snOPY snoRNA Orthological Gene Database

Family: SNORA79

CLUSTAL W (1.83) multiple sequence alignment C_elegans300059 CCCCGCTCTATGTTCCTCTCCACTTTGTTAATTTTCTGGAATGGAGATTT C_familiaris300358 ---TGATGACTGTTCCTCCTATTGCCTTCAGGCCTTGGCACT-AGGATTT C_porcellus300052 ---TGATGACTGTTCCTCCTATTGCTTTGAGGTTT-GGCACT-AGGATTT C_porcellus300873 ---TGATGACTGTTCCTCCTATTGCTTTGAGTCCT-GGCAGT-GGGATTT D_rerio300275 ---TGATGATCGTTCCTCCTGCCGCTCAGAGATCATGCGGCTCAGGATTT D_novemcinctus300201 ---GGTTGGCTTAAAAGGTATGTGCTTGG---------CAGT-AGGATTT D_novemcinctus300541 ---TGATGACTCTTCCTCCTATTGCCTTCAGGCCT-GGCAGT-AGGATTT E_telfairi300023 ---TGATGACTGTTCCTCCTATTGCCTTCAGACCT-GGCACT-AGGGTTT E_telfairi300130 ---TGATGACTGTGCCTCCTCTTGCCTTCAGACCT-GACACT-AGGGTTT E_telfairi300766 ---TGATGACTGTGCCTCCTCTTGCCTTCAGACCT-GGCACT-AGGGTTT E_caballus300284 ---TGATGACTGTTCCTCCTATTGCCTTCAGGCCT-GGCACT-AGGGTTT E_europaeus300490 ---TGATGACTGTTCCTCCTCTTGCCTTCAGGTCT-GGCACT-AGGATTT H_sapiens300721 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT L_africana300475 ---TGATGACTGTTCCTCCTATTGCCTTCAGACCT-GGCACT-AGGATTT M_mulatta300559 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT M_murinus300464 ---TGATGACTGTTCCTCCTATTGCCTTCAAGCCT-GGCACT-AGGATTT M_domestica300117 ---TGATGACTGTTCCTCCTATTGCCTAGAGCTCT-GGCATT-AGGATTT M_musculus300526 -----------------TGTTGAGCCTTTAGCTAT-GGCACT-AGGGTTT M_musculus300848 ---TGATGACTGTTCCTCCTGTCGCCTTTAGGTAT-GGCGCT-AGGATTT M_musculus300878 ---TGATGACTGTTCCTCCTATTGCCTTTAGATAT-GGCACT-AGGATTT M_musculus300925 ---TGATGGCTGTTCCTCCTGTTGCCTATAGGCAT-GGCACT-AGGATTT M_lucifugus300081 ---AGGTGACTGGGGCTCCAAATCCTT-----------CCAT-AAAATGT M_lucifugus300663 ---TGATGACTGTTCCTCCTATTGCCTTCAGTCCT-GGCACT-AGGATTT M_lucifugus300696 ---CGATGACCGTTCCTCCTCCTGCCTGCAGGCCT-GGCACT-AGGATTT M_lucifugus300774 ---TGATGACTGTTCCTCCTATTGCCTTCAGCCCT-GGCACT-AGGATTT O_anatinus302570 ---TGATGGCTGTTCCTCTTGCTGTCTGGAGCTGTGGGCAGT-GGGATTT O_cuniculus300444 ---TGATGACTGTTCCTCCTAATGCTTTCAAGCCT-GGCATT-AGGATTT O_garnettii300652 ---TGATGACTGTTCCTCCTATTGCCTTCAGGTCT-GGCACT-AGGATTT P_troglodytes300558 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATC-AGGATTT P_pygmaeus300789 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT R_norvegicus300490 ---TGATGACTGTTCCTCCTATTGCCTATAGGCAT-GGCACT-AGGATTT R_norvegicus300882 ---TAATGACTATTCCTCCTGTTGCCTGTAGGCAT-GGCACT-AGGATTT R_norvegicus300885 ---TGATGACTGTTCCTCCTGTTGCCTTTAGGTAT-GGCACT-AGGATTT R_norvegicus300904 ---TGATGACTGTTCCTCCTATTGCCTATAGGCAT-GGCACT-AGGATTT R_norvegicus301032 ---TGATGACTGTTCCTCCTATTGCCTTTAGATGT-GGCACT-AGGATTT S_araneus300523 ---TGATGAC-GTTCCTCTCATTGCCTAGAGCATT-GGCACT-GGGATTT S_araneus300919 ---TGGTGGCTGTTCCTCCTATTGCCTAGAGTGCT-GGCACT-AGGATTT S_tridecemlineatus300277 ---TGATGACTGTTCCTCCTATTGCTTATAGGCTG-GGCACT-AGGATTT T_belangeri300403 ---TGATGACTGTTCCTCCTACTGCCTTCAAGCCT-GGCAGT-AGGATTT * * C_elegans300059 TATAAGAGCGAAAATAAAATGTCATTAGCGGTGCTCATCTTCGGTTAATT C_familiaris300358 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA C_porcellus300052 T----AAGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA C_porcellus300873 T----AAGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA D_rerio300275 T----AGATCATCATAGA--GAAATCTGAGTCTGTTTCACCCGGTGTGTG D_novemcinctus300201 T----AGGTCATCATAAATTAAAATTGGATTTTCTT-CACTCAGGGAATA D_novemcinctus300541 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA E_telfairi300023 T----AGGGCATCATAAATAAAAAATTGATTTTCTT-CACTC-------- E_telfairi300130 T----AGGTCATCATAAATAAAAAATTGATTTTCTT-CACTCAGAGAATA E_telfairi300766 T----AGGTCATCATAAATAAAAAATTGATTTTCTT-CACTCAGAGAATA E_caballus300284 T----AGGTCATCGTAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA E_europaeus300490 T----AGGTCATCATAAATTAAAATTTGGTTTTCTT-CACTCAGAGAATA H_sapiens300721 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA L_africana300475 T----AGGTCATCATAGATCAAAATGTGATTTTCTT-CACTCAGAGAATA M_mulatta300559 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA M_murinus300464 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA M_domestica300117 T----ATGTCATCATACATTAAAATTTGACTTTTTT-CACTCAGAGAATA M_musculus300526 T----AGGTCATCACAAATTAAAATTGATTTTTTT--CACTGAGAGAATA M_musculus300848 T----AGGTCATCATAAATTAAAAT-AGATTTTTTT-CACTCAGAGAATA M_musculus300878 T----AGGTCATCATAAATTAAAATTGATTTTTTTT-CACTCAGAGAATA M_musculus300925 T----AAGTCATCATAAATTAAAATTGACTTTTTT--CACTCAGAGAATA M_lucifugus300081 CCAACAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA M_lucifugus300663 T----AGGTCATCATATATTAAAATCTGATTTTCTT-CACTCAGAGAATA M_lucifugus300696 C----AGGTCATCGTAAAGTAAAAG-TGATTTTCTT-CACTCAGAGAATA M_lucifugus300774 T----AGGTCATCATATATTAAAATCTGATTTTCTT-CACTCAGAGAATA O_anatinus302570 T----AGTCCATCACAGAG-AAAAGTGGCCTGTCTT-CACTCGGGGCACC O_cuniculus300444 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGATTA O_garnettii300652 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA P_troglodytes300558 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA P_pygmaeus300789 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA R_norvegicus300490 T----AGGTCATCGTAAATTAAAATTGATTTTTTTTTTACTCAGAGAATA R_norvegicus300882 C----AGGGCATCATAAATTAAAGTTGATTTTTTTTTTACTCAGAGAATA R_norvegicus300885 T----AGGTCATCATAAATTAAAATAGATTTTTTT--CACTCAGAGAATA R_norvegicus300904 T----AGGTCATCATAAATTAAAATTGATTTTTTT--CACTCAGAGAATA R_norvegicus301032 T----AGGTCATCATAAATTAAAATTGATTTTTTT--CACTCAGAGAATA S_araneus300523 T----AGTTCATCATACATCAAA-CTTGATTTTCTT-CACTCAGAGAATA S_araneus300919 T----AGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA S_tridecemlineatus300277 T----ATGTCATCATAAAATTAA-TTTGATTTTCTT-CACTCAGAGAATA T_belangeri300403 T----AGGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA * * * * C_elegans300059 TTCTCGATATGGCTGAT-------TG-GATAATGACTACATTT------- C_familiaris300358 -TTAGGATAATGGGATT----ATCTG-TTTATTCTCTGAAATTTGCGGAA C_porcellus300052 -TTAGGATAATGGGATT----ATCTG-TCTGTTCTCTGAAATTTGCGGAA C_porcellus300873 -TTAGGATAATGGGGTT----ATCTG-TCTGTTCTCTGAAATTTGCGGTA D_rerio300275 --CCGACCGACGGTCTC------CTG-TGGCCACGCTGGACTTTGCGGGA D_novemcinctus300201 -TTAGGATGATGGGATT----ATCT-----ATCCTCTGAAATTTGTGAAA D_novemcinctus300541 -TTAGGATAATGGGATT----ATCTA-TCTGTTCTCTGAAATTTGCGGAA E_telfairi300023 -ATAGGATAATGGGTTTT---ATCTG-ACTAGTCTCTGAAATTTGCGGAA E_telfairi300130 -ATAGAATAATGGGTTTT---ATCTG-ACTATTCTCTGAAATTTGCGGAA E_telfairi300766 -ATAGAATAATGGGTTTT---ATCTG-ACTATTCTCTGAAATTTGCGGAA E_caballus300284 -TTAGGATAATGGAATT----ATCTG-TTTATTCTCTGAAATTTGCGGGA E_europaeus300490 -TTAGGATAATGGGATT----ATCTG-TTTATTCTCTGATATTTGCGGAA H_sapiens300721 -TTAGGATAATGGAGTT----ATC-----TGTTCTCTGAAATTTGCGGAA L_africana300475 -TTAGGATAATGGGATT----ATCTG-TCTATTCTCTGAAATTTGTGGAA M_mulatta300559 -TTAGGATAATGGAGTT----ATCCG-TCTGTTCTCTGAAATTTGCGGAA M_murinus300464 -TTGGGATAATGGGATT----ATCTG-TCTGTTCTCTGAAATTTGCGGAA M_domestica300117 TTTGGGATAAATGGATT----ATCCT-TTTCTTCTCTGAAATTTGCGGAG M_musculus300526 -TTAAGATACCGGGATT----ATCTA-TGTATTCTCTGAAATTTGCGGGA M_musculus300848 -TTAAGATGTTGGGAGGC---ACTTGGTCATGTCTTTTAGCTCTCATGGC M_musculus300878 -TTAAGATACTGGGATT----ATCTA-TGTATTCTCTGAAATTTGCGGGA M_musculus300925 -TCAAGATATTGGGTTT----ATCTA-TGTGTTCTCTGAAATTTGCGGGG M_lucifugus300081 -TTAGGGTGATGGGACT----ATCTG-TTTATTCTCTGATATTTGTGGAA M_lucifugus300663 -TTAGGATGATGGGATT----ATCTG-TTTATTCTCTGAAATTTGCGGAA M_lucifugus300696 -TCAGGATAATGGGATT----ATCTG-TTTGTTCTCTGAAATTTGCGGAA M_lucifugus300774 -TTAGGATGATGGGATT----ATCTG-TTTATTCTCTGAAATTTGCGGAA O_anatinus302570 -ATGAGATGGGTCGGCC----ATCTATTCGTGCCTCCGAACTTTGCGGGG O_cuniculus300444 -TGTGGATAATGGGATT----GTCTG-TCTGTTCTCTGAAATTTGCGGAA O_garnettii300652 -TTGGGATAACGGGATT----ATCTG-TCTGTTCTCTGAAATTTGCGGAA P_troglodytes300558 -TTAGGATAATGGAGTT----ATC-----TGTTCTCTGAAATTTGCGGAA P_pygmaeus300789 -TTAGGATAATGGAGTT----ATCTG-TCTGTTCTCTGAAATTTGCGGAA R_norvegicus300490 -TCAAGATATTGGGATT----ATCTG-TGTATTCTCTGAAATTTGCAGGG R_norvegicus300882 -TCAAGATATTGGGATT----ATCTA-TGTATTCTCTGAAATTTGCGGGG R_norvegicus300885 -TTAAGATATTGAGATT----ATCTG-TATATTCTCTGAAATTTTCAGAA R_norvegicus300904 -TCAAGATAATGGGATT----ATCTG-TGTATTCTCTGAAATTTGCGGGG R_norvegicus301032 -TTAAGATACTGGGATT----ATCTA-TGTACTCTCTGAAATTTGCGGGA S_araneus300523 -TTGGGATAATGGGATT----ATCTG-TGTATTCTCTGAAATTTGCGGAA S_araneus300919 -TTGAGATAATGGGATT----ATCTTGTTTGTTCTCTGAAATTTGCGGAA S_tridecemlineatus300277 -TTAGGATAATGGGATTTATTATCTG-TCTATTCTCTGAAATTTGCGGGA T_belangeri300403 -CTAAGATAATGGGATT----ATCTG-TTTATTCTCTGAAATTTGCGGAA * C_elegans300059 ---------- C_familiaris300358 TCAAACATCT C_porcellus300052 TCAAACAGTT C_porcellus300873 TCAGACAATT D_rerio300275 CTCTACAGCT D_novemcinctus300201 TCAAACAGAA D_novemcinctus300541 TCAAACACAT E_telfairi300023 TCAAACAGCT E_telfairi300130 TCAAACAGCT E_telfairi300766 TCAAACAGCT E_caballus300284 TCAAACATTT E_europaeus300490 TCAAACATTT H_sapiens300721 TCAAACATGT L_africana300475 TCAAACAGCT M_mulatta300559 TCAAACATTT M_murinus300464 TCAAACAAAT M_domestica300117 TCAAACACTT M_musculus300526 TCAAACAGTT M_musculus300848 TGATTCTCTT M_musculus300878 TCAAACAGTT M_musculus300925 TCAAACATTA M_lucifugus300081 TCAAACACTT M_lucifugus300663 TCAAACACTT M_lucifugus300696 TCAAACACTT M_lucifugus300774 TCAAACACTT O_anatinus302570 TCAGACAAGC O_cuniculus300444 TCAAACATTT O_garnettii300652 TCAAACACTT P_troglodytes300558 TCAAACATGT P_pygmaeus300789 TCAAACATTT R_norvegicus300490 TCAAACAATT R_norvegicus300882 CCACACAATA R_norvegicus300885 TCAAACAAAA R_norvegicus300904 TCAAACAATT R_norvegicus301032 TCAAACAGTT S_araneus300523 TCAAACACTG S_araneus300919 TCTGACACTC S_tridecemlineatus300277 TCTAACACTT T_belangeri300403 TCAAACAGTT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved