snOPY snoRNA Orthological Gene Database

Family: SNORA80

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300115 GGCCACGCCGATTTGCCGTCAGAGAGTGAGCTTTATGCGTCGCTCTGATGGCAGTGTACT H_sapiens300493 ----GCATGGGTTTG--GATTTATGACAGGCCCGTCACCCTGGGCC--TGTCATAGTACC H_sapiens300588 ----GCATGGGTTTG--GATTTATGATGGGCTGGATTCCCTAGGCC--TCTCATAGTACC H_sapiens300618 ----GCATGGGTTTG--GATT-ATGACAGGCCCATCCCCCTGGACC--TCTCATAGTGCC H_sapiens300728 ----GCATGGGTTTG--GATTTATGATGGGCCCGTCCCCCTGGACC--TCTCATAGTACC * * **** * * ** * * * ** ** * D_melanogaster300115 CAGTGGCAGAGCAAAAAATTGGTCACTCTTCTTTATTTGGGCTCTCTGTTCTACCCACTC H_sapiens300493 CCATGCCAGAGCAAACTGT-GTCCCCGAACCATTGCCTGGCCTCTGTG------CCCGTA H_sapiens300588 CCATGCCAGAGCAAACTGT-AGCCCC-AACCATTGCCGGGCCTCTATG------CCTGTA H_sapiens300618 CCATGCCAGAGCAAACTGT-GGCCCCGAACCATTGCCTGGCTTCTGTA------CCCGTG H_sapiens300728 CCATGCCAGAGCAAACTGT-AGCCCTGAACCATTGCCTGGCCTCTGTT------CCCGTA * ** ********* * * * ** ** *** * ** * D_melanogaster300115 GACTCTTAGCCTTAACAAAGAAAGAGACATTT H_sapiens300493 GGCTGCTGGCACTGA-AGTGGGTTGCACAGTG H_sapiens300588 GGCTGCTGGCACTGA-AGTGGGTTGCACAGTA H_sapiens300618 GGCCACTGGCACTGA-AGAGGGTTACACAGTG H_sapiens300728 GGCTGCTGGCACTGA-AGTGGGTTGCACAATA * * * ** * * * * *** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved