGC D_novemcinctus300425 AGTGCTT-GCAAGAACAGG-TTTGAAAT-GGTTTCAGGCC-TTGCTCTGC D_novemcinctus300453 AGTGCCT-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300475 AGTGCCA-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300488 AGTGCCT-GCGAGAACAGG-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC D_novemcinctus300507 AGTGCTT-GTGAGAACAGG-TTTGAAAT-GGTTT-AGGCC-TTGCTCTGC D_novemcinctus300605 ATTGCTT-GCCAGAGTGTT--CTGAAAT-GGTTTGAGGCC-TTGCCCTGT D_melanogaster300038 AATAATT----GCGGCCATGTGCGGATC--GCTTGGAGTGTGTATGCCAA E_telfairi300141 AGTGCTT-GCAAGAGCAGC-TTTGAAAG-GGTTTGAGGCC-TTGCTCTAC E_telfairi300172 AGTGCTTTGCAAGATCAGC-TTTGAAAT-GGTCTGAGGCC-TTACTTGAT E_telfairi300211 --TGCTT-GCAAGAGCAGC-TTTGAAAT-GGTTTGAGGCC-TTGCTCTAC E_telfairi300337 AGTGCTT-GCAAGAAAAGT-GTTGAAAT-AGTTTGAGGAC-TTGCTCTGG E_telfairi300426 AGTGCTT-GCAAGAGCAGC-TTTGAAAG-GGTTTGAGGCC-TTGCTCTAC E_telfairi300509 AGTGCTT-GCAAGAACAGT-TT-GAAAC-GGTTTGAGGCC-TTGCTCTGC E_telfairi300591 AGTGCTT-GCAAGAACAGT-TCTGAAAC-CGTTTGAGGAC-TTGCTCTGC E_telfairi300666 AGTGCTT-GCAAGAACAGT-GTTGAAAT-AGTTGGAGGCC-TTGCTATGG E_telfairi300761 AATGCTT-GCAAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTCCTCTGC E_telfairi300791 AGTGCTT-GCAAGAGCAGC-TCTGAAAG-GGTTTGAGGCC-TTGCTCTAC E_telfairi300837 AGTGCTT-GCAAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTCCTCTGC E_telfairi300838 AGTGCTT-GCAAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTTCTCTGC E_caballus300102 AGTGCTT-GCGAGAACA-T-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC E_caballus300277 AGTGCTT-GCTAAAGTGTT--CTGAAAC-GGTTTGAGGCC-TTGCCCTGA E_europaeus300256 AGTGCTT-GCTAGAACAAT--TTGGAAC-GGTTTGAGGCC-TTGCTCTGC F_catus300213 AGTGCTT-GCAAGAACA-T-TGGGAAAC-GGTTTGAGGCC-TTGCCCTGC F_catus300247 AGTGCTT-GCTAGAACGTT--CTGAAAT-GTTTTGAGACT-TTGCCCTGT H_sapiens300418 AGTGCTT-GCTAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC H_sapiens300696 AGGGCTT-GCCAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCCGTGC L_africana300060 AGTGCTTGCCAAAAACAGT-TTTGAAAC-GGTTTGAGGTC-TCGCTCTAC M_mulatta300040 AGTGCTT-GCTAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCTCTGC M_mulatta300268 AGTGCTT-GCCAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCCCTGC M_mulatta300278 AGTGCTT-GCTAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC M_mulatta300423 AGTGCTT-GCTAGAACAGT-TTTGAAAC-GGTTTGAGACC-TTGCCCT-- M_mulatta300486 ACTGCTC-GACAGAACAGT-ATTGAAAT-AGTT-GAGGGT-TTGTCCTGC M_mulatta300629 AGTGCTT-GCCAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC M_murinus300139 ACTGCTT-GCCAGAACAGT-TTTGAAAT-GGTCTGAGGCC-TTGTCCTGT M_murinus300295 AGCGCTT-GCCAGAACAGC-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC M_musculus300304 AGTGCTT-GCCAGAACAAT-TTTGAAGT-GGTTTGAGGCC-TTGCCCTGC M_musculus300578 AGTGCTT-GCCAGAACAAT-TTTGAAGT-GGTTTGAGGCC-TTGCCCTGC M_musculus300619 AGTGCTT-GCCAGAACAAT-TTTGAAGTTGGTTTGAGGCC-TTGCCCTGG O_anatinus303362 AGCGCTT-GCCACAGTAGC-CTTGAGAT-GGTTTGAGGCC-TTGCTCTGC O_anatinus303363 AGCGCTT-GCCACAGTAGC-CTTGAGAT-GGTTTGAGGCC-TTGCTCTGC O_anatinus303364 GGTGCTT-GCCAGAGCAGC-CTTGGGGT-GGTTTGAGGCT-TCTCCCTGC O_cuniculus300161 AGTGCTG-GCCAGGACAGT--TTTGAAT-GATTTGAAGCC-TTGCCCTGC O_cuniculus300198 GGTGCTT-GCCAGAGCAGT-GTCGAAAC-GGTTTGAGGCC-TTGCCCTGC O_cuniculus300251 AGTGCTT-GCCACAACAGT-CTGCAGAG-GATCTGAGGAC-CTGGACTGC O_cuniculus300261 AGTGTGT-GCTGGAACATT-CTCCAAAC-GGTTTGAGGCA-TTGCCCTGC O_cuniculus300441 AGTGCTT-GCCAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC O_garnettii300223 AGGGCTT-GCCAAAACAGT-TTTGAAAT-GCTTTGAGGTC-TTGCCCTGC O_garnettii300409 AGTTCCA-GCCAGAACAGC-TGTGACAC-TGTTTGAGGCC-TTGTCTTGC O_garnettii300426 AGCGCTG-GCTAGAACAGC-TCTGAAGC-AGTTTGAGGCC-TTGCCCTGC P_troglodytes300200 AGTGCTT-GCTAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC P_troglodytes300218 ACTGCTT-GCCAGAACAGT-ATTGAAAT-AGTT-GAGCGT-TTGTCCTGC P_troglodytes300282 AGTGCTT-GCCAGAACAGT-TCTGAAAC-GGTTTGAGGCC-TTGCCCTGC P_troglodytes300654 AGGGCTT-GCCAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCCCTGC P_pygmaeus300126 ACTGCTT-GCCAGAACAGT-ATTGAAAT-AGTT-GAGGGT-TTGTCCTGC P_pygmaeus300266 AGTGCTT-GCCAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC P_pygmaeus300307 AGTGCTT-GCTAGAACAGT-TTTGAAAC-GGTTTGAGGCC-TTGCCCTGC P_pygmaeus300654 AGTGCTT-GCCAGAACAGT-TTTGAAAT-GGTTTGAGGCC-TTGCCCTGC R_norvegicus300003 AGTGCTT-GCCAGAACAAT-TTTGAAGT-GGTTTGAGGCC-TTGCCCTGC R_norvegicus300190 AGGGCTT-GCCAGAACAAT-TTTGAAGT-GGTTTGAGGCC-TTGCCCTGC R_norvegicus300645 AGTGCTT-GCCAGAACAAT-TTTAAAGT-GGTTTGAGGCC-TTGCCCTGC R_norvegicus301010 AGTGCTT-GCCAAAACAAT-TGTGAAGT-GGTTTGAGGCC-TTGCCCTGC R_norvegicus301074 AGAGCTT-GCCAGAACCTC-TGAGGCAT-GGTTTGAGCCC--CACCCCTT S_cerevisiae300043 AGAGATT-GAAAGCCTAGC-TTTTACACCGGTTTGAGTCGGTTCCTTCGT S_araneus300000 AGTGCTT-GCAAGAACA-T-TATAAAAT-GGTTTGAGGCC-TTGCCCTGC S_araneus300001 AGTGCTT-GCAAGAACA-T-TATGAAAC-GACTTGAGTCC-TTGGCCTGC S_araneus300016 ACTGCTT-GCAAGAACA-T-TATGAAAC-GGTTTGAGACT-TTGCCCTGC S_araneus300026 AGTGCCT-GTGAGAACA-G-TATGAAAT-GACCTGCGGCC-TTGCCCTCC S_araneus300090 GATGCTT-CTGAGGAAA-T-GATGAAAT-GGTTCGAGGCC-TTGCTCTGC S_araneus300110 AGTGCTT-GCAAGAATG-T-GATGAAAC-TATTTGAGGTC-TTAGCTTGG S_araneus300111 AGTGCTT-ATAAGAACA-T-CATGACAT-TGTCTGAGGCC-TTGTCTTGC S_araneus300123 AGTGCTT-GCAAGAACA-T-TATGGAAT-GGTTTGAGGCC-TTGCCCTGC S_araneus300160 AGTGCTT-GCAAGAACA-T-TATGAAAT-AGTTTGAGGCC-TTGCCCGGC S_araneus300268 GGTGCTT-GCAAGGACA-T-TATGAAAC-AGTTTGAGGCC-TTGCCCTGC S_araneus300426 AGTGCTT-ACAAGAATA-A-GATAAAAT-GGTTTGAGGCC-TTGCACTGC S_araneus300446 AGAATTT-GTGAGAATA-G-TGTGAAAC-AGTTTGAGGC--TTGTCCTGC S_araneus300467 AGTGCTT-GCAAGAACA-T-TATGGAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus300471 AGTGCTT-GCAAGAACA-T-TATGAAAT-GGTTTGAGGCC-TTGCCCTGC S_araneus300492 AGTGCTT-GGAAGAACTAAAGATGAAAT-GGTTTGAGGCC-TTGCACTGT S_araneus300499 ----------GAGAACA-A-GATGAAAC-CATCTGAGGCC-TTACCCTCC S_araneus300519 AGTGCTT-GCAAGAACA-T-TATGAAAT-TGTTTGCCGCT-TTGCCCTGC S_araneus300536 AGTGCTT-GCGAGAACA-T-TATGAAAC-AGCTTGAGACC-TTGCCTTGC S_araneus300621 AGTGCTT-GTGAGAACA-A-GATAAAAT-GGTTTGAAGCC-TTGTCTTGC S_araneus300699 AGTGCTT-GCAAGAAAA-A-GATGAAAA-GATTTGAGGGC-TTACTCTGC S_araneus300707 GGAGCTT-GTGATAAAA-T-CATGAAAC-AGTTTGAGGTT-TTTCTCTGC S_araneus300720 AGTGCTT-GAGAGAACA-T-TATGAAAC-AGTTTGAGGCC-TTGCACTAC S_araneus300730 AGTGCTT-GCAAGAACA-T-TATGAAAT-GGTTTGAAGCC-TTGCCCTGC S_araneus300770 AGTGCTT-GCAAGAACA-T-TATGGAAT-GGTTTGAGGCC-TTGCCCTGC S_araneus300789 AGAACTT-GTGAGAACA-A-GATAAAAT-GGTTTGAGGTC-TTGCTCAGC S_araneus300835 AGAGCTT-GCAAGAACA-T-TCTGAAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus300837 AGTTCTT-ACAAGAACATTATGAGAAAC-TGTTTGAGGCC-TTGCCCTGC S_araneus300924 AGCGCTT-GCAAGAACA-T-TATGAAAT-GGTTTGAGGCC-TTGCCCTGC S_araneus300966 AGTGCTT-GCAAGAACA-T-TATGAAAC-GGTTTGAGGCT-TTGCCCTGC S_araneus300992 AACGCTC-GCATTAACATT--ATGAAAA-GATTTGAGGCC-TTGCCCTGC S_araneus301011 AGTGCTT-GCAAGAACA-T-TATGGAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus301019 AGTGCTT-GCAAGAACA-T-TATGGAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus301067 AGAGCTT-GCAAGAACA-T-TCTGAAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus301068 AGAGCTT-GCAAGAACA-T-TCTGAAAC-GGTTTGAGGCC-TTGCCCTGC S_araneus301073 AGTGCTTTGCAAGAATA-A-GATGAAAT-GGTTTGAGGCC-TTGCCCTGC S_tridecemlineatus300079 AGTGCTT-GCCTGTACAGT-TTTGAAAT-GGATTGAGGCCTTGCCCTACC S_tridecemlineatus300085 AGTGCTT-GCCAGAACCAT-TTTAAAAT-GGTTTGAGGCC-TTGCCCTGT S_tridecemlineatus300092 AGTGCTT-GCCAGAATACT-T--GAAAT-GGTTTGAGGCC-TTGCCCTGC S_tridecemlineatus300224 GCTGCTG-GCCAGGACACT-TT-GAAAT-GGTTTGAGGCCCTTGCCCTGC S_tridecemlineatus300225 AGTGCTT-GCCAGAACAGG-GTTGGAAT-GGGTTTAGGTC-TTGCCATGC T_nigroviridis300114 GACGTCT-GCCAGAGTCAA--GCGGGGC-TGTTTGAGGCT-CTGCTGTG- T_nigroviridis300115 CAGCTCT-GCCAGAGTCAA--GCGGGGC-CGTTTGAGGCT-CTGCTGTG- T_belangeri300257 AGTGCTT-GCCAAAGCAGT-TTTGAAAT-GGTTTGAGGCC-TTGCCCTGC C_familiaris300048 TCC-ATCCA--GAGCAAGATGAT--AGAAATTTC-A-ACAGTT-- C_familiaris300206 TC-CATC--CAGAGCGAGGTTAT--AGAAATTTC-AGACAGGC-- C_familiaris300398 CT-CTTCCTCAGAACATGGTCCT--AGACATTTC-AGACAATT-- C_porcellus300125 TC-TATC--CAGAGCAAGGTAAT--AGAAATTTC-AGACAGTT-- C_porcellus300811 TC-TATC--CAGAGCACAGTTAT--AGAAATTTT-AGGCAATT-- D_rerio300266 AT---TCCCTTCTCAGTTTGGTTATGTAATCTTC-AAACATTT-- D_rerio300267 AC---TAAATACAGCGTGGTTATAGAAACTCCAG-ATAAAC---- D_novemcinctus300002 TC-CATCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTT-- D_novemcinctus300035 TC-CATCTACAGAGAAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300073 TC-CATCTACAGAGAAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300112 TA-TATCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300117 TTC-ATCTACGGAGCAAGGTTAT--AGAAATTTC-AGACAGTT-- D_novemcinctus300118 TCC-GTCTACGGGGCAAGGTTAT--AGAAATTTC-AGACAGTT-- D_novemcinctus300126 TCC-ATCTATGGAGCAAG-TTAC--AGAAATTTC-AGACAGTT-- D_novemcinctus300137 TC-CGTCTACAGAGCAAGGTAAT--AGACATTTC-AGACAGTT-- D_novemcinctus300138 TC-CATCTACAGAGCAAGGTAAT--AGAAATTC--AGACCGTT-- D_novemcinctus300144 CC-AATCCACAGACCAAGGTAAT--AGACATTTC-AGACCATT-- D_novemcinctus300165 TA-TATCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300182 TC-TGTCTACAGAGCAAGATAAT--AGAAATTT--AGACAATT-- D_novemcinctus300194 TC-CGTCTACAGAGCAAGGTAAT--AGACATTTC-AGACAGTT-- D_novemcinctus300199 TC-TGTCTACAGAGCAAGATAAT--AGAAATTTC-AGACAATT-- D_novemcinctus300213 TC-TGTCTACAGAGCAAGATAAT--AGAAATTTC-AGACAATT-- D_novemcinctus300242 TCACGTCTACAGAGAAAGGTAAT--AGAAATTC--AGACACTT-- D_novemcinctus300270 TC-GGTCTACAGAGCAAGGTAAT--AGAAATATC-AGACCATT-- D_novemcinctus300281 CC-TGTCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300327 TC-CATCTACAGAGAAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300358 TC-CGTCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTG-- D_novemcinctus300364 TCC-ACCTATGGAGCAATTT-AT--AGGAATTTC-AGACAGTT-- D_novemcinctus300418 TTC-ATCTACGGAGCAAGGTTAT--AGAAATTTC-AGACAGTT-- D_novemcinctus300425 TC-CATCTACAGACCAAGGTAAT--AGACATTT--AGACCGTT-- D_novemcinctus300453 TC-CGTCTACAGAGCAAGGTAAT--AGACATTTC-AGACAGTT-- D_novemcinctus300475 CC-AATCCACAGAGCAAGGTAAT--AGACATTTC-AGACCATT-- D_novemcinctus300488 TC-CGTCTACAGAGCAAGGTAAT--AGACATTTC-AGACAGTT-- D_novemcinctus300507 TC-CATCTACAGAGCAAGGTAAT--AGAAATTC--AGACAGTT-- D_novemcinctus300605 CT-CTTCCTCAGAACATAGCCAT--AGGCATTTC-ACAGTTTT-- D_melanogaster300038 CGCTAGTGGAGGCTTGGAATCGGAATGCGGTCTG-AGTCA----- E_telfairi300141 AAT-ATCTACAGAGCAAGGTTAT--AGAAATTTC-AGACATTC-- E_telfairi300172 ACT-GTCTATAGAACAAGGTTAT--AGAAATTTC-ACACAGTT-- E_telfairi300211 AA-TATCTACAGAGCAAGGTTAT--AGAAATTTC-AGACATTC-- E_telfairi300337 ACCCATCTCCAGAGTGAGGTTAT--GGACATTTC-TTACAGAG-- E_telfairi300426 AAT-ATCTACAGAGCAAGGTTAG--AGAAATTTC-AGACATTC-- E_telfairi300509 ACC-ATCTCCAGAGCGAGGGTAT--AGAAATTTC-AGACAAAC-- E_telfairi300591 ACC-ATTTCCAGAGCGAGGTAAT--AGAAATTTC-AGACAGAG-- E_telfairi300666 GCC-ATCTCCAGAGCGAGGTTAT--GGACATTTC-AGACAGAG-- E_telfairi300761 ACC-ATCTCCAGAGCAAGGTTAT--AGAAATTTC-AGACAAAC-- E_telfairi300791 AAT-GTCTGCAGAGCGAGGTTAT--AGAAATTTC-AGACATTC-- E_telfairi300837 ACC-ATCTCCAGAGCAAGGTTAT--AGAAATTTC-AGACAAAC-- E_telfairi300838 ACC-ATCTCCAGAGCAAGGTTAT--AGAAATTTC-AGACAAAC-- E_caballus300102 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATC-- E_caballus300277 CC-CTTCCTCAGAGCATGGTCAT--GGACATTTC-AGACAGTT-- E_europaeus300256 TCC-ACCT--GGAACAAGGTTAT--AGAAATTTC-AGACAGTC-- F_catus300213 TC-CATC--CAGAGCAAGGTTAT--AGACATTTC-GAACAGAT-- F_catus300247 CC-CTTCCGCAGAGCGTGGTCAT--AGACATTTC-AGACAGTT-- H_sapiens300418 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- H_sapiens300696 TC-CATG--TAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- L_africana300060 ATC-ATCTACAGAGCAAGGATAT--AGAAATTTC-AGACAGTT-- M_mulatta300040 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- M_mulatta300268 TC-CATC--CAGAGCAAGGGTAT--AGAAATTTC-AGACAATT-- M_mulatta300278 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- M_mulatta300423 TC-TATC--CAGAGCAAGGTTAT--AAAAATTTC-AGACAATG-- M_mulatta300486 TC-CATC--CAGAGTAAGGTTAT--AGAAATTTC-AGACAATT-- M_mulatta300629 AC-CATG--TAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- M_murinus300139 TC-CATC--CAGAACAAGGTCAT--AGAAATTTT-AGAAAATT-- M_murinus300295 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT-- M_musculus300304 TC-TCTC--CAGAGCAAGGTTATCTAGAAATTTC-AGACAATA-- M_musculus300578 CC-TCTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATA-- M_musculus300619 TC-TTTC--CAGGGCAAGGTTAT--AGAAATTTC-AGACAATA-- O_anatinus303362 TC-TACCTTCGGAGCAAGGTTAT--AGGAATTTC-AGGCACTA-- O_anatinus303363 GC-TACCTTCGGAGCAAGGTTAT--AGGAATTTC-AGGCACTA-- O_anatinus303364 CCCCTTC--CAGGGAGAGGTTAT--AGAAATCTC-AGACAATC-- O_cuniculus300161 TC-AATC--CATAGCAAGGTTGT--AGACATTTC-AGACAGTT-- O_cuniculus300198 CC-CATC--CGGAGCAAGGTTAT--AGAACTTTC-AGACAGCT-- O_cuniculus300251 TC-CATC--CAGAGCAAGGATAC--AGACCTTCT--GTACCATTA O_cuniculus300261 TC-CATC--CAGAGCAAGGTTAT--TGAACTTTT-CAGAACATG- O_cuniculus300441 TC-CATC--CAGTGTAAGGTTAT--AGAACTTTC-GGACAATT-- O_garnettii300223 TC-TATC--TAGAGCAAAGTTAT--AGAAATTTT-GGAAAATA-- O_garnettii300409 CC-TATC--CAGAGCAAGATTAT--AGAAATTTT-AGACAGTT-- O_garnettii300426 CC-TACC--CAGAGCAAGGTTAT--AGAAATTTC-TGACAATC-- P_troglodytes300200 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- P_troglodytes300218 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT-- P_troglodytes300282 TC-CATC--CAGAGCAAGGGTAT--AGAAATTTC-AGACAATT-- P_troglodytes300654 TC-CATG--TAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- P_pygmaeus300126 TC-TATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT-- P_pygmaeus300266 TC-CATC--CAGAGCAAGGGTAT--AGAAATTTC-AGACAATT-- P_pygmaeus300307 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- P_pygmaeus300654 TC-CATG--TAGAGCAAGGTTAT--AGAAATTTC-AGACAATG-- R_norvegicus300003 TC-TCTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATA-- R_norvegicus300190 TC-TCTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATA-- R_norvegicus300645 TC-TCTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATA-- R_norvegicus301010 TC-TCTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAGTA-- R_norvegicus301074 CTTCATC--CAAGGCAAGGCTAT--AGAAAAGTC-AGACCATT-- S_cerevisiae300043 TT---TCT-TAGTTGGAATTGATATAGAAGTGTGTGGACAATC-- S_araneus300000 TC-CATC--AGGAACAAGGTTAT--AGAAATTTC-AGATATGA-- S_araneus300001 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT-- S_araneus300016 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT-- S_araneus300026 TC-CATC--CAGAACAAGCTTAT--AGAAATTTC-AGACAATT-- S_araneus300090 TC-CATT--GAGAGCAAGGTTAT--AGAAATTTC-AGACTATT-- S_araneus300110 TT-CATC--CAGAGAAAGGTTAT--AGAAATTTC-AGGCAATA-- S_araneus300111 TT-CATC--CA--------------AGAAATTTT-AGACAATT-- S_araneus300123 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus300160 TG-CATC--CAGAGCAAGGCTAT--AGAAATTTC-AGACAAAT-- S_araneus300268 TC-CATT--CAGAGCCAAGTTCT--AGGAATTTC-AAAAATAA-- S_araneus300426 TC-CATC--CAGAGCAAGGTTAT--AGAAATTCC-AGGCAATT-- S_araneus300446 TC-CATC--CAGAACAAGGTTAT--AAAAATTTC-AGACAATT-- S_araneus300467 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus300471 TC-CATC--CAGAGCAAGGTTCT--AGAAATTTC-AGACATGA-- S_araneus300492 TC-CATC--CAGAGCAAAGTTAC--AGAAATTTC-AGACAACT-- S_araneus300499 TC-CATT--CAGAGCCAGGTTAT--GGAAATTTC-AGACAATT-- S_araneus300519 TC-CATT--CAGAACAAGGCTAT--AGAAATTTC-AGACTAAT-- S_araneus300536 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTT-AGATAATT-- S_araneus300621 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACCATT-- S_araneus300699 TC-TATA--CAGAGCAAGGTTAC--AGAAATTTT-AGACTACT-- S_araneus300707 TC-CATC--CAAAGCAAGGCTAT--AGAAATTCC-AGACAATT-- S_araneus300720 CC-AATC--CAGCTCGAGGTTAC--AGACATTTT-AGACAACT-- S_araneus300730 TC-CATT--CAGAGCAAGGTTAT--AGAAATTTC-AGACAAAT-- S_araneus300770 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus300789 TC-CAGA--GAGAGCAAAGTTAT--AAAAATTTC-AGACAATT-- S_araneus300835 TC-CATT--CAGAGCAAGGTTAT--AGAAATTTC-AGACAAAT-- S_araneus300837 TC-CATC--CAAAGCAAGGTCAT--AGAAACTTC-TCACAACT-- S_araneus300924 TC-CGTT--CAGAGCAAGGTTAT--AGAAATTTC-AGACAAAT-- S_araneus300966 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus300992 TT-TATC--TAGAACAAGGTTGA--AGAAAATTC-AGACACTT-- S_araneus301011 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus301019 TC-CATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACATGA-- S_araneus301067 TC-CATT--CAGAGCAAGGTTAT--AGAAATTTC-AGACAAAT-- S_araneus301068 TC-CATT--CAGAGCAAGGTTAT--AGAAATTTC-AGACAAAT-- S_araneus301073 TC-CATC--CAGAGCAAGGTTAT--AGAAATTCC-AGACAATT-- S_tridecemlineatus300079 CC-TATC--CAGAGCAAGGTTAT--AGGAACTTC-AGACAATC-- S_tridecemlineatus300085 CC-TATC--CAGAGCAAGGTAAT--AGAAATTTC-AGAGAATT-- S_tridecemlineatus300092 CC-TATC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAACT-- S_tridecemlineatus300224 CC-TCTC--CAGAGCAAGGTGAT--AGAAATTCCCAGACAATT-- S_tridecemlineatus300225 TC-TATT--CAGAGCAAGATCAT--AGGAAATACAAAGCAAA--- T_nigroviridis300114 GC---TCTCCACGCCGGGGTTATAGGTTCGCCTC-CAACAGTT-- T_nigroviridis300115 GT---TCTCCACACCAGGGTTATAGGTTCGCCTC-CAACACCA-- T_belangeri300257 TC-TTTC--CAGAGCAAGGTTAT--AGAAATTTC-AGACAATT--

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved