snOPY snoRNA Orthological Gene Database

Family: SNORA84

CLUSTAL 2.0.10 multiple sequence alignment D_rerio300183 GCCTTGTGGTTCCTTAAGACAGCTCAT----CGGTGCTGATGCTTGAGGTTGTGTTTGAC O_anatinus302849 GCCTTGTGGTTACTGGTTGCTGTTATT-----GATGCAGTACTCCA--GTTGATAGAAAC T_nigroviridis300052 GCCTTGTGGTTCCTAGAGTCAGCTTGTTCCTCGGTGCTGAACTGTGGGGTTTTGTC-AAC *********** ** * * * * * *** * *** ** D_rerio300183 GGGCACACATTGATCTCTGCAATTTAATGCGTGGTGGCTGACATTTCCATGCAGCTTCCA O_anatinus302849 TGGCCAAAAGTAAT-TCTGTGATTTTTTGCATGGAGTCTGTAATTCCTCAGCAGCCTCCA T_nigroviridis300052 AGGCGCACATTAGT-TCTGTGATATTAAGCATGGGAGCTGCCACCATAGCA-GCCTCCCA *** * * * * **** ** * ** *** *** * * *** D_rerio300183 CAGCCCGGTTGCAGAAACATGT O_anatinus302849 TAGCCCGGTCACAGTTACACAA T_nigroviridis300052 CAGCCCGGTCGCAGATACACGC ******** *** ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved