snOPY snoRNA Orthological Gene Database

Family: SNORA75

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300371 -----------ATCTTCTCATTGAGCTCCTTTC--TGTC--AATTGGTGG D_rerio300157 -----------CGCTTCTCA-TGAGCTCCTCTCCGTCAG---TCCAGTGG D_rerio300158 -----------CGCTTCTCA-TGAGCTCCTCTCCGTCAG---TCCAGTGG D_novemcinctus300567 -----------GTCTTCTCATTGAGCTCCTTTCTGTCAG----TTGGTGG E_telfairi300127 -----------CTCTTCTCAGTGAGCTCCTTTC--TGCC--AC-TGGTGG E_telfairi300751 -----------CTCTTCTCAATGAGCTCCTTTC--TGCC--GC-TGGTGG E_caballus300239 -----------GTCTTCTCATTGAGCTCCTTTC--TGTC--AATTGGTGG E_europaeus300133 -----------GTCTTTTCATTGAGCACCTTTC--TCTT--GATTGGTGG E_europaeus300582 -----------ATCTTCTCATTGAGCTCCTTTC--TGTC--AGCCAGTGG G_gallus300107 -----------CACTTCTCAATGAGCTCCTTCCTGCCGACATATCCGTGG H_sapiens300508 -----------GTCTTCTCATTGAGCTCCTTTC--TGTC--TATCAGTGG M_mulatta300059 ----------------GGCAATTAACACCACTA--CA----GATTGGTGG M_mulatta300175 -----------GACTTCTCACTGAGCTTCTTTC--TGTC--TGTTGGTGG M_mulatta300196 -----------GTCTTCTTACTGCGCTCCTTTC--TATC--TACTGGTCG M_mulatta300244 --------------------ATCTCATACTTAT--CA----GAAT-ATAG M_mulatta300399 ------------GCCTTATTAAGATGTAATTGA--CA---------AAAA M_mulatta300420 ----------------GGCAATTAACACCACTA--CA----GATTGGTGG M_mulatta300424 -----------GGCTTCTCATTGAGCTCCTTTC--TGTC--CATTGGTGG M_mulatta300523 -----------GTCTTCTCATTGAGCTCCTTTC--TGTC--TATCAGTGG M_murinus300347 -----------GTCTTCTGATTGGGTTCCTTTC--TGTT--TCTTGGTGG M_murinus300419 -----------GTCTTCTCATTGAGCTCCGTTC--TGTC--TCTTGGTGG M_domestica300101 -----------GTCTTCTCAATGAGCTCCTTCCCGTCT----ATCAGTGA O_anatinus303497 -----------TCCTTCTCAATGAGCTCCTTCC--TGCC--AGACAGTGG O_cuniculus300168 -----------GTCTTCTCACTGAGCTCCTTTC--TATT--GATTGGTGG O_latipes300072 -----------ACCTTCTCA-TGAGCTCCTCTCAATCGC---ATCCATGA O_garnettii300190 -----------GACTTCTCATTGAGCTTCTTTC--TGTC--TCTGGGTAG O_garnettii300515 -----------------------CACTTTTCAG--CA----GAAC-ATAC O_garnettii300516 -----------GTTTTCACATTGAGTGCCTTTC--TATT--TCCTGGTGG O_garnettii300544 ACTTTCCCCCCAGCTTTATTAAGTTTTAAATGA--CA----GATA-AAAA O_garnettii300578 -----------GTCTCCTCAGTGAGCTCCACTCACTGTT--TCTTGGTGG P_troglodytes300015 ------------------CAATTAAAATGACTA--CA----GATTGGTGG P_troglodytes300033 ---------------GGCCAATCTCATACTTAT--CA----GAAT-ATAG P_troglodytes300099 ------------------CAATTAAAATGACTA--CA----GATTGGTGG P_troglodytes300153 -----------GACTTCTCACTGAGCTTCTTTC--TGTC--TGTTGGTGG P_troglodytes300227 ------------------CAATTAAAATGACTA--CA----GATTGGTGG P_troglodytes300388 -----------GTATTCTTATTGAGCTCCTTTC--TGTC--TACTGGTGG P_troglodytes300454 -----------GGCTTCTCATTGAGCTCCTTTC--TGTC--CATTGGTGG P_troglodytes300642 -----------GTCTTCTCATTGAGCTCCTTTC--TGTC--TATCAGTGG P_pygmaeus300016 -----------GACTTCTCACTGAGCTTCTTTC--TGTC--TGTTGGTGG P_pygmaeus300255 ------------------CAATTAAAATGACTA--CA----GATTGGTGG P_pygmaeus300257 ------------------CAATTAAAATGACTA--CA----GATTGGTGG P_pygmaeus300272 ---------------GGCCAATCTCATACTTAT--CA----GAAT-ATAG P_pygmaeus300331 ---------------GGCCAATCTCATACTTAT--CA----GAAT-ATAG P_pygmaeus300443 -----------GGCTTCTCATTGAGCTCCTTTC--TGTC--CATCGGTGG P_pygmaeus300521 -----------------TTATTGGGCTCCTTTC--TGTC--TACTGGTAG P_pygmaeus300696 -----------GTCTTCTCATTGAGCTCCTTTC--TGTC--TGTCAGTGG R_norvegicus300854 -----------ATCTTCTCATTGAGCTCCTTTC--TGTC--AACCAGTGA S_araneus300121 -----------CTCTTCTCAGTGAGTTCTTTTC--TAT---AACTGGTGG S_tridecemlineatus300003 -----------ATCTTCTCATTGAGCTCCTTTC--TGCC--AACTGGTGG T_nigroviridis300014 -----------CTCTTCTCA-TGAGCACCACTCTGTCTA---AC-GGTGA X_tropicalis300112 -----------ATCTTCCCATTGAGCTCTTTCCTGCCGGCA-ATTTATGG C_familiaris300371 CAGTTTATGGATTCGCACGAGAAGAAGAGACAATTCACAG---TTAGCAT D_rerio300157 CGGTGTATGGATTCGCACGAGAAG-----TAGAGTCAAAATCACAGTTA- D_rerio300158 CGGTGTATGGATTCGCACGAGAAG-----TAGAGTCAAAATCACAGTTA- D_novemcinctus300567 CAGTTTATGGATTCGCACGAGAAG-----AAGAGACAATCNNNNNNNNNN E_telfairi300127 CAGTTCTTGGATTCGCACGAGAAGAAGAGCCAGATTCCCAGGCG-AGCCC E_telfairi300751 CAGCTGTTGGATTCGCACGAGAAGAAGAGCCAGAGTCCCAGGCG-AGCCC E_caballus300239 CAGTTTATGGATTCGCACGAGAAGAAGAGACAATTCACAGAACT-AGCAT E_europaeus300133 CAGTGTATGGATTCATGTGAAA-AAA----AAATTCAGAGAATG-AGCAT E_europaeus300582 CAGTTTAAGGATTCGCACGAGAAGAAGAGGAAATTCACATAACT-AGCTC G_gallus300107 CAGCCTATGGATTCGCATGAGAAGGA---CATAAACAGCTCAGTAGTGGC H_sapiens300508 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGAACT-AGCAT M_mulatta300059 CAATTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC M_mulatta300175 AAGCTTATAGATTCATGTGAGCAGAG---AAAATTCATAGAACT-AGCAT M_mulatta300196 CAGTTTATGGATTTGCACAAGAAGAG------------AAAACT-AGCGC M_mulatta300244 AGGGAAATGCATTCACACTAGAAGAC---AGAATTCACAGAAGT-AGCAT M_mulatta300399 CAGTATATAGATTCACATGAGAAGAAAAAACAATTCACAAAACT-AGCAT M_mulatta300420 CAATTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC M_mulatta300424 CAGTTGAGGTATTTGCATGAGAAGAAGAGAGAATTCACAGAACT-AGCAT M_mulatta300523 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGCACT-AGCAT M_murinus300347 CAGTTTATAGATTTGCAT------GAG-AAGAAGTCACGGAACT-AGCAT M_murinus300419 CAGTTTATGGATTCGCACGAGAAGAAG-AAGAATTCACAGAACTTAGCAT M_domestica300101 TGGGCTGTGGATTCGCACGAGAAG-----AAAATTCACTTCACT--CCA- O_anatinus303497 CAGCCTATGGATTCGCATGAGAAGAA-AATGAACATCCCAGT-----TCC O_cuniculus300168 CATT-TATGGATTTGCATGAGACAAG----AAATTCACAGAATT-AGCAT O_latipes300072 TTCTGTACGGATTCGCACGAGAAG-----CAGAGCCAGTGCACAGATCAA O_garnettii300190 CAGTTCATGGATTTGCAC------AAG-AAGAATTCACAGGACT-AGCAT O_garnettii300515 ATGGCACTGGATTCACATGAGAAGAAGAGAGAATTTACAGAACT-ACCAT O_garnettii300516 CAGTTTATAGATTTGCAT------GAG-AAGAATTCACAGAACT-AGCAT O_garnettii300544 CTGTATAAAGATTTATATGAGAAAAAGAGACAATTCACAGAATT-AGAAT O_garnettii300578 CAGTTTATGGATTCTCAT------GAG-AATAATTCACAGAACT-AGCAT P_troglodytes300015 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300033 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_troglodytes300099 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300153 CAGCTTATGGATTCATATGAGCAGAG---AGAAT-CACAGAACT-AGCAT P_troglodytes300227 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAT P_troglodytes300388 CAGTCTATGGATTTGCACAAGA---G------------AAAACT-AGCGC P_troglodytes300454 CAGTTGATGGATTTGCATGAGAAGAAGAGAGAATTCACAGAACT-AGCAT P_troglodytes300642 CAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGAACT-AGCAT P_pygmaeus300016 CAGCTTATGGATTCATATGAGCAGAG-----AAT-CACAGAACT-AGCAT P_pygmaeus300255 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC P_pygmaeus300257 CAGTTTATGGATTTGCACAAGAAGAG---AGAACTCACAGAACT-AGCAC P_pygmaeus300272 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_pygmaeus300331 AGGGAAATGCATTCGCACTAGAAGAC---AGAATTCACAGAAGT-AGCAT P_pygmaeus300443 CAGTTGATGGATTTGCATGAGAAGA---GAGAATTCACAGAACT-AGCAT P_pygmaeus300521 CAGTCTATGGATTTGCACAAGA---G------------AAAACT-AGCGC P_pygmaeus300696 CAGTTTATGGATTCGCACGAGAAGAAGAGAAAATTCACAGAACT-AGCAT R_norvegicus300854 CAGATTATGGATTCGCACGAGAAGAAGAGAAAGTTCACAGAACT-AGCAC S_araneus300121 CCCATTATGGATTCACATAGGAAGAAGAGACAACTCACAGAGCT-AGCAT S_tridecemlineatus300003 CAGTTTATGGATTCGCACGAGAAGAAGAGACATTTCACAGAAC--AGCAT T_nigroviridis300014 CAGTGAATGGATTCGCAAGAGAAG-----TAGAG-CAAAGTGACATTTAC X_tropicalis300112 CAGTAGATGGATTCGCACGGGAAG-----AATATTAAAGGCACTTGCGA- *** C_familiaris300371 TA-TTTTACCTT-CTGTCTTCACAGAGG-----TATATGTTGCTGTTT-- D_rerio300157 ATCAGGTGTT---CTCAGTGTTTTG-GG----ACGC-ACCGAT-GTCTGA D_rerio300158 ATCAGGTGTT---CTCAGTGTT------------GC-ACCGAT-GTCTGA D_novemcinctus300567 NNNNNNNNNNNN-NNNNNNNNN---------------------------- E_telfairi300127 CG---TGAGCCTCCCTTCTGCCAATGGG---GGTTAGTTCCACT--GCC- E_telfairi300751 TG---TGAGCTTCCCTTCTGCCAGTGGG---GGTTAGTTCCGCT--GCC- E_caballus300239 TA-TTTTGCCTT-CTGTCTTCGCGGAGG-----TGTATTCTGCTGTTT-- E_europaeus300133 TC-TTTTGCTTC-CTGTCTTCACAGAAG-----TGTAGTCTGCTATTT-- E_europaeus300582 T----T----TTTTGGCCTCTTCTGAGG-----CACATTTTGCTGTT--- G_gallus300107 A-CACTCACAAC-CTGGTTATACATCAG----TTGTGATTAACCACTTAC H_sapiens300508 TA-TTTTACCTT-CTGTCTTTACAGAGG-----TATATTTAGCTGTAT-- M_mulatta300059 TA-TTTTACGCT-CTGTCTTTACAGATG-----TGCATCTGGCTGTTT-- M_mulatta300175 TACTTTTGCCTT-CTGTCTTTACAGGAG-----TATATTTGGCTGTTT-- M_mulatta300196 TA-TTTTGCCTT-CTGTCTTTAAAGAGG-----TATATTTGACTGTTT-- M_mulatta300244 T----TCACCTT-TTGTCTTTACAGAAG-----TATATTTGGCTGTTT-- M_mulatta300399 TG-TTTTACTT--CTGTCCTTACAGAGA-----TATGTTTGACTGTTT-- M_mulatta300420 TA-TTTTACGCT-CTGTCTTTACAGATG-----TGCATCTGGCTGTTT-- M_mulatta300424 TA-TTTTACTTT-CTGTCTTTACAGAGG-----TATATTTGGCTGTTT-- M_mulatta300523 TA-TTTTACCTT-CTGTCTTTACAGAGG-----TATATTTAGCTGTTT-- M_murinus300347 TA-TTTTGCCTT-CTGTCTTTATGGAG------TATATTTGGCTATTT-- M_murinus300419 TA-TTTTACCTTCTTTTTTTTATGGAGG-----TATATTTGGCTGTTT-- M_domestica300101 --CATGTAGTGT-T--CCTGTTGTCACG----GGGATGCTCAAGTGTGGC O_anatinus303497 TG---GCACTTTTACCTCTGTTTCTAGAT--GGTTTGTTCTGCCAGGGC- O_cuniculus300168 TA-TTTTACCTT-CTGTCTTTACAGT-G-----TATATGTGATGGTTT-- O_latipes300072 AACAGGCTCGCC-CTACATGCTTAT-GG----GTGTTGCCCAT-GTCTGC O_garnettii300190 TA-TTTTACCTT-TTTGCTTTACAGAGG-----TACATCTGGCTATTT-- O_garnettii300515 TA-TTTTACCTT-CTGTCTCTACAGTGG-----TAT-CTTGGCTGCTC-- O_garnettii300516 TA-TTTAA---T-CTGTCTTTGTGGAAA-----TATATTTGGCTGTTC-- O_garnettii300544 TA-TTTTATTTT-CTGTCTTTACAGAGG-----TATGTTTGGCTGGTT-- O_garnettii300578 TA-TTTTACTTT-CTTTCTTTATGTAGG-----CATATTTGGCTATTT-- P_troglodytes300015 TA-TTTTACCCT-CTGTCTTTACAGAGG-----TGTATTTGGCTGTTT-- P_troglodytes300033 T----TCACCTT-TTGCCTTTACAGAAG-----TATATTTGGCTGTTT-- P_troglodytes300099 TA-TTTTACCCT-CTGTCTTTACAGAGG-----TGTATTTGGCTGTTT-- P_troglodytes300153 TACTTTTG--------TCTTTACAGGAG-----TATATTTGGCTGTCT-- P_troglodytes300227 TA-TTTTACCCT-CTGTCTTTACAGAGG-----TGTATTTGGCTGTTT-- P_troglodytes300388 TA-TTTTACCTT-CTGTCTTTAAACAGAAGGTTTAAATTTGACTGTTT-- P_troglodytes300454 TA-TTTTACTTT-CTGTCTTTACAGAGG-----TATATTTGGCTGTTT-- P_troglodytes300642 TA-TTTTACCTT-CTGTCTTTACAGAGG-----TATATTTAGCTGTAT-- P_pygmaeus300016 TACTTTTGCCTT-CTGTCTTTACAGGAG-----TATATTTGGCTATCT-- P_pygmaeus300255 TA-TTTCACCCT-CTGTCTTTACAGAGG-----TGTATTTGGCTGTTT-- P_pygmaeus300257 TA-TTTCACCCT-CTGTCTTTACAGAGG-----TGTATTTGGCTGTTT-- P_pygmaeus300272 T----TCACCTT-TTGTCTTTACAGAAG-----TATATTTGGCTGTTT-- P_pygmaeus300331 T----TCACCTT-TTGTCTTTACAGAAG-----TATATTTGGCTGTTT-- P_pygmaeus300443 TA-TTTTACTTT-CTGTCTTTACAGAGG-----TATATTTGGCTGTTT-- P_pygmaeus300521 TA-TTTTACCTT-CTGTCTTTAAACAGG-----TATATTTGACCGTTT-- P_pygmaeus300696 TA-TTTTACCTT-CTGTCTTTAC-GGGG-----TATATTTAGCTGTTT-- R_norvegicus300854 T----TAATCTTCTGTTTTTGCAGGAGA-----TCTATTTGGCTGTTATG S_araneus300121 GC-ACTTAT-TT-CTGTCTTTG--GAAG-----ACTACTTTACTATTT-- S_tridecemlineatus300003 TA-CTTTACCTT-CTGTTTCTACTGAGGT---GTGTATCTGGTTGTTC-- T_nigroviridis300014 ACAAGGCATTTA-CCTAGTGGT----------AGGT-GCCCAT-GTCCAA X_tropicalis300112 --CCTGTATCTC-TTGCCTCTAAATAAA----CTGGCATGAAATGGTCTC C_familiaris300371 TGTGAGACATCT D_rerio300157 TGTGAGACACTT D_rerio300158 TGTGAGACACTT D_novemcinctus300567 ------------ E_telfairi300127 TGTGAGACATTT E_telfairi300751 TGTGAGACATTT E_caballus300239 TGTGAGACATTC E_europaeus300133 TATGAGACAATG E_europaeus300582 TGTGAGACATGG G_gallus300107 TGTTCTACAAGT H_sapiens300508 TGTGAGACATTC M_mulatta300059 TGTCAGACATTC M_mulatta300175 TGGGAGATATTG M_mulatta300196 TGTGAGAAATTC M_mulatta300244 TGTGAGACATTC M_mulatta300399 GGTGAGACATTC M_mulatta300420 TGTCAGACATTC M_mulatta300424 TGTGAGACATTC M_mulatta300523 TGTGAGACATTC M_murinus300347 TGTGAGATGTTC M_murinus300419 TGTGAGACATTC M_domestica300101 TGTGAGACAAGT O_anatinus303497 TGTGAGACATTC O_cuniculus300168 TGTGAGACATTT O_latipes300072 TGTGCAACAAAT O_garnettii300190 TGTAAGACATTC O_garnettii300515 TGTGAGACATTC O_garnettii300516 TGTGGCCAAAA- O_garnettii300544 TGTGAGACATTC O_garnettii300578 TATGAGACATTC P_troglodytes300015 TGTTAGCCATTC P_troglodytes300033 TGTGAGACATTC P_troglodytes300099 TGTTAGACATTC P_troglodytes300153 TGTGAGATATTA P_troglodytes300227 TGTTAGCCATTC P_troglodytes300388 TGTGAGAAATTC P_troglodytes300454 TGTGAGACATTC P_troglodytes300642 TGTGAGACATTC P_pygmaeus300016 TGTGAAATATTA P_pygmaeus300255 TGTTAGACATTC P_pygmaeus300257 TGTTAGACATTC P_pygmaeus300272 TGTGAGACATTC P_pygmaeus300331 TGTGAGACATTC P_pygmaeus300443 TGTGAGACATTT P_pygmaeus300521 TGTGAGAAATTC P_pygmaeus300696 TGTGAGACATTC R_norvegicus300854 TGTGAGACATTC S_araneus300121 TATGAGACATAG S_tridecemlineatus300003 TGTGAGACAGAC T_nigroviridis300014 TGTGAGACATTT X_tropicalis300112 TGTGCAATATGT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved