snOPY snoRNA Orthological Gene Database

Family: SNORA75

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300371 ---------ATCTTCTCATTGAGCTCCTTTC--TGTCAA----TTGGTGG D_rerio300157 ---------CGCTTCTCA-TGAGCTCCTCTC--CGTCAG---TCCAGTGG D_rerio300158 ---------CGCTTCTCA-TGAGCTCCTCTC--CGTCAG---TCCAGTGG D_novemcinctus300567 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCAG----TTGGTGG E_telfairi300127 ---------CTCTTCTCAGTGAGCTCCTTTC--TGCCAC-----TGGTGG E_telfairi300751 ---------CTCTTCTCAATGAGCTCCTTTC--TGCCGC-----TGGTGG E_caballus300239 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCAA----TTGGTGG E_europaeus300133 ---------GTCTTTTCATTGAGCACCTTTC--TCTTGA----TTGGTGG E_europaeus300582 ---------ATCTTCTCATTGAGCTCCTTTC--TGTCAG----CCAGTGG G_gallus300107 ---------CACTTCTCAATGAGCTCCTTCC--TGCCGACATATCCGTGG H_sapiens300508 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCTA----TCAGTGG M_mulatta300059 ----------------GGCAATTAACACCAC--TACAGA----TTGGTGG M_mulatta300175 ---------GACTTCTCACTGAGCTTCTTTC--TGTCTG----TTGGTGG M_mulatta300196 ---------GTCTTCTTACTGCGCTCCTTTC--TATCTA----CTGGTCG M_mulatta300244 --------------------ATCTCATACTT--ATCAGA----AT-ATAG M_mulatta300399 ------------GCCTTATTAAGATGTAATT--GACA---------AAAA M_mulatta300420 ----------------GGCAATTAACACCAC--TACAGA----TTGGTGG M_mulatta300424 ---------GGCTTCTCATTGAGCTCCTTTC--TGTCCA----TTGGTGG M_mulatta300523 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCTA----TCAGTGG M_murinus300347 ---------GTCTTCTGATTGGGTTCCTTTC--TGTTTC----TTGGTGG M_murinus300419 ---------GTCTTCTCATTGAGCTCCGTTC--TGTCTC----TTGGTGG M_domestica300101 ---------GTCTTCTCAATGAGCTCCTTCC--CGTCT----ATCAGTGA M_musculus300013 ---------GTCTTTTCACTGAGCCCCTTTC--TGTCAA----CCGGTGG M_musculus300788 ---------ATCTTCTCATTGAGCTCCTTTC--TGTCCA----TCAGTGA M_musculus300811 ---------ATCTTCTCATTGAACCCCTTTC--TGTCAA----CCAGTGA O_anatinus303497 ---------TCCTTCTCAATGAGCTCCTTCC--TGCCAG----ACAGTGG O_cuniculus300168 ---------GTCTTCTCACTGAGCTCCTTTC--TATTGA----TTGGTGG O_latipes300072 ---------ACCTTCTCA-TGAGCTCCTCTC--AATCGC---ATCCATGA O_garnettii300190 ---------GACTTCTCATTGAGCTTCTTTC--TGTCTC----TGGGTAG O_garnettii300515 -----------------------CACTTTTC--AGCAGA----AC-ATAC O_garnettii300516 ---------GTTTTCACATTGAGTGCCTTTC--TATTTC----CTGGTGG O_garnettii300544 ACTTTCCCCCCAGCTTTATTAAGTTTTAAAT--GACAGA----TA-AAAA O_garnettii300578 ---------GTCTCCTCAGTGAGCTCCACTCACTGTTTC----TTGGTGG P_troglodytes300015 ------------------CAATTAAAATGAC--TACAGA----TTGGTGG P_troglodytes300033 ---------------GGCCAATCTCATACTT--ATCAGA----AT-ATAG P_troglodytes300099 ------------------CAATTAAAATGAC--TACAGA----TTGGTGG P_troglodytes300153 ---------GACTTCTCACTGAGCTTCTTTC--TGTCTG----TTGGTGG P_troglodytes300227 ------------------CAATTAAAATGAC--TACAGA----TTGGTGG P_troglodytes300388 ---------GTATTCTTATTGAGCTCCTTTC--TGTCTA----CTGGTGG P_troglodytes300454 ---------GGCTTCTCATTGAGCTCCTTTC--TGTCCA----TTGGTGG P_troglodytes300642 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCTA----TCAGTGG P_pygmaeus300016 ---------GACTTCTCACTGAGCTTCTTTC--TGTCTG----TTGGTGG P_pygmaeus300255 ------------------CAATTAAAATGAC--TACAGA----TTGGTGG P_pygmaeus300257 ------------------CAATTAAAATGAC--TACAGA----TTGGTGG P_pygmaeus300272 ---------------GGCCAATCTCATACTT--ATCAGA----AT-ATAG P_pygmaeus300331 ---------------GGCCAATCTCATACTT--ATCAGA----AT-ATAG P_pygmaeus300443 ---------GGCTTCTCATTGAGCTCCTTTC--TGTCCA----TCGGTGG P_pygmaeus300521 ---------------TTATTGGGCTCCTTTC--TGTCTA----CTGGTAG P_pygmaeus300696 ---------GTCTTCTCATTGAGCTCCTTTC--TGTCTG----TCAGTGG R_norvegicus300854 ---------ATCTTCTCATTGAGCTCCTTTC--TGTCAA----CCAGTGA S_araneus300121 ---------CTCTTCTCAGTGAGTTCTTTTC--TAT-AA----CTGGTGG S_tridecemlineatus300003 ---------ATCTTCTCATTGAGCTCCTTTC--TGCCAA----CTGGTGG T_nigroviridis300014 ---------CTCTTCTCA-TGAGCACCACTC--TGTCTA---AC-GGTGA X_tropicalis300112 ---------ATCTTCCCATTGAGCTCTTTCC--TGCCGGCA-ATTTATGG C_familiaris300371 CAGTTTATGGATTCGCACGAGAAGAAGAGACAATTCACAG---TTAGCAT D_rerio300157 CGGTGTATGGATTCGCACGAGAAG-----TAGAGTCAAAATCACAGTTA- D_rerio300158 CGGTGTATGGATTCGCACGAGAAG-----TAGAGTCAAAATCACAGTTA- D_novemcinctus300567 CAGTTTATGGATTCGCACGAGAAG-----AAGAGACAATCNNNNNNNNNN E_telfairi300127 CAGTTCTTGGATTCGCACGAGAAGAAGAGCCAGATTCCCAGGCG-AGCCC E_telfairi300751 CAGCTGTTGGATTCGCACGAGAAGAAGAGCCAGAGTCCCAGGCG-AGCCC E_caballus300239 CAGTTTATGGATTCGCACGAGAAGAAGAGACAATTCACAGAACT-AGCAT E_europaeus300133 CAGTGTATGGATTCATGTGAA-A-AA---AAAATTCAGAGAATG-AGCAT E_europaeus300582 CAGTTTAAGGATTCGCACGAGAAGAAGAGGAAATTCACATAACT-AGCTC G_gallus300107 CAGCCTATGGATTCGCATGAGAAGGA---CATAAACAGCTCAGTAGTGGC H_sapiens300508 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGAACT-AGCAT M_mulatta300059 CAATTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC M_mulatta300175 AAGCTTATAGATTCATGTGAGCAGAG---AAAATTCATAGAACT-AGCAT M_mulatta300196 CAGTTTATGGATTTGCACAAGAAGAG------------AAAACT-AGCGC M_mulatta300244 AGGGAAATGCATTCACACTAGAAGAC---AGAATTCACAGAAGT-AGCAT M_mulatta300399 CAGTATATAGATTCACATGAGAAGAAAAAACAATTCACAAAACT-AGCAT M_mulatta300420 CAATTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC M_mulatta300424 CAGTTGAGGTATTTGCATGAGAAGAAGAGAGAATTCACAGAACT-AGCAT M_mulatta300523 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGCACT-AGCAT M_murinus300347 CAGTTTATAGATTTGCATGAGAAGAA-------GTCACGGAACT-AGCAT M_murinus300419 CAGTTTATGGATTCGCACGAGAAGAAG-AAGAATTCACAGAACTTAGCAT M_domestica300101 TGGGCTGTGGATTCGCACGAGAAG-----AAAATTCACTTCACT--CCA- M_musculus300013 CAGATTATGGATTCGCAC---AAGAGGAGAGAGGTCACAGAGCT-AGCAC M_musculus300788 TAGATTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGAACT-GGCAC M_musculus300811 TAGATTATGGATTCGCACGAGAAGAAGAGAA--TTCACAGAACT-GGCAC O_anatinus303497 CAGCCTATGGATTCGCATGAGAAGAA-AATGAACATCCCAGT-----TCC O_cuniculus300168 CATT-TATGGATTTGCATGAG-ACAA---GAAATTCACAGAATT-AGCAT O_latipes300072 TTCTGTACGGATTCGCACGAGAAG-----CAGAGCCAGTGCACAGATCAA O_garnettii300190 CAGTTCATGGATTTGCACAAGAAGAA-------TTCACAGGACT-AGCAT O_garnettii300515 ATGGCACTGGATTCACATGAGAAGAAGAGAGAATTTACAGAACT-ACCAT O_garnettii300516 CAGTTTATAGATTTGCATGAGAAGAA-------TTCACAGAACT-AGCAT O_garnettii300544 CTGTATAAAGATTTATATGAGAAAAAGAGACAATTCACAGAATT-AGAAT O_garnettii300578 CAGTTTATGGATTCTCATGAGAATAA-------TTCACAGAACT-AGCAT P_troglodytes300015 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300033 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_troglodytes300099 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300153 CAGCTTATGGATTCATATGAGCAGAG---AGAAT-CACAGAACT-AGCAT P_troglodytes300227 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300388 CAGTCTATGGATTTGCACAAGA---G------------AAAACT-AGCGC P_troglodytes300454 CAGTTGATGGATTTGCATGAGAAGAAGAGAGAATTCACAGAACT-AGCAT P_troglodytes300642 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGAACT-AGCAT P_pygmaeus300016 CAGCTTATGGATTCATATGAGCAGAG-----AAT-CACAGAACT-AGCAT P_pygmaeus300255 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC P_pygmaeus300257 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC P_pygmaeus300272 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_pygmaeus300331 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_pygmaeus300443 CAGTTGATGGATTTGCATGAGAAGA---GAGAATTCACAGAACT-AGCAT P_pygmaeus300521 CAGTCTATGGATTTGCACAAGA---G------------AAAACT-AGCGC P_pygmaeus300696 CAGTTTATGGATTCGCACGAGAAGAAGAGAAAATTCACAGAACT-AGCAT R_norvegicus300854 CAGATTATGGATTCGCACGAGAAGAAGAGAAAGTTCACAGAACT-AGCAC S_araneus300121 CCCATTATGGATTCACATAGGAAGAAGAGACAACTCACAGAGCT-AGCAT S_tridecemlineatus300003 CAGTTTATGGATTCGCACGAGAAGAAGAGACATTTCACAGAAC--AGCAT T_nigroviridis300014 CAGTGAATGGATTCGCAAGAGAAG-----TAGAG-CAAAGTGACATTTAC X_tropicalis300112 CAGTAGATGGATTCGCACGGGAAG-----AATATTAAAGGCACTTGCGA- *** C_familiaris300371 T-ATTTTACCTTCTGTCTTCACAGAGG-----TATATGTTGCTGTT--TT D_rerio300157 ATCAGGTGTT--CTCAGTGTTTTGGGAC-----GC-ACCGAT-GTCTGAT D_rerio300158 ATCAGGTGTT--CTCAGTGTT------------GC-ACCGAT-GTCTGAT D_novemcinctus300567 NNNNNNNNNNNNNNNNNNNNN----------------------------- E_telfairi300127 C---GTGAGCCTCCCTTCTGCCAATGGG--GGTTAGTTCCACT--GC-CT E_telfairi300751 T---GTGAGCTTCCCTTCTGCCAGTGGG--GGTTAGTTCCGCT--GC-CT E_caballus300239 T-ATTTTGCCTTCTGTCTTCGCGGAGG-----TGTATTCTGCTGTT--TT E_europaeus300133 T-CTTTTGCTTCCTGTCTTCACAGAAG-----TGTAGTCTGCTATT--TT E_europaeus300582 T-------TTTTTGGCCTCTTCTGAGG-----CACATTTTGCTGTT---T G_gallus300107 A-CACTCACAACCTGGTTATACATCAGT----TGTGATTAACCACTTACT H_sapiens300508 T-ATTTTACCTTCTGTCTTTACAGAGG-----TATATTTAGCTGTA--TT M_mulatta300059 T-ATTTTACGCTCTGTCTTTACAGATG-----TGCATCTGGCTGTT--TT M_mulatta300175 TACTTTTGCCTTCTGTCTTTACAGGAG-----TATATTTGGCTGTT--TT M_mulatta300196 T-ATTTTGCCTTCTGTCTTTAAAGAGG-----TATATTTGACTGTT--TT M_mulatta300244 T----TCACCTTTTGTCTTTACAGAAG-----TATATTTGGCTGTT--TT M_mulatta300399 T-GTTTTACTT-CTGTCCTTACAGAGA-----TATGTTTGACTGTT--TG M_mulatta300420 T-ATTTTACGCTCTGTCTTTACAGATG-----TGCATCTGGCTGTT--TT M_mulatta300424 T-ATTTTACTTTCTGTCTTTACAGAGG-----TATATTTGGCTGTT--TT M_mulatta300523 T-ATTTTACCTTCTGTCTTTACAGAGG-----TATATTTAGCTGTT--TT M_murinus300347 T-ATTTTGCCTTCTGTCTTT-ATGGAG-----TATATTTGGCTATT--TT M_murinus300419 T-ATTTTACCTTCTTTTTTTTATGGAGG----TATATTTGGCTGTT--TT M_domestica300101 --CATGTAGTGTT--CCTGTTGTCACGG----GGATGCTCAAGTGTGGCT M_musculus300013 T----TA-TCTTCTGTTTTTGCAGAGG-----TATATTTGGTTGTT--GT M_musculus300788 T----TA-TCTTCTGTTTTTGCAGAAG-----TATATTTGGCTGTT--GT M_musculus300811 T----TA-TCTTCTGTTTTTGCAGAAG-----TATATTTGGCTGTT--GT O_anatinus303497 T---GGCACTTTTACCTCTGTTTCTAGAT-GGTTTGTTCTGCCAGGG-CT O_cuniculus300168 T-ATTTTACCTTCTGTCTTTACAGT-G-----TATATGTGATGGTT--TT O_latipes300072 AACAGGCTCGCCCTACATGCTTATGGGT-----GTTGCCCAT-GTCTGCT O_garnettii300190 T-ATTTTACCTTTTTGCTTT-ACAGAGG----TACATCTGGCTATT--TT O_garnettii300515 T-ATTTTACCTTCTGTCTCTACAGTGG-----TAT-CTTGGCTGCT--CT O_garnettii300516 T-ATTTAA---TCTGTCTTT-GTGGAAA----TATATTTGGCTGTT--CT O_garnettii300544 T-ATTTTATTTTCTGTCTTTACAGAGG-----TATGTTTGGCTGGT--TT O_garnettii300578 T-ATTTTACTTTCTTTCTTT-ATGTAGG----CATATTTGGCTATT--TT P_troglodytes300015 T-ATTTTACCCTCTGTCTTTACAGAGG-----TGTATTTGGCTGTT--TT P_troglodytes300033 T----TCACCTTTTGCCTTTACAGAAG-----TATATTTGGCTGTT--TT P_troglodytes300099 T-ATTTTACCCTCTGTCTTTACAGAGG-----TGTATTTGGCTGTT--TT P_troglodytes300153 TACTTTTG-------TCTTTACAGGAG-----TATATTTGGCTGTC--TT P_troglodytes300227 T-ATTTTACCCTCTGTCTTTACAGAGG-----TGTATTTGGCTGTT--TT P_troglodytes300388 T-ATTTTACCTTCTGTCTTTAAACAGAAGGTTTAAATTTGACTGTT--TT P_troglodytes300454 T-ATTTTACTTTCTGTCTTTACAGAGG-----TATATTTGGCTGTT--TT P_troglodytes300642 T-ATTTTACCTTCTGTCTTTACAGAGG-----TATATTTAGCTGTA--TT P_pygmaeus300016 TACTTTTGCCTTCTGTCTTTACAGGAG-----TATATTTGGCTATC--TT P_pygmaeus300255 T-ATTTCACCCTCTGTCTTTACAGAGG-----TGTATTTGGCTGTT--TT P_pygmaeus300257 T-ATTTCACCCTCTGTCTTTACAGAGG-----TGTATTTGGCTGTT--TT P_pygmaeus300272 T----TCACCTTTTGTCTTTACAGAAG-----TATATTTGGCTGTT--TT P_pygmaeus300331 T----TCACCTTTTGTCTTTACAGAAG-----TATATTTGGCTGTT--TT P_pygmaeus300443 T-ATTTTACTTTCTGTCTTTACAGAGG-----TATATTTGGCTGTT--TT P_pygmaeus300521 T-ATTTTACCTTCTGTCTTTAAACAGG-----TATATTTGACCGTT--TT P_pygmaeus300696 T-ATTTTACCTTCTGTCTTTAC-GGGG-----TATATTTAGCTGTT--TT R_norvegicus300854 T----TAATCTTCTGTTTTTGCAGGAGA----TCTATTTGGCTGTTATGT S_araneus300121 G----CACTTATTTCTGTCTTTGGAAG-----ACTACTTTACTATT--TT S_tridecemlineatus300003 T-ACTTTACCTTCTGTTTCTACTGAGGT---GTGTATCTGGTTGTT--CT T_nigroviridis300014 ACAAGGCATTTACCTAGTGGT-----AG-----GT-GCCCAT-GTCCAAT X_tropicalis300112 --CCTGTATCTCTTGCCTCTAAATAAAC----TGGCATGAAATGGTCTCT C_familiaris300371 GTGAGACATCT D_rerio300157 GTGAGACACTT D_rerio300158 GTGAGACACTT D_novemcinctus300567 ----------- E_telfairi300127 GTGAGACATTT E_telfairi300751 GTGAGACATTT E_caballus300239 GTGAGACATTC E_europaeus300133 ATGAGACAATG E_europaeus300582 GTGAGACATGG G_gallus300107 GTTCTACAAGT H_sapiens300508 GTGAGACATTC M_mulatta300059 GTCAGACATTC M_mulatta300175 GGGAGATATTG M_mulatta300196 GTGAGAAATTC M_mulatta300244 GTGAGACATTC M_mulatta300399 GTGAGACATTC M_mulatta300420 GTCAGACATTC M_mulatta300424 GTGAGACATTC M_mulatta300523 GTGAGACATTC M_murinus300347 GTGAGATGTTC M_murinus300419 GTGAGACATTC M_domestica300101 GTGAGACAAGT M_musculus300013 GTGAGACACTC M_musculus300788 GTGAGACATTA M_musculus300811 GTGAGGCATTC O_anatinus303497 GTGAGACATTC O_cuniculus300168 GTGAGACATTT O_latipes300072 GTGCAACAAAT O_garnettii300190 GTAAGACATTC O_garnettii300515 GTGAGACATTC O_garnettii300516 GTGGCCAAAA- O_garnettii300544 GTGAGACATTC O_garnettii300578 ATGAGACATTC P_troglodytes300015 GTTAGCCATTC P_troglodytes300033 GTGAGACATTC P_troglodytes300099 GTTAGACATTC P_troglodytes300153 GTGAGATATTA P_troglodytes300227 GTTAGCCATTC P_troglodytes300388 GTGAGAAATTC P_troglodytes300454 GTGAGACATTC P_troglodytes300642 GTGAGACATTC P_pygmaeus300016 GTGAAATATTA P_pygmaeus300255 GTTAGACATTC P_pygmaeus300257 GTTAGACATTC P_pygmaeus300272 GTGAGACATTC P_pygmaeus300331 GTGAGACATTC P_pygmaeus300443 GTGAGACATTT P_pygmaeus300521 GTGAGAAATTC P_pygmaeus300696 GTGAGACATTC R_norvegicus300854 GTGAGACATTC S_araneus300121 ATGAGACATAG S_tridecemlineatus300003 GTGAGACAGAC T_nigroviridis300014 GTGAGACATTT X_tropicalis300112 GTGCAATATGT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved