snOPY snoRNA Orthological Gene Database

Family: SNORA8

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300466 ----------TGCACTGCA---TGGTATCTGCACTTAGCAGCTCAGGT-- C_porcellus300756 ----------TGCACTGAA---TGGTATCTGCACTCAACAGTTTATT--- C_porcellus300763 ----------TGCACTGAA---TGGTATCTGCACTCAACAGTTTATT--- D_novemcinctus300120 ----------AGTACTGCAT--GGT-ATCTGCACTCAGCATTTTTAT--C D_novemcinctus300160 ----------TGCACTGCAT--GGT-ATCTGCACTCAGCATTTTTTT--C D_novemcinctus300200 ----------TGCACTGCAT--GGC-ATCTGCACTCAGCATGTTTTT--C D_novemcinctus300396 ----------TGCACTGCAT--GGT-ATCTGCACTCAGCATTTTTTT--C D_novemcinctus300442 ----------TGTACTGCA---TGGTATCTGCGTTCAGCAGCTTTTT--- D_novemcinctus300457 ----------TAAAGTGAAT--AGTTACCTGCACTCAGCATTTTTTT--T D_novemcinctus300497 ----------TGCACTGCAT--GGT-ATCTGCACTCAGCAT-TTTTT--C D_novemcinctus300530 ----------TGCACTGTG---TGGTATCTGCATTCCACATTTTTTTTTC D_melanogaster300086 -----------TCCGCACGAAGTATCTCCAGAAATCAGAAATGTCTGTGC E_telfairi300052 ----------AGCACTGCA---TGGTATCTGTATCCAGCAGCCTTTT--- E_telfairi300241 ----------AGCACTGCA---TGGTATCTGCATCCAGCAGCCTTTT--- E_telfairi300449 ----------AGCACTGCA---TGGTATCTGCATCCAGCAGCCTTTT--- E_telfairi300624 ----------CACAATGCA---TGGCATCTGCGCCCAG------------ E_caballus300148 ----------TGCACTGCA---TGGTATCTGCATTCAGCAGTGTATT--- E_europaeus300111 ----------AGCACTGCA---TGGTATCTGCACTCAGTGGCGTGT---- G_gallus300009 ----------TGCACTGAA---TGGTATCTGCACCCAGCAGCGTT-C--T G_aculeatus300088 ----------AGCACTGTG---TGGTATCTGCAGCCAGTTGGTT--C--C G_aculeatus300090 ----------AGCACTGTG---TGGTATCTGCAGCCAGTTGGTT--C--C H_sapiens300750 ----------TGCACTGC-A--TGGTATCTGCACTCAGCAGTTTACA--- L_africana300148 ----------TGCACTGCA---TGGTATCTGCATTCAGCAGTTCACT--- M_mulatta300046 ----------TGCACTGC-A--TGGTATCTGCACTCAGCGGTTTACT--- M_mulatta300663 ----------TGCACTGC-A--TGGTATCTGCACTCAGCAGTTTACT--- M_murinus300194 ----------TGCACTGC-A--TGGTATCTGCATTCAGCAGTTTACT--- M_murinus300342 ----------TGCACTG-CA--CAGTT-CTGCATTTAGCAGTTAATT--- M_domestica300009 ----------TGCACTGTA---TGGTATCTGCATCCAGCAATAT-----T M_musculus300097 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGTTCT-T--T M_musculus300972 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGTTCT-T--T M_lucifugus300163 ----------TGCACTGCA---TGGTATCTGTATTCAGCAGTTTATT--- M_lucifugus300243 ----------TGCACTGCA---TGGTATCTGCATTCAGTAGTTTATT--- M_lucifugus300324 ----------TGCACTGTG---TGGTATCTGGATTCAGTAGTTTATT--- M_lucifugus300345 ----------TGTATTGCAC--TGGTGTCTACATTCAGCAGTTTATT--- M_lucifugus300409 ----------TGCACTGCA---TGGTATCTGCATTCAGTAGTTTATT--- M_lucifugus300423 ----------TTGACTCCA---TGGTATCTGCATTCAGCAG-TTATT--- M_lucifugus300455 ----------TACACTGCA---TGGTATCTGCATTCAGCAGTTTATT--- M_lucifugus300941 ----------TTGACTCCA---TGGTATCTGCATTCAGCAG-TTATT--- O_anatinus304400 ----------TGCACTGTA---TGGTATCTACACCCAGCAGTCTTTT--T O_cuniculus300010 ----------TGCACTGGTG--TGGTAACTGCATACAGCAGTTTATT--- O_cuniculus300398 ----------TGCACTGCA---TGGTATCTGCACACAGCAGTTTATT--- O_garnettii300016 ----------TATACAACA---TAGTATCTGGACCCAGCAGTTTA-T--T O_garnettii300292 ----------TGCACTGC-A--TGGTATCTGCACCCAGCAGCTTACT--- O_garnettii300558 ----------TGCACTGC-A--TGGTATCTGCATTCAGCAGCTTACT--- P_troglodytes300030 ----------TGCATTGCCA--TGGTATCTGCACTCAGTAGTTTATT--- P_troglodytes300084 ----------TGCACTGCAT--GG-CATCTGCACCCAGCAGTTTATT--- P_troglodytes300186 ----------------------------------------ACCTCT---- P_troglodytes300673 ----------TGCACTGC-A--TGGTATCTGCACTCAGCAGTTTACA--- P_pygmaeus300053 ----------TGCATTGCCA--TGGTATCTGCCCTCAATAGTTTATT--- P_pygmaeus300092 ----------TGCACTGCAT--GG-CATCTGCACCCAGCAGTTTACT--- P_pygmaeus300130 ------------------------AGAATTAAATGAGACAACCTCT---- P_pygmaeus300298 ----------TGCACTGC-A--TGGTATCTGCACTCAGCAGTTTACA--- P_pygmaeus300336 ----------TGCACTGC-G--TGGTATCTGCACTCAGCAGTTTACT--- R_norvegicus300259 ----------TGTACTGTAT--GGGCATCTGTGCTCGGCAGTTTCCT--- R_norvegicus300311 --------AGGACTTAGAA---ACTCAACTTCACTTAGCAGTTCT-T--T R_norvegicus300587 ----------TGCACTGCA---TGGTATCTGCACCCAGCAGTTCT-T--T R_norvegicus300664 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGTTCT-T--T R_norvegicus300859 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGTTCT-T--T R_norvegicus300876 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGTTCT-T--T S_cerevisiae300037 GAAGCAAAATTACACCATGAGTTCCTATTAACGTCAGCCTCTTTTGTACT S_araneus300553 ----------GATACTACA---CCAAATCTTCACACAGCAGCGCAT---- S_tridecemlineatus300138 ----------CGCACTGCA---TGGTATCTGCACTCAGCAGTTTCTT--- S_tridecemlineatus300307 ----------CACCCTTCATG-AAGCATTAAAATTCTATTAAAACTTTAA T_nigroviridis300170 ----------AGCACTGCG---TGGTATCTACAGCCAGATGCTT--C--A T_belangeri300182 ----------TGCACTGCA---TGGTATCTGCACTCAGCAGGTTATT--- X_tropicalis300035 ----------AGCACTGGA---TGGTATCTGCACCCAATGGCATA-T--A C_familiaris300466 CCTGCTGGG-TGTTCAAAAGACAGTGCAATAGAAATTCAGTAT------C C_porcellus300756 CCTGCTGATGTGTTCAAAAGACAGTGCGACAGGAATTCAGTGT------G C_porcellus300763 CCTGCTGATGTGTTCAAAAGACAGTGCGACAGGAATTCAGTGT------G D_novemcinctus300120 CT-ACTGGGGAGTTCAAAAGACAGTGCTACAGAAATTCAGTAT------C D_novemcinctus300160 CT-GCTGGGGAGTTCAAAAGACAGTGCTATAGAAATTCAGTAT------C D_novemcinctus300200 CT-GCTGGGAAGTTCAAA-GACAGTGCTATAGAAATTCACTAT------C D_novemcinctus300396 CT-GCTGGGGAGTTCAAAAGACAGTGCTATAGAAATTCAGTAT------C D_novemcinctus300442 ----------------------------TCAGAAATTCAGTAT------C D_novemcinctus300457 CTTGCTGGGGAGTTCAAA-GACAGTGCTATAGAAATTCAGTAT------C D_novemcinctus300497 CT-GCTGGGGTGTTCAAAAGTCAGTGCTATAGAAATTCAGTAT------C D_novemcinctus300530 CCTGCTGGGGTGTTCAAATGACAGTGCTATAGAAATTCAGTAT------C D_melanogaster300086 TTTGGTCG--CATTTGAAGCGTGCTAAACTAAGAATTAAATGCTGCTTAC E_telfairi300052 CCTGCTGGGGTGTTCAAAGGACAGTGCAATAGAAATTCAGTAT------C E_telfairi300241 CCTGCTGGGGTGTTCAAAGGACAGTGCAATAGAAATTCAGTAT------C E_telfairi300449 CCTGCTGGGGTGTTCAAAGGAGAGTGCAATAGAAATTCAGTAT------C E_telfairi300624 --------------------ACAGTGCTATAGAAATTCAGTAT------C E_caballus300148 CCTGCTGGG-TGTTCAAAGGACAGTGCGACATAAATTCAGTAT------C E_europaeus300111 CCTGCTGGG-TGTTCAAAGGACAGTGCGACATGAATTCAGTGT------C G_gallus300009 TCTGATGGGGTGTTCAAAAACCAGTGCTACAGTAATTCAGCAT------T G_aculeatus300088 TCAGCTGGTTTGTTCAAAAGTCAGTGCTAGAACAACTCAGCGT------C G_aculeatus300090 TCAGCCGGTTTGTTCAAAAGTCAGTGCTAGAACAACTCAGCGT------C H_sapiens300750 CCTGCTAGGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C L_africana300148 CCTGCTGGGATGTTCCAAGGACAGTGCGACAGAAATTCAGTAG------C M_mulatta300046 CCTGCTAGGGTGTTCAAAGATTAGTGCCATAGAAATCCAGTAT------C M_mulatta300663 CCTGCTAGGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C M_murinus300194 CCTGCTGGGGTGTTCAAAGGTCAGTGCCATAGAAATTCAGTAT------C M_murinus300342 CCTGCTAAGGCATGCAAAGGTCAGTGCCACAGAAATTCAGTAT------C M_domestica300009 ATTGTTGGGGTGTTCAAAAGACAGTGCTATAGAAATTCAGTAT------C M_musculus300097 CCTGTTGGG-TGTTCAAAAGACAGTGCTATAGAAACTCACTAT------C M_musculus300972 CCTGTTGGG-TGTTCAAAAGACAGTGTGATAGAAACTCACTAT------C M_lucifugus300163 CTTGCTGGG-TGTTCAAAGGACAGGGCAATATAAATTTAGTAT------C M_lucifugus300243 CCTGCTGGG-TGTTCAAAGGACAGTGCAATATAAATTCAGTAT------C M_lucifugus300324 CCTGCTGGG-TGTTCAAAAGACATTGCAATATGAATTCAGCAC------C M_lucifugus300345 CCTGCTGGG-TGTTCAAAGGACAGTATGATATAAATTCAGTAT------C M_lucifugus300409 CCTGCTGGG-TGTTCAAAGGACAG--CAATATAAATTCAGTAT------C M_lucifugus300423 CCTGCTGGG-TGTTCAAAGGACAGTGTGATATAAATTCAGTAT------C M_lucifugus300455 CCTGCTGGG-TGTTCAAAGGACAGTGCGATATAAATTCAGTAT------C M_lucifugus300941 CCTGCGGGG-TGTTCAAAGGACAGTGTGATATAAATTCAGTAT------C O_anatinus304400 CCTGGTGGGGTGTTCAAAAGCCAGTGCTAAAGGAATGCAATAT------C O_cuniculus300010 CCTGCTGGGGTATTCAAAGGACAATGCAATAGAAATTCAATGT------C O_cuniculus300398 CCTGCTGGGGTGTTCAAAGGACAGTGCAATAGAAATTCAGTAT------C O_garnettii300016 CCTGCTGGGGTGTTCAAAGGTCAGTGCCACAGAAATTCACTAC------C O_garnettii300292 CCTGCTGGGGTGTTCCAAGGTCAGTGCCATAGAAATTCAGTAT------T O_garnettii300558 CCTGCTGGGGTGTTCAAAGGTCAGTGCCATAGAAATTCAGTAT------T P_troglodytes300030 CCTGCT-GGGTGTCCAAAGATCAGTGCCATAGAAATTCAGTAT------C P_troglodytes300084 CTTGCTAAGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C P_troglodytes300186 GCTGAGGTG-T--TTAAAGGTCAGCGCTGCAGATATTCAGCAT------C P_troglodytes300673 CCTGCTAGGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C P_pygmaeus300053 CCTGCC-GGGTGTTCAAAGATCAGTGCCATAGAAATTCAGTAT------C P_pygmaeus300092 CTTGCTAAGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C P_pygmaeus300130 GCTGGGGTG-T--TTAAAGGTCAGTGCCATAGATTTTCAGCAT------C P_pygmaeus300298 CCTGCTAGGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTAT------C P_pygmaeus300336 CCTGCTAGGGTGTTCAAAGGTCAGCGCCATAGAAATCCAGTAT------C R_norvegicus300259 CTTGCTAGAATGTTTCAAGGACAGCCCTATAGAAATTCAATAT------C R_norvegicus300311 CCTGATGGG-TGTTCAAAAGACAGTGCGATAGAAATTCACTAT------C R_norvegicus300587 CCTGTTGGG-TGTTCAAAAGACAGTGCGATAGAAATTCATTAT------C R_norvegicus300664 CCTGTTGGG-TATTCAAAAGACAGTGTGATAGAAATTCACTAT------C R_norvegicus300859 CCTGTTGGG-TGTTCAAAAGACAGTGCGATAGAAATTCATTAT------C R_norvegicus300876 CCTGTTGGG-TGTTCAAAAGACAGTGCGATAGAAATTCACTAT------C S_cerevisiae300037 CATAATGTGGC-TTCGGATGTTTGATGGGCGTTGCTTCAGTGC------G S_araneus300553 CCTGCTGGG-TG-TTGAAGGGCAGTGTGACACAAATCCAGTGT------C S_tridecemlineatus300138 CCTGCTGGCGTGTTCAAAGGACAGTGCAATAGAAATTCAGTAT------C S_tridecemlineatus300307 CCT---------TTTAAATGAGTGTGTGTTAGAAATTCATTAA------C T_nigroviridis300170 TCACCTGGCTCGTTCAGAAGTCAGTGCCAGACTACCTCAACGC------T T_belangeri300182 TCTGCTGCAGTGTTCAAAGGACAGTGCCACAGAAATTCAGTAT------C X_tropicalis300035 CCTGTTGTGGTGTTCAATAGGCAGTGCTACAGTAACTCTGCAA------T C_familiaris300466 TGGCATCGTTGGTTTTCTTGGC-TTCGTGCATGTTAAA-CCTGGTATTTT C_porcellus300756 CGGCATAAGAGGTTCTCTTGGC-TGAAAGCACGTTAAG-AAAGGTAGATC C_porcellus300763 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC D_novemcinctus300120 TGGCATCGTTGGTTTTCTTGGT-TTTGTGCATGTTAAA-CCTGGTATTTC D_novemcinctus300160 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCACATTAAA-CCTGGTATTTC D_novemcinctus300200 TGGCATCATTGGTTTTCTTGGC-TTTGTCCG----------TGGTATTTC D_novemcinctus300396 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC D_novemcinctus300442 TGGCATGGTTCATTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTGTTTC D_novemcinctus300457 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGTTATTTC D_novemcinctus300497 GGGCATTGTTGGTTTTCTTGGC-TTTGTGCACGTTAAA-CCTAGTATTTC D_novemcinctus300530 TGGCATCATTGGTTTTCTTGGC-TTTGTGCATATTAAA-CCTGGTATTTC D_melanogaster300086 TAGCATCGTTAGGCGACACGAC-TTTCCATACTGTGGC-CATGGTTTTCA E_telfairi300052 TGGCATCATTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC E_telfairi300241 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC E_telfairi300449 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGATATTTC E_telfairi300624 TGACATCGTGGTGTTTTTTGGC-TTTGCGCATGTGAAA-CCTGGTATTTT E_caballus300148 TGGCATCGTTGGTTTTCTTTGC-TTCGTGCATGTTAAA-CCTGGTATTTT E_europaeus300111 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTGAAA-CCTGGTATTTT G_gallus300009 TGGCATCGTTGGTTTTCACTCT-GCAGTGGTTGTTAAA-CCTGGTATTCT G_aculeatus300088 TGGCATCGTTGGTCTCCATGCT-GCCGGTGTGTGGAGT-CCTGGTATGGT G_aculeatus300090 TGGCATCGTTGGTCTCCATGCT-GCCTGTGTGTGGAGT-CCTGGTATGGT H_sapiens300750 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC L_africana300148 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC M_mulatta300046 TGGCTTCATTGATTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC M_mulatta300663 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC M_murinus300194 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC M_murinus300342 TGGCATCTTTGGTTTTCTCGGC-TTTGTGCATATTTAA-CCTTGTATTTG M_domestica300009 TGGCATCGTTGGTTTC-ATGCTTGTCATGCATGTTCAG-CCTGGTATTTC M_musculus300097 TGGCATCGTTGGTTT-CTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC M_musculus300972 TGGCATCGTTGGTTT-CTTGGC-TTTGTGCGTGTTAAA-CCTGGTATTTC M_lucifugus300163 TGGCATCGTTGGTTTTCTTGGC-TTTGTGTATGTTAAA-CCTGGTATTTT M_lucifugus300243 TGGCATCGTTGGTTTTCTTCGC-TTTGTGCATGTTAAA-CCTGGTATTTT M_lucifugus300324 TGGCATCGTTGGTTTTCTTGGC--------ATGTTAAA-CCTGGTATTTT M_lucifugus300345 TGGCATTGTTGGTTATCTTGGC-TTCATTCATGTTAAA-CCTGG-ATTTT M_lucifugus300409 TGGCATCATTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGCATTTT M_lucifugus300423 TGGCATCGCTGGTTTTCTTGGC-TTTGTGTATGTTAAA-ACTGGTATTTT M_lucifugus300455 TGGCATCGTTGGTTTTCTCGGC-TTCAAGCATGTTAAA-CCTGGTAATTT M_lucifugus300941 TGGCATCGCTGGTTTTCTTGGC-TTTGTGTATGTTAAA-ACTGGTATTTT O_anatinus304400 TGGCATCGTTGGTTTCCTTGCCGTTCGTGCTTGTTAAA-CCTGGTATTTG O_cuniculus300010 TGGCATTTTGTGTTTTCTTGGC-TTTGTGTGTATTAAG-CTTGGTATTTA O_cuniculus300398 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC O_garnettii300016 TAGAATTGTTGGTTTTCTTAAT-GTTGTGCATGTTAAA-CCCGGTATTTC O_garnettii300292 TGGCAT-GTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTGTTTC O_garnettii300558 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC P_troglodytes300030 TAGCATCACTGATTTTCTTGGC-TTTGTGCTTGTTAAAACTTGGTATTTC P_troglodytes300084 TGGCATCATTGGTTTTCTTGAC-TTTGTGCTTGTTAAA-CCTAGTATTTC P_troglodytes300186 TGGCATCTT-GGCTT-CCTG---CTTGT-----T-AAA-CCTGGTATTTT P_troglodytes300673 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC P_pygmaeus300053 TAGCACCACTGATTTTCTTGGC-TTTGTGCTTGTTAAAACTTGGTATTTC P_pygmaeus300092 TGGCATCATTGGTTTTCTTGAG-CTTGTGCTTGTTTAA-CCTGGTATTTC P_pygmaeus300130 TGACATCTT-GGCTT-CCTG---CTTGT-----T-AAA-CCTGGTATTTC P_pygmaeus300298 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC P_pygmaeus300336 TGGTTTCATTGCTTTTCTTGGC-TTTGTGCTTGTTAAA-CCTGGTATTTC R_norvegicus300259 TAGCATTGTTGATTTTCTTGAC-TTTGTGCTTATTAAA-CCTGGTATTTC R_norvegicus300311 TGGCATCATTGGTTT-CTTGGC-TTTGCGCATGTTAAA-CCTGGTATTTC R_norvegicus300587 TGGCATCGTTGGTTT-CTTGGC-TTTGTGCGTGTTAAA-CCTGGTATTTC R_norvegicus300664 TGGCATCGTTGGTTT-CTTGGC-TTTGAGCATGTTAAA-CCTGGTATTTC R_norvegicus300859 TGGCATCGTTGGTTT-CTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC R_norvegicus300876 TGGCATCGTTGGTTT-CTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC S_cerevisiae300037 TACGGCTCATGGTAGATTAATTATTAGAAAGATGTATCTCCAGCTGTTGA S_araneus300553 TGGCATCTTTGGTTT-CTTGAC-TTTGTGCTGAT-AAA-CCTGGTATTTT S_tridecemlineatus300138 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTATTTC S_tridecemlineatus300307 TGAC---TTTGGTTTTCTTGGC-TTTGTGCATATTAAA-CCTGGTATTTC T_nigroviridis300170 TGGCATCGTTGGTCTCCATA---GCAACTGCTGGGAGT-CCTGGTAGTTG T_belangeri300182 TGGCATCGTTGGTTTTCTTGGC-TTTGTGCATGTTAAA-CCTGGTA-TTC X_tropicalis300035 TGGCATCGTTGGTTTTAAGGCTTTTCTATGCTTTAAAT-CCTGGTTTTTC C_familiaris300466 TATTGAAACAGTA------------------------------------- C_porcellus300756 TACTGATACATCG------------------------------------- C_porcellus300763 TACTGATACATTA------------------------------------- D_novemcinctus300120 TATTGATACAGTA------------------------------------- D_novemcinctus300160 TATTGATACAGTA------------------------------------- D_novemcinctus300200 TATTGATACAGTA------------------------------------- D_novemcinctus300396 TATTGATACAGTA------------------------------------- D_novemcinctus300442 TATTGGTACAGTA------------------------------------- D_novemcinctus300457 TATTGATACAGTA------------------------------------- D_novemcinctus300497 TATTGATATGGTA------------------------------------- D_novemcinctus300530 TGCCAATACAATA------------------------------------- D_melanogaster300086 AAGTAGTACAAAT------------------------------------- E_telfairi300052 TATTGATACAATT------------------------------------- E_telfairi300241 TATTGATACAGTT------------------------------------- E_telfairi300449 TATTGATACAATT------------------------------------- E_telfairi300624 TATGGATGCCGTT------------------------------------- E_caballus300148 TATTGATACAGTA------------------------------------- E_europaeus300111 TACTGATACAGAT------------------------------------- G_gallus300009 TGCTGATACAGGT------------------------------------- G_aculeatus300088 TGTTGAGACACTA------------------------------------- G_aculeatus300090 TGTTGAGACACTA------------------------------------- H_sapiens300750 TACTGATACAGTA------------------------------------- L_africana300148 TATTGGTACAGTT------------------------------------- M_mulatta300046 TATTGATAAAGCA------------------------------------- M_mulatta300663 TATTGATACAGTA------------------------------------- M_murinus300194 TATTGATACAGTA------------------------------------- M_murinus300342 TATTGATAGAGTA------------------------------------- M_domestica300009 TATTGATACAGGC------------------------------------- M_musculus300097 TAATGATACAGTT------------------------------------- M_musculus300972 TAATGATACAGTT------------------------------------- M_lucifugus300163 TATTGA--CATTATT----------------------------------- M_lucifugus300243 TATTGAGACATTA------------------------------------- M_lucifugus300324 TATTGATACAATA------------------------------------- M_lucifugus300345 CACTGATACAGTA------------------------------------- M_lucifugus300409 TATTGAAACATTA------------------------------------- M_lucifugus300423 TATTGGTACACTA------------------------------------- M_lucifugus300455 GGCGCGTCGTGCG------------------------------------- M_lucifugus300941 TATTGGTACACTA------------------------------------- O_anatinus304400 TATTGCTACAGGC------------------------------------- O_cuniculus300010 TGTTGATGTAGTA------------------------------------- O_cuniculus300398 TATTGATACAGTA------------------------------------- O_garnettii300016 TTTTTTTTTTTTT------------------------------------- O_garnettii300292 TATTGATACAGTA------------------------------------- O_garnettii300558 TATTGATACAGTA------------------------------------- P_troglodytes300030 TATTGACACAGTA------------------------------------- P_troglodytes300084 TATTGATACAGTA------------------------------------- P_troglodytes300186 TACTGATACAGTA------------------------------------- P_troglodytes300673 TACTGATACAGTA------------------------------------- P_pygmaeus300053 TATTGACACAGTA------------------------------------- P_pygmaeus300092 TATTGATACAGTA------------------------------------- P_pygmaeus300130 CACTGATACAGTA------------------------------------- P_pygmaeus300298 TATTGATACAGTA------------------------------------- P_pygmaeus300336 TATTGATACGGCA------------------------------------- R_norvegicus300259 TATGTATGCAGTT------------------------------------- R_norvegicus300311 TAATGATTGTTTT------------------------------------- R_norvegicus300587 TAATGATACAGTT------------------------------------- R_norvegicus300664 TAATGATACAGTT------------------------------------- R_norvegicus300859 TAATGATACAGTT------------------------------------- R_norvegicus300876 TTTTTTTTTTTTT------------------------------------- S_cerevisiae300037 TATTAGAGGGGGAAGCCTTTCTCTTTCACCTCGCCTTTTTAAACACCTGA S_araneus300553 TACTGAGACATTT------------------------------------- S_tridecemlineatus300138 TATTGATACAGCA------------------------------------- S_tridecemlineatus300307 TATTGATAAAATA------------------------------------- T_nigroviridis300170 TGTTGAAACATTT------------------------------------- T_belangeri300182 TATTGATACAGTA------------------------------------- X_tropicalis300035 TGCTGATACAAAT------------------------------------- C_familiaris300466 -------------------------------- C_porcellus300756 -------------------------------- C_porcellus300763 -------------------------------- D_novemcinctus300120 -------------------------------- D_novemcinctus300160 -------------------------------- D_novemcinctus300200 -------------------------------- D_novemcinctus300396 -------------------------------- D_novemcinctus300442 -------------------------------- D_novemcinctus300457 -------------------------------- D_novemcinctus300497 -------------------------------- D_novemcinctus300530 -------------------------------- D_melanogaster300086 -------------------------------- E_telfairi300052 -------------------------------- E_telfairi300241 -------------------------------- E_telfairi300449 -------------------------------- E_telfairi300624 -------------------------------- E_caballus300148 -------------------------------- E_europaeus300111 -------------------------------- G_gallus300009 -------------------------------- G_aculeatus300088 -------------------------------- G_aculeatus300090 -------------------------------- H_sapiens300750 -------------------------------- L_africana300148 -------------------------------- M_mulatta300046 -------------------------------- M_mulatta300663 -------------------------------- M_murinus300194 -------------------------------- M_murinus300342 -------------------------------- M_domestica300009 -------------------------------- M_musculus300097 -------------------------------- M_musculus300972 -------------------------------- M_lucifugus300163 -------------------------------- M_lucifugus300243 -------------------------------- M_lucifugus300324 -------------------------------- M_lucifugus300345 -------------------------------- M_lucifugus300409 -------------------------------- M_lucifugus300423 -------------------------------- M_lucifugus300455 -------------------------------- M_lucifugus300941 -------------------------------- O_anatinus304400 -------------------------------- O_cuniculus300010 -------------------------------- O_cuniculus300398 -------------------------------- O_garnettii300016 -------------------------------- O_garnettii300292 -------------------------------- O_garnettii300558 -------------------------------- P_troglodytes300030 -------------------------------- P_troglodytes300084 -------------------------------- P_troglodytes300186 -------------------------------- P_troglodytes300673 -------------------------------- P_pygmaeus300053 -------------------------------- P_pygmaeus300092 -------------------------------- P_pygmaeus300130 -------------------------------- P_pygmaeus300298 -------------------------------- P_pygmaeus300336 -------------------------------- R_norvegicus300259 -------------------------------- R_norvegicus300311 -------------------------------- R_norvegicus300587 -------------------------------- R_norvegicus300664 -------------------------------- R_norvegicus300859 -------------------------------- R_norvegicus300876 -------------------------------- S_cerevisiae300037 TACAGTTGGTCATGATTCGTTCTACATTTTAA S_araneus300553 -------------------------------- S_tridecemlineatus300138 -------------------------------- S_tridecemlineatus300307 -------------------------------- T_nigroviridis300170 -------------------------------- T_belangeri300182 -------------------------------- X_tropicalis300035 --------------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved