snOPY snoRNA Orthological Gene Database

Family: SNORA79

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300059 CCCCGCTCTATGTTCCTCTCCACTTTGTTAATTTTCTGGAATGGAGATTT C_familiaris300358 ---TGATGACTGTTCCTCCTATTGCCTTCAGGCCTTGGCACT-AGGATTT C_porcellus300052 ---TGATGACTGTTCCTCCTATTGCTTTGAGGTTT-GGCACT-AGGATTT C_porcellus300873 ---TGATGACTGTTCCTCCTATTGCTTTGAGTCCT-GGCAGT-GGGATTT D_rerio300275 ---TGATGATCGTTCCTCCTGCCGCTCAGAGATCATGCGGCTCAGGATTT D_novemcinctus300201 -----------GGTTGGCTTAAAAGGTATGTGCTT-GGCAGT-AGGATTT D_novemcinctus300541 ---TGATGACTCTTCCTCCTATTGCCTTCAGGCCT-GGCAGT-AGGATTT E_telfairi300023 ---TGATGACTGTTCCTCCTATTGCCTTCAGACCT-GGCACT-AGGGTTT E_telfairi300130 ---TGATGACTGTGCCTCCTCTTGCCTTCAGACCT-GACACT-AGGGTTT E_telfairi300766 ---TGATGACTGTGCCTCCTCTTGCCTTCAGACCT-GGCACT-AGGGTTT E_caballus300284 ---TGATGACTGTTCCTCCTATTGCCTTCAGGCCT-GGCACT-AGGGTTT E_europaeus300490 ---TGATGACTGTTCCTCCTCTTGCCTTCAGGTCT-GGCACT-AGGATTT H_sapiens300721 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT L_africana300475 ---TGATGACTGTTCCTCCTATTGCCTTCAGACCT-GGCACT-AGGATTT M_mulatta300559 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT M_murinus300464 ---TGATGACTGTTCCTCCTATTGCCTTCAAGCCT-GGCACT-AGGATTT M_domestica300117 ---TGATGACTGTTCCTCCTATTGCCTAGAGCTCT-GGCATT-AGGATTT M_musculus300526 -----------------TGTTGAGCCTTTAGCTAT-GGCACT-AGGGTTT M_musculus300848 ---TGATGACTGTTCCTCCTGTCGCCTTTAGGTAT-GGCGCT-AGGATTT M_musculus300878 ---TGATGACTGTTCCTCCTATTGCCTTTAGATAT-GGCACT-AGGATTT M_musculus300925 ---TGATGGCTGTTCCTCCTGTTGCCTATAGGCAT-GGCACT-AGGATTT O_anatinus302570 ---TGATGGCTGTTCCTCTTGCTGTCTGGAGCTGTGGGCAGT-GGGATTT O_cuniculus300444 ---TGATGACTGTTCCTCCTAATGCTTTCAAGCCT-GGCATT-AGGATTT O_garnettii300652 ---TGATGACTGTTCCTCCTATTGCCTTCAGGTCT-GGCACT-AGGATTT P_troglodytes300558 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATC-AGGATTT P_pygmaeus300789 ---TGATGACTGTTCTTCCTGTTGCCTTCAGACCT-GGCATT-AGGATTT R_norvegicus300490 ---TGATGACTGTTCCTCCTATTGCCTATAGGCAT-GGCACT-AGGATTT R_norvegicus300882 ---TAATGACTATTCCTCCTGTTGCCTGTAGGCAT-GGCACT-AGGATTT R_norvegicus300885 ---TGATGACTGTTCCTCCTGTTGCCTTTAGGTAT-GGCACT-AGGATTT R_norvegicus300904 ---TGATGACTGTTCCTCCTATTGCCTATAGGCAT-GGCACT-AGGATTT R_norvegicus301032 ---TGATGACTGTTCCTCCTATTGCCTTTAGATGT-GGCACT-AGGATTT S_araneus300523 ---TGATGAC-GTTCCTCTCATTGCCTAGAGCATT-GGCACT-GGGATTT S_araneus300919 ---TGGTGGCTGTTCCTCCTATTGCCTAGAGTGCT-GGCACT-AGGATTT S_tridecemlineatus300277 ---TGATGACTGTTCCTCCTATTGCTTATAGGCTG-GGCACT-AGGATTT T_belangeri300403 ---TGATGACTGTTCCTCCTACTGCCTTCAAGCCT-GGCAGT-AGGATTT * *** C_elegans300059 TATAAGAGCGAAAA-TAAAATGTCATTAGCGG-TGCTC-----ATC-TTC C_familiaris300358 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA C_porcellus300052 TAAGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA-TTA C_porcellus300873 TAAGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA-TTA D_rerio300275 TAGATCATCATAGA--GAAATCTGAGTCTGTTTCACCCGGTGTGTG--CC D_novemcinctus300201 TAGGTCATCATAAATTAAAATTGGATTTTCTT-CACTCAGGGAATA-TTA D_novemcinctus300541 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA E_telfairi300023 TAGGGCATCATAAATAAAAAATTGATTTTCTT-CACTC---------ATA E_telfairi300130 TAGGTCATCATAAATAAAAAATTGATTTTCTT-CACTCAGAGAATA-ATA E_telfairi300766 TAGGTCATCATAAATAAAAAATTGATTTTCTT-CACTCAGAGAATA-ATA E_caballus300284 TAGGTCATCGTAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA E_europaeus300490 TAGGTCATCATAAATTAAAATTTGGTTTTCTT-CACTCAGAGAATA-TTA H_sapiens300721 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA L_africana300475 TAGGTCATCATAGATCAAAATGTGATTTTCTT-CACTCAGAGAATA-TTA M_mulatta300559 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA M_murinus300464 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTG M_domestica300117 TATGTCATCATACATTAAAATTTGACTTTTTT-CACTCAGAGAATATTTG M_musculus300526 TAGGTCATCACAAATTAAAATTGATTTTTTT--CACTGAGAGAATA-TTA M_musculus300848 TAGGTCATCATAAATTAAAA-TAGATTTTTTT-CACTCAGAGAATA-TTA M_musculus300878 TAGGTCATCATAAATTAAAATTGATTTTTTTT-CACTCAGAGAATA-TTA M_musculus300925 TAAGTCATCATAAATTAAAATTGACTTTTTT--CACTCAGAGAATA-TCA O_anatinus302570 TAGTCCATCACAGA-GAAAAGTGGCCTGTCTT-CACTCGGGGCACC-ATG O_cuniculus300444 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGATTA-TGT O_garnettii300652 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTG P_troglodytes300558 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA P_pygmaeus300789 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTA R_norvegicus300490 TAGGTCATCGTAAATTAAAATTGATTTTTTTTTTACTCAGAGAATA-TCA R_norvegicus300882 CAGGGCATCATAAATTAAAGTTGATTTTTTTTTTACTCAGAGAATA-TCA R_norvegicus300885 TAGGTCATCATAAATTAAAATAGATTTTTTT--CACTCAGAGAATA-TTA R_norvegicus300904 TAGGTCATCATAAATTAAAATTGATTTTTTT--CACTCAGAGAATA-TCA R_norvegicus301032 TAGGTCATCATAAATTAAAATTGATTTTTTT--CACTCAGAGAATA-TTA S_araneus300523 TAGTTCATCATACATCAAA-CTTGATTTTCTT-CACTCAGAGAATA-TTG S_araneus300919 TAGGTCATCATAAATTAAAATTTGATTTTCTT-CACTCAGAGAATA-TTG S_tridecemlineatus300277 TATGTCATCATAAAATTAA-TTTGATTTTCTT-CACTCAGAGAATA-TTA T_belangeri300403 TAGGTCATCATAAATTGAAATTTGATTTTCTT-CACTCAGAGAATA-CTA * * * * * ** * * C_elegans300059 GGTTAATTTTCTCG---ATATGGCTGA---TTGGATAATGACTACATTT- C_familiaris300358 GGATAATGGGATT----ATCTGTTTAT-TCTCTGAAATTTGCGGAATCAA C_porcellus300052 GGATAATGGGATT----ATCTGTCTGT-TCTCTGAAATTTGCGGAATCAA C_porcellus300873 GGATAATGGGGTT----ATCTGTCTGT-TCTCTGAAATTTGCGGTATCAG D_rerio300275 GACCGACGGTCTC----CTGTGGCCA---CGCTGGACTTTGCGGGACTCT D_novemcinctus300201 GGATGATGGGATT----ATCTATC-----CTCTGAAATTTGTGAAATCAA D_novemcinctus300541 GGATAATGGGATT----ATCTATCTGT-TCTCTGAAATTTGCGGAATCAA E_telfairi300023 GGATAATGGGTTTT---ATCTGACTAG-TCTCTGAAATTTGCGGAATCAA E_telfairi300130 GAATAATGGGTTTT---ATCTGACTAT-TCTCTGAAATTTGCGGAATCAA E_telfairi300766 GAATAATGGGTTTT---ATCTGACTAT-TCTCTGAAATTTGCGGAATCAA E_caballus300284 GGATAATGGAATT----ATCTGTTTAT-TCTCTGAAATTTGCGGGATCAA E_europaeus300490 GGATAATGGGATT----ATCTGTTTAT-TCTCTGATATTTGCGGAATCAA H_sapiens300721 GGATAATGGAGTT----ATC----TGT-TCTCTGAAATTTGCGGAATCAA L_africana300475 GGATAATGGGATT----ATCTGTCTAT-TCTCTGAAATTTGTGGAATCAA M_mulatta300559 GGATAATGGAGTT----ATCCGTCTGT-TCTCTGAAATTTGCGGAATCAA M_murinus300464 GGATAATGGGATT----ATCTGTCTGT-TCTCTGAAATTTGCGGAATCAA M_domestica300117 GGATAAATGGATT----ATCCTTTTCT-TCTCTGAAATTTGCGGAGTCAA M_musculus300526 AGATACCGGGATT----ATCTATGTAT-TCTCTGAAATTTGCGGGATCAA M_musculus300848 AGATGTTGGGAGGC---ACTTGGTCATGTCTTTTAGCTCTCATGGCTGAT M_musculus300878 AGATACTGGGATT----ATCTATGTAT-TCTCTGAAATTTGCGGGATCAA M_musculus300925 AGATATTGGGTTT----ATCTATGTGT-TCTCTGAAATTTGCGGGGTCAA O_anatinus302570 AGATGGGTCGGCC----ATCTATTCGTGCCTCCGAACTTTGCGGGGTCAG O_cuniculus300444 GGATAATGGGATT----GTCTGTCTGT-TCTCTGAAATTTGCGGAATCAA O_garnettii300652 GGATAACGGGATT----ATCTGTCTGT-TCTCTGAAATTTGCGGAATCAA P_troglodytes300558 GGATAATGGAGTT----ATC----TGT-TCTCTGAAATTTGCGGAATCAA P_pygmaeus300789 GGATAATGGAGTT----ATCTGTCTGT-TCTCTGAAATTTGCGGAATCAA R_norvegicus300490 AGATATTGGGATT----ATCTGTGTAT-TCTCTGAAATTTGCAGGGTCAA R_norvegicus300882 AGATATTGGGATT----ATCTATGTAT-TCTCTGAAATTTGCGGGGCCAC R_norvegicus300885 AGATATTGAGATT----ATCTGTATAT-TCTCTGAAATTTTCAGAATCAA R_norvegicus300904 AGATAATGGGATT----ATCTGTGTAT-TCTCTGAAATTTGCGGGGTCAA R_norvegicus301032 AGATACTGGGATT----ATCTATGTAC-TCTCTGAAATTTGCGGGATCAA S_araneus300523 GGATAATGGGATT----ATCTGTGTAT-TCTCTGAAATTTGCGGAATCAA S_araneus300919 AGATAATGGGATTA---TCTTGTTTGT-TCTCTGAAATTTGCGGAATCTG S_tridecemlineatus300277 GGATAATGGGATTTATTATCTGTCTAT-TCTCTGAAATTTGCGGGATCTA T_belangeri300403 AGATAATGGGATT----ATCTGTTTAT-TCTCTGAAATTTGCGGAATCAA C_elegans300059 ------ C_familiaris300358 ACATCT C_porcellus300052 ACAGTT C_porcellus300873 ACAATT D_rerio300275 ACAGCT D_novemcinctus300201 ACAGAA D_novemcinctus300541 ACACAT E_telfairi300023 ACAGCT E_telfairi300130 ACAGCT E_telfairi300766 ACAGCT E_caballus300284 ACATTT E_europaeus300490 ACATTT H_sapiens300721 ACATGT L_africana300475 ACAGCT M_mulatta300559 ACATTT M_murinus300464 ACAAAT M_domestica300117 ACACTT M_musculus300526 ACAGTT M_musculus300848 TCTCTT M_musculus300878 ACAGTT M_musculus300925 ACATTA O_anatinus302570 ACAAGC O_cuniculus300444 ACATTT O_garnettii300652 ACACTT P_troglodytes300558 ACATGT P_pygmaeus300789 ACATTT R_norvegicus300490 ACAATT R_norvegicus300882 ACAATA R_norvegicus300885 ACAAAA R_norvegicus300904 ACAATT R_norvegicus301032 ACAGTT S_araneus300523 ACACTG S_araneus300919 ACACTC S_tridecemlineatus300277 ACACTT T_belangeri300403 ACAGTT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved