snOPY snoRNA Orthological Gene Database

Family: SNORA76

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300174 -----GCGCTGCCTTTGAGC---CCC-CGCCGCGCCTGCGCGTGGCGCCG C_porcellus300606 -----GCGCTGCCTTTGAGC---CCC-CGT-GCGCCTGTGTGTGGCGCCG D_novemcinctus300060 -----GTGCTGCCTTTGAGC---CCACAGTCGCACCTGCACGTGGTGCTG D_novemcinctus300214 -----GCACTGCCTTTGAGA---CCC-TGCCATGCCTGCGCATGGCACTG D_novemcinctus300478 -----GCGCTGCCTTTGAGC---CCC-CGTCGCGCCTGCGCGTGGCGCCG E_telfairi300177 ------CCTCTTCATTGAA-----CC-CGCCGCGCCGGCCTGTGGCGCGG E_telfairi300506 -----GTGCTGCCTTTAAA-----CC-TGCCGCACCTGCCTGTGGCATGG E_telfairi300649 -----GTGCTGCCTTTGAA-----CC-CGCCGCGCCGGCCCGTGGCGCGG E_telfairi300702 ------------------AT---GTT-GTATCGAAATGAATAGATCCTCC E_telfairi300739 -----GCGCTGCCTTTGAA-----CC-CGCTGCGCCGGCCCGTGGCGCAG E_telfairi300832 -----ACGCTGCGTTTGAA-----CC-CGCAATGCCTGCCTGTGACAACT E_caballus300021 -----GTGCTGCCTTTGAGC---CCC-TGCTGCACCTGCACGTGGCGCCG E_caballus300232 -----GCGCTGCCTTTGAGC---CCC-TGCTGCGCCTGCACGTGGCGCCG E_europaeus300566 -----GCGCCGCCTTTGAGC---CCC-CGC--CGCCTGCA-GTGGTGCCG G_gorilla300804 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCCTCCTCGTGGCGCCG G_gorilla300279 TCACATTTTATCAACCAAAT---GAA-TTAGAGAAAAAAGTTCATGCCCA G_gorilla300378 -----GCACTGCTTTAGAGC---CTCTGTGTG--TCTGGCTGTGGCCTCA H_sapiens300082 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCTTCCTCGTGGCGCCG H_sapiens300595 -----AAGATTCGACAGATA---CCC-TACTGCCTCTCTTTGTGGCGGCG M_mulatta300277 ------ACGCTGCCTTTGTA---CAC-CACCGCGCCTCCGCGTGGCGCCT M_mulatta300351 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCCTCCTCGTGGCGCCG M_mulatta300419 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCCTCCTCGTGGCGCCG M_mulatta300619 -----AAGATTCAGCAGTTA---CCC-TACTACCTGTCTTTGTGGCCATG M_murinus300279 -----GCGCTGCCTTTGAGC---CCC-CGTAGCGCCTCCGCGTGGCGCCG M_musculus300033 -----GCGCTGCCTTTGAGC---CCC-CGGCCCACCTTCTCGTGGTGCCG M_musculus300301 -----GTGCTGCCTTTGAGC---CCC-C------------TGTAGTGCCG M_musculus300584 -------GTTGAAAATGAACAACCCGGCGGCGCACCTTCTCCTGGTGCTG M_lucifugus300178 --GTTAAGAATCATGAACCA---CC---ACTGCGCCTGCGCATGGTGCCG M_lucifugus300204 -----ATACTGCCTTTGAGA---CCCC-GCTGCACCTGCTCGTGGCGA-G M_lucifugus300252 -----GCGCTGCCTTTGAGC---CCC-CGCTGCGCCTGCGTGTGGCGCCG M_lucifugus300489 -----GCGCTGCCTTTGAGT---CCC-CGCTGCGCCTGCGTGTGGCGCCG M_lucifugus300544 -----GCGCTGCTGTTGAGC---CCC-CGCTGTGCCTGTGTGTGGTGT-- O_anatinus304392 -----GCACTGTCTTTGAAC---CCATGAAACGCCTCGTCCGTGGCTTGA O_cuniculus300138 -----GCGCTGCCTTTGAGC---CCC-CGTCGCGCCTGCGCGTGGCGCCG O_garnettii300411 -----ACGCTGCCTTTGAAC---CCC-CGC-GCGCTTCCTCGTGGCGCCG O_garnettii300587 -----GCGCTGCCTTTGAGC---CCC-CGCCGCGCTTCCTCGTGGCGCCG O_garnettii300037 -----GCGCTGCCTTTGATT----CCTCGCCGCACCTTCGCGTGGCGTCG O_garnettii300065 -----------AAGACTTAT---TTA-TACTCTTAAAAATTAGGAAATTG P_troglodytes300151 ------GCGCTGCCTTTGTA---CCC-CACCATGCCTCCGCCTGGTGTCT P_troglodytes300468 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCCTCCTCGTGGCGCCG P_troglodytes300693 -----AAGATTCGACAGATA---CCC-TACTGCCTCTCTTTGTGGTGGTG P_pygmaeus300025 ---------------AATAG---GCT-AAAAAAGAAAAATCACATGATCA P_pygmaeus300113 -----GCGCTGTCTTTGAGC---CCC-CGCCGAGCCTCCTCGTGGCGCCG P_pygmaeus300407 ---------------AATAG---GCT-AAAAAAGAAAAATCACATGATCA P_pygmaeus300755 -----AAGATTCAACAGATA---CCC-TACTGCCTCTCTTTGTGGCTGCG R_norvegicus300075 -----GTGCTGCCTTTGAGC---CCC-CGGTGCACCTTCTCGTGGTGTCG R_norvegicus300094 -----GCGCTGTCTTTGAGC---CCC-CGGTAAACCTTCTTGTGGTGCTG R_norvegicus300313 -----GCGCTACCTTTGAGC---CCC-CGGCGCACCTTCTTGTGGTGCTG R_norvegicus300336 -----CCGCCGCCTTTGCGT---CCC-CAGCTCAC-----CGTGGTGCCG R_norvegicus300479 -----ACACTACCTTTGAGC----CCCCGGCGCAACTTCTTGTGGTGCCG R_norvegicus300529 -------------GAAGGGCTGGCCC-CAGCGCACCTCCTCGTGGTGCCA R_norvegicus300571 -----GCGCTGCCTTTGAGC---CCC-CGGCGCACCTTCTCGTGGTGCCG R_norvegicus301021 -----GCGCTGCCTGTGAGC---CC--TGGCGCACCTTCTCCTGGTGCTG R_norvegicus300223 -----GTGCTGCCTTTGAGC---CTC-CGACACACCTTCCCATGGTGCCG S_araneus300394 -----GCGCTGCTTTTGAGC---CCC-CG--GCGCCTGCACGTGGCCCCG S_araneus300040 -----GCGCTGCCTTTGAGC---CCC-CG--GCGCCTGCGCGTGGCCCCG S_tridecemlineatus300049 -------------------------G-GGCTGCACCTGCACGTGGCGCCA T_nigroviridis300107 -----GCACTGTCTTTGAAC---C--TGACTGGTCCCATCAGTGACCTCT T_belangeri300050 -----GCGCTGCCTTTGAGC---CCC-CGCCGCGCCTGCGCGTGGCGCCG C_familiaris300174 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--GCG--CTT---GCG C_porcellus300606 GGGG---TCAAGCTGCGG-----CGCCAGAGAAG--GTG--CTC---GCG D_novemcinctus300060 GGGG---TTAAGCTGCAG-----CACCATAGCAC--GTG--CTT---GCA D_novemcinctus300214 GGGG---TTAAGCTGCAG-----TGCCAGAGTAT--GTG--CTT---GCG D_novemcinctus300478 GGGG---TTAAGCTGCAG-----CGCCAGAGCAC--GTG--CTT---GCG E_telfairi300177 GGG----TTAAGCTGCAG-----CGCCAGAGCAA--GTG--CTG---GCG E_telfairi300506 GGGG---TTAAGCTGCAG-----CGTCAGAGCAA--GTG--CTG---ACG E_telfairi300649 GGGG---TTAAGCTGCAG-----CGCCAGAGCAA--GTG--CTG---GCG E_telfairi300702 AGAG---TTAAGCTGCAG-----TGCCAGAGCAA--GTG--CTC---ATG E_telfairi300739 GGGG---TTAAGCTGCAG-----CGCCAGAGCAG--GTG--CTG---GCA E_telfairi300832 GGGG---TTAAGCTGCAG-----CACCTGAGCAG--GTG--CTG---GCA E_caballus300021 GGGG---TCAGGCTGCG--------CCAGAGCAC--GCG--CTT---ACG E_caballus300232 GGGG---TCAGGCTGCGG-----CGCCAGAGTAC--GCG--CTT---GCG E_europaeus300566 GGGG---TCAGGCTGCGG-----CGCCAGAGCAG--CCG--CTC---GTG G_gorilla300804 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG G_gorilla300279 GGGG---TGAGGCTACAG-----TGCCAGAACAC--TTG--CTT---GTG G_gorilla300378 GGGG---TCTAGCAGCAG-----TGCTAGAGCAGAC-CCAGCTT---GT- H_sapiens300082 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG H_sapiens300595 GGGC---TCAGGCTGCAG-----CACCACAGCACT-GTG--TGT---GTG M_mulatta300277 GGGG---TCAGGCTGCAGCA--GCGCCAGAGCAC--ATG--CTT---GCG M_mulatta300351 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG M_mulatta300419 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG M_mulatta300619 GGGC---TCAGGCTGCAG-----CACCACAGCACT-GTG--TGC---GT- M_murinus300279 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--GGG--CTC---GCG M_musculus300033 GGG---GTTAAGCTGCGG-----CGCCATAACACT-CTG--CTA---GCG M_musculus300301 GGG---ATTAAGCTGCGG-----CGCCATAGCACT-TTG--CAG---GCG M_musculus300584 GGG---CTTAAGCTGTGG-----CGCCACAGCACA-TTG--CAG---GTG M_lucifugus300178 GGGT---TCAGGCTGCAG-----CACCAGAGCAC--ATG--CTT---GCG M_lucifugus300204 GGAG---TCAGGCTGCAG-----CGCCAGAGCAC--GTG--CTT---GGA M_lucifugus300252 GGGG---TCAGGCTGCAG-----CGCCAGAGCAG--CTG--CTT---GCG M_lucifugus300489 GGGGG-GTCAGGCTGCAG-----CACCAGAGCAG--TTG--CTT---GTG M_lucifugus300544 GGGT---TCAGACTGCAG-----CACCAGAGCAC--ATG--CTT---GTG O_anatinus304392 TGGG---CTACGCAGCGG-----TGCAAAATTA----TGAGCTT---GTT O_cuniculus300138 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--GAG--CTC---GCC O_garnettii300411 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--AGG--CTT---GCA O_garnettii300587 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--AAG--CTT---GCG O_garnettii300037 GGGG---TCGGGCTGTAG-----CGCCAGAGCAT--GTG--CTC---GGG O_garnettii300065 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--AAG--CTT---GCG P_troglodytes300151 GGGG---TCAGGTTGCAGC-----GCCAGAGCAC--GTG--CTT---GCG P_troglodytes300468 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG P_troglodytes300693 GGGC---TCAGGCTGCAG-----CACCACAGCACT-GTG--TGT---GTG P_pygmaeus300025 CGTC---AAGAGATGCAGAAAAACGCTAGAGCAT--GTG--CTT---GCG P_pygmaeus300113 GGGG---TCAATCTGCAG-----CGCTAGAGCAT--GTG--CTT---GCG P_pygmaeus300407 CGTC---AAGAGATGCAGAAAAACGCTAGAGCAT--GTG--CTT---GCG P_pygmaeus300755 GGGC---TCAGGCTGCAG-----CACCACAGCACT-GTG--TGT---GTG R_norvegicus300075 TGG---GTTAAGCTGTGA-----CGCTATAGCACT-TTG--CTG---G-- R_norvegicus300094 GGG---GTTAAGCTTCAG-----TGCTATAGCATT-TTG--CTG---GCG R_norvegicus300313 GGGGTTATTAAGATGCCG-----TGCTATAGCACT-TTG--CTG---GCA R_norvegicus300336 GG----ATTAAGCTGAGG-----CGCCATAGCACT-TTA--CTG---GCG R_norvegicus300479 GGGG---TTAGGCTGTGG-----TGCTATAGCACT-TTG--CTG---GCA R_norvegicus300529 GGG---TTTAAGCTGCGG-----TGCTTTAGCACT-TTG--CTG---GTG R_norvegicus300571 GGG---GTTAAGCTGCAG-----CGCTATAGCATT-TTG--CTG---GCG R_norvegicus301021 GGG---GTCAGGCTGGGG-----AGCTGGCGCATA-ACGGGCAGTCTGCC R_norvegicus300223 GGG---GTTAAGTTACAG-----CGCTATAGCACT-TTG--CTG---GAG S_araneus300394 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--GGG--CTC---GCG S_araneus300040 GGGG---TCAGGCTGCAG-----CGCCAGAGCAC--GGG--CTC---GCG S_tridecemlineatus300049 GGGG---TCAGGCTGCAG-----CGCCAGAGGAC--ATG--CTC---ACA T_nigroviridis300107 CAGG---CCAAGCTACAG-----TGCTAAATGAAACTTGGACTT---GTT T_belangeri300050 GGGG---CCAGGCTGCAG-----CGCCAGAGCAC--ATG--CTT---GTG * C_familiaris300174 CATAA---------CTGGGGCCGCCCGGTTCCCCC---------GCCGGC C_porcellus300606 CATAA---------CTGGGGCCGCCTG--CCGTTC---------GCCGAC D_novemcinctus300060 CATAA---------CTGGGGCTGC-------------------------- D_novemcinctus300214 CA-AA---------CTGGGGCCACCTGACC---CT---------ATGGGT D_novemcinctus300478 CATAA---------CTGGGGCCGCCCGACC---GT---------ACGGGC E_telfairi300177 CATAA---------CTGGGGCCGCCAAGCCT--CT---------GCGGGC E_telfairi300506 CATAA---------CTGGGGCTGCCAAGCC-------------------- E_telfairi300649 CATAA---------CTGGGGCCGCCAAGCCT--CT---------GCGGGC E_telfairi300702 CATAA---------ATGGGGCCACCAAGGCTCT-----------GCAGGT E_telfairi300739 CATAA---------CTGGGGCCACCAAGCCT--CT---------GCGGGC E_telfairi300832 CATAA---------CTGGGGCCGCCAAGCCT--CT---------GCAGGA E_caballus300021 CACGA---------CTGGGGCCGCCTG--CTGCTC---------GCCGGC E_caballus300232 CATAA---------CTGGGGCCGCCTC--CCGCTC---------GCCGGC E_europaeus300566 -ATAA---------CTGGGGCTC----CGCGC--T---------GCCGGC G_gorilla300804 CATAA---------CTGGGGCCGCCTGGCTCC-CC---------GCGGGC G_gorilla300279 CATAA---------TTAAGGCCACTTGCCCTCT-----------TCAGGT G_gorilla300378 CAGAT---------CCGGGGCTGCTTAGAGGCCA---------CCTAAGT H_sapiens300082 CATAA---------CTGGGGCCGCCTGGCCTC-CC---------GCGGGC H_sapiens300595 TATAA---------CTGGGGCCACCTGCCCCTTCC---------AAGTGT M_mulatta300277 TATAA---------CTGGGGCCACCTGGCCCCCT----------GCGGAT M_mulatta300351 CATAA---------CTGGGGCCGCTTGGCCCC-CC---------GCGGGC M_mulatta300419 CATAA---------CTGGGGCCGCTTGGCCCC-CC---------GCGGGC M_mulatta300619 -ATAA---------CTGGGGCCACCTGCCCCCTCC---------AAGTGT M_murinus300279 CATAA---------CTGGGGCCGCCTGCCTCCTCC---------GCGGGC M_musculus300033 CATAA---------CTGGGGCCGCCTGCCCTTCGC-----------GGGC M_musculus300301 CATAA---------CTGGGGCCGCCTGTCTTTCCC-----------AGGC M_musculus300584 CATGA---------CTGGGGCTGTCTGCCCTTCGC-----------AGGC M_lucifugus300178 CATAA---------CTGGGGCCAACCGCTCTCC------------ACTGG M_lucifugus300204 CGTAA---------CTGCGGCCACG------------------------- M_lucifugus300252 CATAA---------CTGGGGCCTACGGCGCTC--T---------GCCGGC M_lucifugus300489 CATAA---------CTGGGGCCTACGGCTCTT--T---------GCCCGC M_lucifugus300544 CATAA---------TGGGGGCCGACTGCTCCC--C---------ACCAGT O_anatinus304392 TATAA---------CTGGGGCTGCTTGGT--CAAA--------CCCAAGT O_cuniculus300138 CATAA---------CTGGGGCCGCCTG--TACCTC---------GCAGGC O_garnettii300411 TATAA---------CTGGGGCCGCCTGCCTTCTTC---------ACGGGC O_garnettii300587 TATAA---------CTGGGGCCGCCTGCCTTCTCC---------GCGGGC O_garnettii300037 CATAA---------CTGGGGCCGCCTAAACCCCTA----------AGGGC O_garnettii300065 TATAA---------CTGGGGCCGCCGGCCTTCTCC---------GCGGGC P_troglodytes300151 CATAA---------ATGGGGCAGCCTGGCCCCCT----------GCGGAT P_troglodytes300468 CATAA---------CTGGGGCCGCCTGGCCCC-CC---------GCGGGC P_troglodytes300693 TATAA---------CTGGGGCCACCTGCCCCTTCC---------AAGTGT P_pygmaeus300025 CATAA---------CTGGGGCCGCCTGGCCCCCC----------GCGGGC P_pygmaeus300113 CATAA---------CTGGGGCCGCCTGGCCCC-CC---------GCGGGC P_pygmaeus300407 CATAA---------CTGGGGCCGCCTGGCCCCCC----------GCGGGC P_pygmaeus300755 TATAA---------CTGGGGCCACCTGCCCCTTCC---------AAGTGT R_norvegicus300075 ------------------GACCGCCTGCCTATCG-----------AGGGC R_norvegicus300094 CATAA---------CTGGGGCCGCCTGCCTATCGCGGCTAAGGCTAAGGC R_norvegicus300313 CATAA---------CTGGGGCCACCTGCCTATCAC-----------AGGC R_norvegicus300336 CATAA---------CTGGGGCCGCCTGCCCTTTGC-----------GGGC R_norvegicus300479 CATAA---------CTGGGGCTGCCTGCCCTT------------------ R_norvegicus300529 CATAA---------CTGGGGCCGCCTGCCTATCGC-----------AGGC R_norvegicus300571 CATAA---------CTGGGGCCGCCTGCCTATCGC-----------GGGC R_norvegicus301021 CATCATGGGTGGCCCTGGGGCTGTCTGCCCGTTGC-----------AGGT R_norvegicus300223 CATAA---------CTGGG-CAGCCTACCTTTCGC-----------AGGC S_araneus300394 CATAA---------CTGGGGCCGCCAGCCCCCCTC---------GCCGGC S_araneus300040 CATAA---------CTGGGGCCGCCAGCCCCCCTC---------GCCGGC S_tridecemlineatus300049 CATAA---------CTGGGGCCACCTGTTTT-------------GATGGC T_nigroviridis300107 CATAA---------CTGGGGCAACCTGGCAACAAT--------CCCAAGT T_belangeri300050 CATAA---------CTGGGGCCGTCTGTCCCTAAC---------GCGGGC * * C_familiaris300174 GGCCCTTTTAACCGCGAGCGACACGG C_porcellus300606 GGCCCTTTTAACCGCGAGCTACACGG D_novemcinctus300060 ------TTTAACTGCCAGCAACAAGA D_novemcinctus300214 GGTGACTTTAACTGTGAGTGATAGGA D_novemcinctus300478 GGCGCCTTTAACCGCGAGCGACAAGC E_telfairi300177 GGCCCTTTTAACCGCGAGCGACACGG E_telfairi300506 ----CTTTTAACCGTGAGTGACACGG E_telfairi300649 GGCCCTTTTAACCGCCAGCGACACGG E_telfairi300702 GGCCCTTTTAACCAAGAGCAACATGG E_telfairi300739 GGCCCTTTTAACCGCGAGCGACATGG E_telfairi300832 GGCCCTTTTAACTGAGAG-GACACTG E_caballus300021 AGCCCTTTTAACCGCTAGCGACAAGG E_caballus300232 GGCCCTTTTAACCGCGAGCGACAAGG E_europaeus300566 CGCCCTTTTAGCCACAAGCCACATGG G_gorilla300804 GGCCCTTTTAACCGCGAGCGACAACA G_gorilla300279 AGCCCTTTTAACTGGGAGCAAAGTGA G_gorilla300378 GATTCCTTTGGCAGCAAGCAACATTC H_sapiens300082 GGCCTTTTTAACCGCGAGCGACAAGA H_sapiens300595 GGGCCTTTTAACCTCTATCGACAGGT M_mulatta300277 AGTCCTTTTAACAAGGAGATGG---- M_mulatta300351 GGCCCTTTTAACCGCGAGCGACAATT M_mulatta300419 GGCCCTTTTAACCGCGAGCGACAATT M_mulatta300619 GGGCCTTTTAACCTCTGTCTACAGGT M_murinus300279 GGCCCTTTTAACCGCGAGCGACACAG M_musculus300033 GGCCCTTTTAACCGCTAGCTACAGGC M_musculus300301 GGCCCTTTTAAC--CTAGCTACAGGC M_musculus300584 GGCCCTTTTAACTGCCAGCTACAGAC M_lucifugus300178 CGGCCTTTCAAGCAAGAGCAACAGGG M_lucifugus300204 GCTCCTTTTAACCGCAAGCAGCACTG M_lucifugus300252 GGCCCTTTTAACCGCGAGCGACACGG M_lucifugus300489 GACCCTTTTAACCCGGAGCGACAGGA M_lucifugus300544 GGCCTTTTTAGCCCTGAGCTACGTGG O_anatinus304392 GGCTCTTTTAAGAACAAGTGACATTT O_cuniculus300138 CGCCCTTTTAACCGCGAGCGACAGGG O_garnettii300411 GGCCCTTTTAACCACCAGCGACGCGG O_garnettii300587 GGCCCTTTTAACCGCGAGCGACACGG O_garnettii300037 GGCCCTTTTAACCACGAGCAACATGA O_garnettii300065 GGCCCTTTTAACCGCAAGCGACATGG P_troglodytes300151 GGTCCTTTTAACCGCGAGCAACAAGG P_troglodytes300468 GGCCTTTTTAACCGCGAGCGACAAGA P_troglodytes300693 GGGCCTTTTAACCTCTATCGACAGGT P_pygmaeus300025 GGCCCTTTTAACCGCGAGCGACAATA P_pygmaeus300113 GGCCCTTTTAACCGCGAGCGACAATA P_pygmaeus300407 GGCCCTTTTAACCGCGAGCGACAATA P_pygmaeus300755 GGGCCTTTTAACCTCTGTCGACAGGT R_norvegicus300075 GGCCTTTTTAACCGTTAGCTACAGGC R_norvegicus300094 CGCCCTTTTAACCACTAGCTACAGGC R_norvegicus300313 AGCCCTTTTAATTGCTAGCTACAGGC R_norvegicus300336 GGCCCTTTTAACTGCTAGCTACAGGC R_norvegicus300479 --CTCCCCGAGCTGAAATG------- R_norvegicus300529 AGCCCTTTTAACTGCTAGCTACAGGC R_norvegicus300571 GGCCCTTTTAACCGCTAGCTACAGGC R_norvegicus301021 GGCCCTTTTAACTGCTAGTTACAGGC R_norvegicus300223 CGTCCCTTTAACTGCTAGCTACAGGC S_araneus300394 GGCTCTTTTAACCGCGAGCGACACGC S_araneus300040 GGCCCTTTTAACCGCGAGCGACACGC S_tridecemlineatus300049 AGCCCTTTGAACTGTGAGCTACATAG T_nigroviridis300107 TGCTCTTTTAAAAGCAAGTCATAGCT T_belangeri300050 GGTCCTTTTAAACGCAAGCTACATGG

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved