snOPY snoRNA Orthological Gene Database

Family: SNORA77

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300133 -------ACAGATTCACTCTGTATCCAGCTGTAGC-CCCAG-GTGGGTGCTTTTTCTGTC C_familiaris300399 -------GCAGACTCACTCTGCATCCGGCTGCAGC-CCCAG-GCGGGTGCTTTTTCCGTC C_porcellus300681 -------GCAGACTCACTCTGCACCGGA--GCAGCATCCAG-GCAGATGCCATCTCTGTC C_porcellus300708 -------GCAGACTCACTCTGCACTTGGCTGTAGCCTCCAG-GCAGGTACTTTTTCTGTC C_porcellus300960 -------GCAGACTCACTCTGCACTTGGCTGTAGCCTCCAG-GCAGGTGCTTTTTCTGTC D_rerio300209 -------GCAGACTCACTCTGTGTAAGGCAGATACCTCCAG-CCTTAGACTTTTTCTGTC D_novemcinctus300250 -------GCAGACTCACTCTGCATCCAACTGCAGCCCCAGT-CTGGGTGCTTTTTTCGTC E_caballus300388 -------GCAGACTCACTCTGCACCTGGCTGCAGC-CCCAG-GCGGGTGCTTTTTCTGTC E_europaeus300592 -------GCAGACTCACTCTGCACCCGGCTGCAGC-CCCAG-GCGGGTGCTTTTTCTGTC G_gorilla300637 -------GCAGACTCCCTCAGCATCCAGC---------------GGGTGCTTTTTCGGTC G_gorilla300127 ------------GAGACTCTGTCTCAAAAAAAAAA-AAA---AAAAATG-TAATTCTGTC G_gorilla300212 -------GCAGACTCACTGTGCACCTGGCTGCAGG-CCCAG--TGGGTGCTCGTTCCCTC G_gorilla300379 -------GCAGACTCACTCTGCATCTGACTATACT-TCCAG-GCGGGTGCTTTTTCTGTC G_gorilla300445 -------GCAGACTCACTCTGCACCTGACTGTACT-TCCAG-GCAGGTGCTTTTTCTGTC G_gorilla300446 -------ACAGACTCACTTTGCACCTGGCTGCAGC-CTCAT-GGGGGTGCTTTTTCCATG H_sapiens300648 -------ACAGACTCACTTTGCACCTGGCTGCAGC-CTCAT-GGGGGTGCTTTTTCCATG H_sapiens300674 -------GCAGACTCACTATGCACCTGACTGTACT-TCCAG-GCAGGTGCTTTTTCTGTC H_sapiens300681 -------GCAGACTCACTCTGCATCTGACTATACT-TCCAG-GCGGGTGCTTTTTCTGTC M_mulatta300003 -------GCAGACTCACTATGCATCTGGCTGCATT-GCCAG-GTGGCTGCTCATTCCCTC M_mulatta300258 -------GCAGACTCACTTGGAACCTGACTGCAAC-TCAAG-ATGGGTGCTTTTTCCTTC M_mulatta300299 -------GCAGACTCACTCAGCATCCAGC---------------GGGTGCTTTTTCTGTC M_mulatta300533 -------GCAGACTCACTCTGCACCTGACTGTACT-TCCAG-GCGGGTGCTTTTTCTGTC M_mulatta300572 -------ACAGACTCACTTTGCACCTGGCTGCAGC-CTCAT-GGGCGTGCTTTTTCCATG M_mulatta300591 -------GCAGACTCACTCTGCACCTGACTATACT-TCCAG-GCGGGTGCTTTTTCTGTC M_murinus300548 -------GCAGTCTCACTCTGCACCCAGCGGCAGCCCCAGG-C--GGTGCTTTTTCCGTC M_murinus300559 -------GCAGACTCACTCTGCATCCGGCTGCA-C-TTCAG-ATGGGTGCTTTTTCTGTC M_musculus300872 -------GCAGATTCACTCTGCACCTGGCTGCAGC-TCCAG-TCTGGTGCTTTTTCCATC M_lucifugus300605 -------GCCGACGCACTGTGC--CCGGCCGCAGT-CCCAG-GCGGG-GCTTTCCTCGTC M_lucifugus300720 -------GCAGACTCACTCTGCACCTGGATGCAGT-CCCAG-GCAGATGCTTTTTCCGTC M_lucifugus300725 -------GCAGACTCACTCTGCACCCGGCTGCAGT-CCCAG-ACGGGTGCTTTTTCAGTC O_anatinus302910 -------GCAGGCTCACTCTGCGCCTGGCCGCGCTCCTCGGCCTTGGTGCTTTTTCCGCC O_cuniculus300202 -------ACAGACTCACCTTGCACCCAGC--CTGT-CCCAG-GCGGGTGCTTTTTTCATC O_garnettii300495 -------GCAGACTCACTCTGCATCCGCCTGCAGCCCCAAG-GCGGGTGCTTTTTCAGTC P_troglodytes300614 -------GCAGACTCACTCTGCATCTGACTATACT-TCCAG-GCGGGTGCTTTTTCTGTC P_troglodytes300226 -------GCAGACTCCCTCAGCATCCAGC---------------GGGTGCTTTTTCGGTC P_troglodytes300353 -------GCAGACTCACTGTGCACCTGGCTGCAGG-CCCAG-GTGGGTGCTCGTTCCCTC P_troglodytes300508 -------ACAGACTCACTTTGCACCTGGCTGCAGC-CTCAT-GGGGGTGCTTTTTCCATG P_troglodytes300534 -------GCAGACTCACTCTGCACCTGACTGTACT-TCCAG-GCAGGTGCTTTTTCTGTC P_pygmaeus300134 -------GCAGACTCACTGTGCACCTGGCTGCAGG-CCCAG-GTGGGTGCTCGTTCCCTC P_pygmaeus300279 -------GCAGACTCACTCTGAACCTGACTGCAAC-CCAGG-ATGGGTGTTTTTTCCTTC P_pygmaeus300325 -------GCAGACTCCCTCAGCATCCAGC---------------GGGTGCTTTTTCAGTC P_pygmaeus300608 -------ACAGACTCACTTTGCACCTGGCTGCAGC-CTCAT-GGGGGTGCTTTTTCCATG P_pygmaeus300763 -------GCAGACTCACTCTGCACCTGACTGTACT-TCCAG-GCGGGTGCTTTTTCTGTC P_pygmaeus300585 -------GCAGACTCACTCTGCACCTGACTGTACT-TCCAG-GCGGGTGCTTTTTCTGTC R_norvegicus300677 GAGAATATCTATGTACTTGTGTCCATTAAGATAGA-ATC---TCAAGTGCTTTTTCCATC R_norvegicus301037 -------GCAGATTCACTCTGCACCTGGCTGTAGC-TCCAG-TCTGGTGCTTTTTCCATC S_araneus300906 -------GCAGACTCACTCTGCACCCTGCTGCATCACCAAGCATGGGTGCTTTTTCTGTC T_nigroviridis300078 -------GCAGGCTCACTCTGTTCCTGGCTGCTCGCTCCAG-CCTGGGACTTTTTTCGCC * C_familiaris300133 TGCCACAGAGACA----TCCCCAAGTGTTGTAACCACCTTGACC--TGTC-A----GGG- C_familiaris300399 TGCCACAGAAACA----TCCCGGGGTGCTGTGACCACCTCGTCC--TGTCAA----GGG- C_porcellus300681 TGCCAGAGAACCA----TTACAGGGAGCTGTGACAACCT-GCCC--AGTCAG----GGGG C_porcellus300708 TGCCAGAGAACCA----CTCCAGGGAGCTGTGACAGCCTTGACC--TGTCAG----GGGG C_porcellus300960 TGCCAGAGAACCA----TTCCAGGGAGCTGTGACAGCCTTGACC--TGTCAG----GGGG D_rerio300209 TGCTACATTAACT-----TGAAGATTGTTACAACCTGCCTTGCC--TGTCAC--TTGGCA D_novemcinctus300250 TGCCAGAGAAACA------CCTGGCCGCCATGTGGGCCTCGACT--TGTCGA----TGG- E_caballus300388 TGCCACAGAAACG----TTCCAGGGTGCTGTGACCACCTTGACC--TGTCAA----GGG- E_europaeus300592 TGCCACAGTAACA----CTCCAGGC-GCTGCAGTCATCTTGACA--TG----------G- G_gorilla300637 TGCCAGTGAG-CA----TTCCATGGTGCTGTGACCATTTTGACC--TCTCTA----GGG- G_gorilla300127 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCTGCCTC-ACG--TATCCA----GGG- G_gorilla300212 TGCAAGAGAAACAAACATTCCAGGGTGCTGTGGCTGCCT-GATC--TAT-AA----AGG- G_gorilla300379 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCCGCCTC-ACG--TATCCA----GGG- G_gorilla300445 TGCCAGAGAAACA----TTCCAGGGTGCTGTGGCTGCCTC-ACC--TATCCA----GGG- G_gorilla300446 TGCCAGGGAAACA----TTCTGGGGCGTTGTGGCTGCCT-GACC--TATCAA----GGG- H_sapiens300648 TGCCAGGGAAACA----TTCTGGGGTGTTGTGGCTGCCT-GACC--TATCAA----GGG- H_sapiens300674 TGCCAGAGAAACA----TTCCAGGGTGCTGTGGCTGCCTC-ACC--TATCCA----GGG- H_sapiens300681 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCCGCCTC-ACG--TATCCA----GAG- M_mulatta300003 TTCCAGAGAAACAAACATTCCAGCGTGCTGTGGCCGCCT-GACT--TAT-AA----GGG- M_mulatta300258 TGCCAGAATAACA----TTCTGGGGTGCTGTGGCCACCT-GACC--TGTCAA----GAC- M_mulatta300299 TGCCAGTGAG-CA----TTCCAGGGTGCTGTGACCATTTTGGCC--TCTCTA----GGG- M_mulatta300533 TGCCAGATAAACA----TTCCAGAGTGCTGTGGCTGCCTC-ACC--TATCCA----GGG- M_mulatta300572 TGCCAGGGAAACA----TTCTGGGGCGTTGTGGCTGCCT-AACC--TATCAA----GGG- M_mulatta300591 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCTGTCTC-ACC--TATCCA----GGG- M_murinus300548 TGTCAGAGAAATA-----TTCCCAGTTCTGTGGCTGCCTCACCT---GTCAA----GGG- M_murinus300559 TGCCAAAGAAATA-----TTCCGGGTGCTGTGGCTGCCT-GACT--TGTCAG----GGG- M_musculus300872 TGCCAAAGAAACA----GTCCAGAATGCTGTGGCTTCCTCTGCC--TATCAG----AGG- M_lucifugus300605 TGCCACAGAAACA----TTCCAGGGCCCTGTGACCGCCCTGACC--AGTCAA----GGG- M_lucifugus300720 TGCCACAGAAACA----GCCCAGGGTACTGTGACC-----------TGTCAA----GGG- M_lucifugus300725 TGCCACAGAAACA----TTCCAGGG-ACTGCGACTACCTTGACC--TGTGCA----GGG- O_anatinus302910 TGCCAGAGAAACT----CCCCGGGCCACTGCT---------------------------- O_cuniculus300202 TGCCAGAGAAACT----TTTCGGGGTACTGTGGCCACTTTGACC--TCTCGG----G--- O_garnettii300495 TGCCAGAGAAATA-----GTCCAGGTGCTGCAGCTGTCTGACCCACTGTCAA----GGG- P_troglodytes300614 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCCGCCTC-ACG--TATCCA----GGG- P_troglodytes300226 TGCCAGTGAG-CA----TTCCATGGTGCTGTGACCATTTTGACC--TCTCTA----GGG- P_troglodytes300353 TGCAAGAGAAACAAACATTCCAGGGTGCTGTGGCTGCCT-GACC--TAT-AA----GGG- P_troglodytes300508 TGCCAGGGAAACA----TTCTGGGGTGTTGTGGCTGCCT-GACC--TATCAA----GGG- P_troglodytes300534 TGCCAGAGAAACA----TTCCAGGGTGCTGTGGCTGCCTC-ACC--TATCCA----GGG- P_pygmaeus300134 TGCAAGAGAAACAAACATTTCAGGGTGCTGTGGCCGCCT-GACC--TAT-AA----GGG- P_pygmaeus300279 TGCCAGAACAACA----TTCTGGGGTGCTGTGGACACCT-GACC--TGTCAA----GAG- P_pygmaeus300325 TGCCAGTGAG-CA----TTCCATGGTGCTGTGACCATTTTGACC--TCTCTA----GGG- P_pygmaeus300608 TGCCAGGGAAACA----TTCTGGGGCGTTGTGGCTGCCT-GACC--TGTCAA----GGG- P_pygmaeus300763 TGCCAGATAAACA----TTCCAGGGTGCTGTGGCCGCCTC-ACC--TATCCA----GGG- P_pygmaeus300585 TGCCAGAGAAACA----TTCCAGGGTGCTGTGGCTGCCTC-ACC--TATCCA----GGG- R_norvegicus300677 TGCCAAAGAAACA----ATCC-GGGTGCTGTGGCTGCCTCCACT--TATCAG----GGG- R_norvegicus301037 TGCCAGAGAAACA----ATCCGGG-TGCTGTGGCTGCCTCTGCC--TGTCAG----GGG- S_araneus300906 TGCCACAGAAACA-----TGCCAGGGACTGGTACTGCTTTGACC--TATCAA----AG-- T_nigroviridis300078 TGCTATAGGAACA-----TGCAGAATGTT-CACTTTTCCACGCT--TACCAACATTAAGC * * C_familiaris300133 -CAGTGCAACCCTC-TGGGGACTCAGGG C_familiaris300399 -TGATACAGCCGTC-TGGGAACACAGGG C_porcellus300681 -CAGTGCAGCTTCT-TGGAATCAAAGAA C_porcellus300708 GCAGTGCAGCTTCT-TGGGGACATAGAA C_porcellus300960 GCAGTGCAGCTTCT-TGGGGACATAGAA D_rerio300209 GGGTGACTGTACCTTCTCAGACATTT-- D_novemcinctus300250 -CACTGCAGCTGGC-CGGGGACAGTGGT E_caballus300388 -CGATGCAGCTGCC-TGGGGACATGGAG E_europaeus300592 -CAATACAGTTGCC-GGGGGACAAGGTG G_gorilla300637 -TGATGCAGCTGCC-TGGGGACACAGAG G_gorilla300127 -TGATGCAGCTCCC-TGGGGACACAGGT G_gorilla300212 -CGATGCAGCTGCC-TGGGGACAGACGG G_gorilla300379 -TGATGCAGCTCCC-TGGGGACACAGGT G_gorilla300445 -CGATGCAGCTCCC-TGGGGACACAGGT G_gorilla300446 -TGATGCAGGTGTC-TGGGGATACAGGA H_sapiens300648 -TGATGCAGCTGTC-TGGGGATACAGGA H_sapiens300674 -CGATGCAGCTCCC-TGGGGACACAGGT H_sapiens300681 -TGATGCAGCTCCC-TGGGGACACAGGT M_mulatta300003 -CAATGCAGCTGCC-TGGAGATAGACAG M_mulatta300258 -TTATGTAGCTGCC-CAGGAACACAGGG M_mulatta300299 -TGATGTAGCTGCC-TGGGGACACAGAG M_mulatta300533 -CGATGCAGCTCCC-TGGGGACACAGGT M_mulatta300572 -TGATGCAACTGTC-TCGGGATACAGGA M_mulatta300591 -CGATGCAGCTCCC-TGGGGACACAGGT M_murinus300548 -CGATGCCACTGCC-TGGGGACTTGGGG M_murinus300559 -CGATGCAGCTGCC-TGGGGACACAGGG M_musculus300872 -CAGTGCAGCTGCC-TGGGGACACAGCC M_lucifugus300605 -TGCTGCCGCTGCC-CGGGGACACGGTT M_lucifugus300720 -TGATGCAGGTGCC-CAGGAACACAGGG M_lucifugus300725 -TGACGCAGCTGCC-CGGGGACATGGTG O_anatinus302910 ---------------------------- O_cuniculus300202 -TGATGCAGCTACC-TGAGGGCACAGGG O_garnettii300495 -CAGTGCAGCTGCC-TGGGGACACGGGT P_troglodytes300614 -TGATGCAGCTCCC-TGGGGACACAGGT P_troglodytes300226 -TGATGCAGCTGCC-TGGGGACACAGAG P_troglodytes300353 -CGACGCAGCTGCC-TGGGGATAGACAG P_troglodytes300508 -TGATGCAGCTGTC-TGGGGATACAGGA P_troglodytes300534 -CGATGCAGCTCCC-TGGGGACACAGGT P_pygmaeus300134 -CGATGCAGCTGCC-TGGGGATAGACAG P_pygmaeus300279 -TGATGTAGCTGCC-CAGGAACATAGGG P_pygmaeus300325 -TGATGCAGCTGCC-TGGGGACACAGAG P_pygmaeus300608 -TGATGCAACTGTC-TGGGGATACAGGA P_pygmaeus300763 -CGATGCAGCTCCC-TGGGGACACGAGG P_pygmaeus300585 -CAATGCAGCTCCC-TGGGGACACAAGT R_norvegicus300677 -CAATACAGCAGCC--GGGGACACAGCC R_norvegicus301037 -CAATACAGCGGCC-TGGGGACACAGCC S_araneus300906 -TGGCGAAGCTGCCATGGGGACACGGGG T_nigroviridis300078 GGTGGGTAATGTGTTCTGCAACATCAGC

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved