snOPY snoRNA Orthological Gene Database

Family: SNORA74

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300151 ------------------------------------------------------------ C_elegans300126 ------------------------------------------------------------ C_familiaris300288 -----------CCCAGCGGTT-GTCA-GCTATCCAGG-CTAGTATGTTGCCT----TGGA C_familiaris300352 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-TAGACCC-ATTCCT----GTGA C_porcellus300322 --------------------------------------------------CC----ATGA D_rerio300203 -----------CCCAGCATTA-GTCA-GCTGTTCAGG-CATTTTCAGTGCCT----GTAA D_rerio300246 -----------CCCAGCGGTA-GTCA-GCTGTGCAGG-CCAGACC-ATGCCT----GAGC D_novemcinctus300009 -----------ACCAGCAGTT-GTCA-GCTTTCCAGG-CCAGTGTGATGCCT----GTGA D_melanogaster300113 ----------TTTCACAGGTCAGTCA-GCTGTACGGTTCTGGTTTTAAACGTCAACCGAA E_telfairi300231 -----------CCCAACGGTT-GTCA-GCTGTCCAGG-CTAACACAGTACCT----GGGA E_telfairi300232 -----------ACCAATGGTT-GTCA-GCCATCCAGG-CTAACACAATGCCT----GGGA E_telfairi300385 -----------CCCAACGGTT-GTCA-GCTGTCCAGG-CTAACACAATGCCT----GGGA E_telfairi300462 -----------CCCAATGGTT-GTCA-GCTATCC-GG-CTAGCACGATGCCT----GTGA E_telfairi300471 -----------CCCAATGGTT-GTCA-GCTGTCCAGG-CTAGCACGATGCCT----GTGA E_telfairi300555 -----------CCCAATGGTT-GTCA-GCTATCCAGG-CTAGCACGATGCCT----GTGA E_telfairi300631 -----------CCCAACGGTT-GTCA-GCTGTCCAGG-CTAACACAATGCCT----GGGA E_telfairi300826 -----------CCCAATGGTT-GTCA-GCTATCCAGG-CTAGCACGATGCCT----GTGA E_caballus300082 -----------TCCAGCGGTT-GTCA-GCTATCCAGG-CTAGTGCGATGCCT----TGGA E_caballus300360 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-CAGAATC-CTTCCT----GTGA E_europaeus300095 -----------CCCAGTGGTT-GTCA-GCTACCAAGG-CTAATG---TGCCT----TGGG E_europaeus300494 -----------TCCAGTGGTT-GTCA-GCTG-CCAGG-CT-GCCTGGTGCCT----TGGC F_catus300197 -----------CCCAGCGGTT-GTCA-GCTATCCAGG-CCAGCATGATGCCT----TGGA H_sapiens300551 ----------ATCCAGCGGTT-GTCA-GCTATCCAGG-CTCATGTGGTGCCT----GTGA H_sapiens300554 ---------TTTCCAGCAGTA-GTCA-GCCATCCGGA-CAGAACC-GTTCCT----GTGA L_africana300332 -----------CCCAATGGTT-GTCA-GCTATCCAGG-CTAGTGTGATGCCT----GGGG M_mulatta300171 -----------TCCAGCAGTC-GTTA-GCTCTCCTGG-CTAGTGTGATGCCT----GTGA M_mulatta300593 -----------TCCAGCAGTA-GTCA-GCCATCTGGA-CAGAACC-ATTCCT----GGAA M_mulatta300724 -----------TCCAGCGGTT-GTCA-GCTATCCAGG-CTTGTGTGGTGCCT----GTGA M_mulatta300727 -----------TCCAGCAGTA-GTCA-GCCGTCCGGA-CAGAACC-GTTCCT----GTGA M_murinus300162 -----------TCCAGCGGTT-GTCA-GCTGTCCAGG-CTAGTGTGATGCCT----GTGA M_murinus300227 -----------TCCAGCAGTT-GCCA-GCCCTCCAGG-CTGGTGCCATGCAT----GTGA M_musculus300550 -----------TCCAGCAGTT-GTCA-GCTATCCAGG-CT-GTGTGGTGCCC----GAGA M_musculus300821 -----------CCCAGTAGTA-GTCA-GCCATCC----CAGACAC-ATTCCT----GTGA M_lucifugus300032 -----------TCCAGCAGTT-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300045 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGCATC-ATGCCT----GTGC M_lucifugus300056 -----------TCCAGCAGTG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300140 -----------TCCAGCGGTT-GTCA-GCTATCCAGG-CTAGTGTGATGCCT----TGGA M_lucifugus300187 -----------TCCAGCAGTG-GTCA-TCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300250 -----------TCCAACAGTG-GTCA-GTTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300357 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGCATC-ATGCCT----GTGA M_lucifugus300387 -----------TCCAGCAGTG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300417 -----------TCCAGCAGTG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300418 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300462 -----------TCCAACAGTG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300466 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300501 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300734 -----------CCCAGCAGTA-GTCA-GCTGTCCAGA-CAGA-TC-GTTCCT----GTGA M_lucifugus300865 -----------TCCAGCAGTG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300866 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGAATC-ATGCCT----GTGA M_lucifugus300867 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGCATC-ATGCCT----GTGA M_lucifugus300868 -----------TCCAGCAGGG-GTCA-GCTCTCCAGA-CAGCATC-ATGCCT----GTGA O_anatinus302862 -----------TCCAGCGGCT-GTCA-GCTGTCCAGG-TGGGCGCGGTACCT----GCGA O_anatinus304316 -----------TCCAGCGGTA-GTCA-GCTGTCCAGG-GTGTTTCCGTGCCT----GAGA O_cuniculus300170 -----------CCCAGCGGTT-GTCA-GCTGTCCAGG-CTTGTATGATGCCT----GTGA O_cuniculus300422 -----------TCCAGCAGCT-GTCAAGCTGTCCAGG-CTTGTATGATGCCT----GTGA O_cuniculus300465 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-CAGATCC-ATTCCT----GTGA O_garnettii300074 -----------CCCAGCAGTT-GTCA-GCCCTCCAGG-CTCACGTGATGGGCTGCAGGGC O_garnettii300720 -----------CCCAGCAGTA-GTCA-GCTGTCCGGA-CAGAACC-ATTCCT----GTGA P_troglodytes300339 -----------TCCAGCAGTT-GTTA-GCTCTCCTGG-CTAGTGTGATGCCT----GTGA P_troglodytes300538 -----------TCCAGCAGTA-GTCA-GCTGTCTGGA-CAGAACC-ATTCCT----GGGA P_troglodytes300711 -----------TCCAGCGGTT-GTCA-GCTATCCAGG-CTCATGTGGTGCCT----GTGA P_troglodytes300714 -----------TCCAGCAGTA-GTCA-GCCATCCGGA-CAGAACC-GTTCCT----GTGA P_pygmaeus300063 -----------TCCAGCGGTT-GTCA-GCTATCCAGG-CTCATGTGGTGCCT----GTGA P_pygmaeus300375 -----------TCCAGCAGTC-GTTA-GCTCTCCTGG-CTAGTGTGATGCCT----GTGA P_pygmaeus300420 -----------TCCAGCAGTA-GTCA-GCCATCCGGA-CAGAACC-GTTCCT----GTGA P_pygmaeus300666 -----------TCCAGCAGTA-GTCA-GCTGTCTGGA-CAGAACC-ATTCCT----GGGA R_norvegicus300371 -----------TCCAGCAGTT-GTCA-GCTGCCCAGG-CT-GTGTGGTGCCT----GTGA S_cerevisiae300073 TACCAAACCTTTTTGTCAGGGTGCTTCTCTATCCGTTTTAGGATAAACTTATCTACAGAA S_araneus300153 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-CACAATT-ATTCCT----GTGA S_araneus300988 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-CAAAATC-ATTCCT----GTGA T_nigroviridis300004 -----------CCCAGCTCTAAGTCA-GCTGGCCAGA-CGGC----GTGTTT----GGTG T_belangeri300044 -----------TCCAGCGGCT-GTCA-GCTCTCCAGG-CTAGTGTGATGCCT----GTGA T_belangeri300052 -----------TCCAGCAGTT-GTCA-GCTGTCCAGG-CTAGTGTGATGCCT----GTGA T_belangeri300198 -----------TCCAGCAGTA-GTCA-ACTGTCCAGG-CTATTATGATGCCT----GTGG T_belangeri300353 -----------TCCAGCAGTA-GTCA-GCTGTCCGGA-GA---TC-ATTCCA----GTGA A_thaliana300151 --A--TCTGGCTTAGTTAGGAGGCATAAA---TCAATCTT-GATCATCAATACTTTACTG C_elegans300126 -------------TGTCG-AAGAGTAGT-------------------CATTTG--TATAC C_familiaris300288 TGG--TGTTACACTGTTGGAAGAGCAAA---CACTGCCTT-TATTGAGGTCTGGCTCCGA C_familiaris300352 TGG--TGTTACACTGCTGGGAGAGGAATG-------TCTT----CTTCCTCCAGTTGCCT C_porcellus300322 TG---TGTTACACTGT-AGGAGAGCA-G---CGCTGTCT--CATCAAGGTT-GGTGTCAC D_rerio300203 CGG--TGTTATACTGCTGGGACAGTGA-----CCTGCCGC-------GGTCTGGCTCTAG D_rerio300246 TAG--TGTTACTCTGCTGGAAGAGAAAGG--CACTGCCAT-----T-TGTGCTCCATCAG D_novemcinctus300009 TGG--TGTTACACTGTTGGAAGAGGAAG---CACTACCTT-TACTGTGGTCTGGCCCCAA D_melanogaster300113 TAG--CGTTACACCAGTGATAGAGCAATAAATGCGGCTGTGCCATTCCCCCTGTCCACCT E_telfairi300231 CAG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCC---AGTGAGGTCTGGCTCCAC E_telfairi300232 CAG--TGTTACACTGTTGGAAGAGCAAG---CACTGCCC---AGTGAGGTCTGGCTCCAC E_telfairi300385 CAG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCC---AGTGAGGTCTGGCTCCAC E_telfairi300462 TGG--TGTTACACTGTTGGAGGAGCAAG---CGCTGCCC---AGTGGGGTCTG-CTCCAA E_telfairi300471 CGG--TGTTACACTGTGGGAAGGGCAAG---CGCTGCCC---AGTGGGGTCTGGCTCCAA E_telfairi300555 TGG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCC---GGTGGGTTCTGGCTCCAA E_telfairi300631 CAG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCC---AGTGAGGTCTGGCTCCAC E_telfairi300826 TGG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCC---AGTGGGGTCTGGCTCCAA E_caballus300082 TGG--TGTTACACTGGTGGAAGAGTAAA---CGCTGCCTTATGCTGAGGTATGGCTCCAA E_caballus300360 CGG--TGTTACACTGCTGGGAGAGGAATG--TCCTGTCTT----CTTCCTCCAGTTGCCT E_europaeus300095 TGG--TGTTACACTGCTGGAAGAGCAAT---CATTGCCTT-GAATGACGTATGAGTCTGA E_europaeus300494 CAG--TG-TACACTGCTGGGAGAGCAAG---TGCTGCCCT-TCCTTGGGTCTGGCTCCGA F_catus300197 TGG--TGTTACACTGTTGGAAGAGCAAA---CGCTGACCT-TCTTGAGGTCTGGCTTCAA H_sapiens300551 TGG--TGTTACACTGTTGGAAGAGCAAA---CACTGTCTT-TATTGAGGTTTGGCTCCAA H_sapiens300554 TGG--TGTTACACTGCTGGGAGAGGAATG--TC---TTGT----CTTCATCCGGTTGCCT L_africana300332 TGG--TGTTACACTGTTGGGAGAACAAG---TGCTGCCTT-TGTTGAGGTCTGGCTCCAA M_mulatta300171 TGG--TGTTTCACTGTTGGAACAGTAAG---CACTGTCTT-CATTGAGGCTTGGCTGCAG M_mulatta300593 TGG--TGTTACACTGCTGGGAGAGGAATG--TCTTCTCTT----C---ATCCGGTTGCCT M_mulatta300724 TGG--TGTTACACTGTTGGAAGAGCAAG---CACTGTCTT-TATTGAGGTTTGGCTCCAA M_mulatta300727 TGG--TGTTACACTGCTGGGAGAGGAATG--TC---TTGT----CTTCATCCGGTTGCCT M_murinus300162 TGG--TGTTACACTGTTGGAAGAGCAAG---CACTGTCTT-TATTGAGGTTTGGCTCTAA M_murinus300227 TGA--TGTTGCACTGTTGGAAGAGCCAG---TG----------TTGAGGTTTGGCTCCAC M_musculus300550 TCG--TGTTACACTGTTGGAAGAGTAAA---CACTGCCTT--ACTAAGGGTCGGCTCCCA M_musculus300821 TGG--TGTTACACTGCTGGGAGAGTAATG--T---GTGCT----CTTCACCTGGTTGCTG M_lucifugus300032 GGG--TGTTACACTGCTGGGAGAGGAATG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300045 GGG--TGTTACACTGCTGGG-GAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGC-C M_lucifugus300056 GGG--TGTTACACTGCTAGGAGAGGAATG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300140 TGG--TGTTACACTGTTGGAAGAGCAAG---CGCTGCCTT-TAATGAGGTCTGGCTCCAA M_lucifugus300187 GGG--TGTTACACTGCTGGGAGAGGAACG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300250 GGG--TGTTATACTGCTGGGAGAGGAATG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300357 GGG--TGTTACACTGCTGGG-GAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGC-T M_lucifugus300387 GGG--TGTTACACTGCTGGGAGAGGAACG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300417 GGG--TGTTACACTGCTGGGAGAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300418 GGG--TGTTACACTGCTGGGAGAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300462 GGG--TGTTACACTGCTGGGAGAGGAATG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300466 GGG--TGTTACACTGCTGGG-GAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300501 GGG--TGTTACACTGCTGGGAGAGGAATG--CCCTATCTT----CTTCCTCCAGTTGCTC M_lucifugus300734 TGG--TGTTACACTGCTGGGAGAGAAATG--TCCTGTCTT----CTTCCTCCAGTTGCCT M_lucifugus300865 GGG--TGTTACACCGCTGGGAGAGGAACG--CCTTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300866 GGG--TGTTACACTGCTGGGAGAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGCTC M_lucifugus300867 GGG--TGTTACACTGCTGGG-GAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGC-C M_lucifugus300868 GGG--TGTTACACTGCTGGG-GAGGAATG--CCCTGTCTT----CTTCCTCCAGTTGC-C O_anatinus302862 TAG--CGTTACACCGCTGGGACATCAGGG--CGCCGTCCA-----GACGACCCTCCGCCT O_anatinus304316 CAG--TGTTACACTGCTGGGAGATTAATG--TTCTGTCAT----TTCAATCTGGTCGCCA O_cuniculus300170 TGG--TGTTACACTGTTGGGAGAGCAAA---CACTGTCTA-CACTG-GGTTTGGCTCCGA O_cuniculus300422 TGG--TGTTACACTGTTGGAAGAGCAAG---CACTGTTTT-TGTTGAGGTTTGGCTCTAA O_cuniculus300465 CGG--TGTTACACTGCTGGGAGAGCAATG--TCTTGCCTT----CTTCATCTAGTTGCTT O_garnettii300074 TGA--TGCTGCACCGTTGGAAGAGCCAG---TG----------TTGAGGTTTGGCTCCGA O_garnettii300720 TGG--TGTTACACTGCTGGAAGAGAAATG--TCTTGTCTT----CTTTATCCGGTTGCCT P_troglodytes300339 TGG--TGTTTCACTGTTGGAACAGCAAG---CACTGTCTT-AATTGAGGCTTGGCTCCGG P_troglodytes300538 TGG--TGTTACACTGCTGGGAGAAGAATG--TCTTCTCTT----C---ATCCAGTTGCCT P_troglodytes300711 TGG--TGTTACACTGTTGGAAGAGCAAA---CACTGTCTT-TATTGAGGTTTGGCTCCAA P_troglodytes300714 TGG--TGTTACACTGCTGGGAGAGGAATG--TC---TTGT----CTTCATCCGGTTGCCT P_pygmaeus300063 TGG--TGTTACACTGTTGGAAGAGCAAA---CACTGTCTT-TATTGAGGTTTGGCCCCAA P_pygmaeus300375 TGG--TGTTTCACTGTTGCAACAGCAAG---CACTGTCTT-AATTGAGGCTTGGCTCCAG P_pygmaeus300420 TGG--TGTTACACTGCTGGGAGAGGAATG--TC---TTGT----CTTCATCCGGTTGCCT P_pygmaeus300666 TGG--TGTTACACTGCTGGGAGAGGAATG--TCTTCTCTT----C---ATCCGGTTGCCT R_norvegicus300371 TTG--TGTTACACTGTTGGAAGAGCAAA---GGCTGCTTT--AG-AAGGGTTGGCTCCAA S_cerevisiae300073 GTGTCTGTTACTGTTTTGGAAGAGTAATACTGTTCGCTTATCCATATTTCCCCGTTCTGG S_araneus300153 TGG--TGTTACACTGCTGGGAGAGAAATG--CCATGTCTT----CTTCCTCCAGTTGCCT S_araneus300988 TGG--TGTTACTCTGCTGGGAGAGTAATG--TCTTGCCTT----TTT-TTCCTGTTGCCT T_nigroviridis300004 CAG--TGTTACAGGGCTGGTAGAGGAAGA--CTCTGCTTC-----CGAGTGCAGCTGTGC T_belangeri300044 TGG--GGTTACGCTGTTGGAAGAGCAAG---CACTGTCTT-TGTGGAGGTTTGTCTACA- T_belangeri300052 TGG--TGTTACACTGTTGGAAGAGTAAG---CACTGTCTT-TATTGAGGTTTGGCTATAA T_belangeri300198 TGG--TGTTACACTGTTGGAAGAGCAAG---TACTGTCTT-TATAGAGGTTTGGCTATAA T_belangeri300353 TGG--TGTTACACTGCTGGTAGAGCAGTG--TC-TGTCTC----TCTCATCCGGTTGCCC A_thaliana300151 TATTGTATTGATCTATTTGACT-TGAGGTCTTTTTGAGGA--GGAGCTTTGC-------- C_elegans300126 GTG-ATACACTTATACAGAGTTACACTTTTCGTATATA----AGTGCTTCTT-------- C_familiaris300288 GCA-CTGTTTTGGTGTTGCAGC--TAAGTACTC-TTGGGC--AGCGTTTTGC-------- C_familiaris300352 CTG-TCACTGTTTTGGTGGCGCCTGGCACTGGTACAAGGC--AGAACTATGC-------- C_porcellus300322 AAG-CTGTTTTAGTGTGT---GGCCCAGTGCCT-TCGGGC--AGCGTTTTGT-------- D_rerio300203 ATG-GCGCTGTTGTAGCGTCTTTCAGAGTTCAGCTGGAGG--CAGGA-GAGC-------- D_rerio300246 GTT-TGGCTGTTTTAGTGAATCCTGCTGTGTGGTGCTGGT--TATGCCATGT-------- D_novemcinctus300009 GCA-CTGTTTTGGTGATGA--GGGCAAGTACCTATAGGGC--AGTGTTTTGC-------- D_melanogaster300113 GTGGCCACTGTTCTAGTGGCCACGCCGGGCAATCCGGGGCGTGGCACTTGGCCGGGCGCC E_telfairi300231 GCA-CTGTTTTAGTGTTGTGGTCGCATAA-CCT-CTGGGC--AGCATTTTGC-------- E_telfairi300232 GCA-CTGTTTTAGTGTTGTGGTCGCATAA-CCT-CAGGGC--AGCATTTTGC-------- E_telfairi300385 GCA-CTGTTT-AGTGTTGTGGTCGCATAA-CCT-CTGGGC--AGCATTTTGC-------- E_telfairi300462 GCA-CTCTTTCCGTGTCGTAGT--CCCGTCCCT-TTGGGC--AGCGTTTTGC-------- E_telfairi300471 GCA-CCCTTTCAGGGTTGGGGTGGCCTGTCCCA-TTGGGC--AACATCTTGC-------- E_telfairi300555 GCA-CTCTTTCCGTGGTGTAGT--CACGTACCT-TTGGGC--AGCATTTTGC-------- E_telfairi300631 GCA-CTGTTTTAGTGTTGTGGTTGCATAA-CCT-CTGGGC--AGCATTTTGC-------- E_telfairi300826 GCG-CTCTTTCCGTGGTGTGGT--CACGTACCT-TTGGGC--AGCGTTTTGC-------- E_caballus300082 GCA-CTGTTTTGGTGTTGTGGC--TGAGTACCT-TTGGGC--AGTGTTTTGC-------- E_caballus300360 CTG-CCACTGTTCTGGTGGCATCTGGCACTGGTGCAAGGC--AGAACTGTGC-------- E_europaeus300095 GCA-CTGTTTTAGTGTGATGAC----AGTACCT-TGGGGC--AATGCCTTGC-------- E_europaeus300494 GCA-CTGTTTTGGTGTGGG--GGCTGCGTACCTTTGGAGC--AGTGTGTTGC-------- F_catus300197 GCA-CTGTTTTGGTGTTGTGGC--TGA-TACTC-TTGGGC--AGTGTTTTGC-------- H_sapiens300551 GCA-CTGTTTTGGTGTTGT--AGCTGAGTACCT-TTGGGC--AGTGTTTTGC-------- H_sapiens300554 GCG-CCACTGTTCTGGTGGCGTCTGGCACTGGTGCAAGAC--AGAGCTGTGC-------- L_africana300332 GCA-CTGTTTTGGTGTTGAGGT---TAGTACCT-TTCGGT--AGCAT-TTGC-------- M_mulatta300171 CTG-CTGTTTTGGTGTGG---GGCCAAGTACCT-TTGGGC--AGTGTTTCGC-------- M_mulatta300593 CTA-TCACTGTTCTGGTGGTGTCTGGCACTGGTGCAAGGC--AGGACTGTGC-------- M_mulatta300724 GCA-CTGTTTTGGTGTTGT--AGCTGAGTACCT-TTGGGC--AGTGTTTTGC-------- M_mulatta300727 GCG-CCACTGTTCTGGTGGCGTCTGGCACTGGTACAAGAT--AGAGCTGTGC-------- M_murinus300162 ACA-CTGTTTTGGTGTTTT--GGCTGAGTACCT-TTGGGC--AGTGTTTTGC-------- M_murinus300227 CCA-CTGTTTTGGTGTTGC--AGGAAAATACCT-TTGAGC--AATGTTTTAC-------- M_musculus300550 GCA-CTGTTTTGGTGTCTGG-TGCTGAGTACTT-TCAGGC--AGT--ATTGC-------- M_musculus300821 GG--TCACCGTTCTGGTGGGCTGTGACTCTGGTGTAAGAC--CAAACTTTGC-------- M_lucifugus300032 CCT-TCATTGCTCTGGTGATGTGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300045 CCT-TCACTGCTATGGTGACATGTGGCACTGGTGCAGGGC--AGAACTGTGC-------- M_lucifugus300056 CCT-TCACTGCTCTGGTGATGTGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300140 GCA-CTGTTTTGGTGTTGTGGC--CGAGTACCT-TTGGGC--AGTGTTTTGC-------- M_lucifugus300187 CCT-TCACTGCTCTGGTGACGTGTGGCACTGGTGCAAGCC--AGTACTGTGC-------- M_lucifugus300250 CCT-TCACTGCTCTGGTGACGTGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300357 CCT-TCACTGCTCTGGTGACATGTGGCACTGGTGCAGG-C--AGAACTGTGC-------- M_lucifugus300387 CCT-TCACTGCTCTGGTGACGTGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300417 CCT-TCACTGCTCTGGTGACGTGTGGCACTGGTACAAGGC--AGTACTGTGC-------- M_lucifugus300418 CCT-TCACTGTTCTGGTGACGTGTGGCACTGGTACAAGGC--AGTACTGTGC-------- M_lucifugus300462 CCT-TCACTGCTCTGGTGACATGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300466 CCT-TCACTGCTCTGGTGACATGTGGCACTGGTGCAGG-C--AGAACTGTGC-------- M_lucifugus300501 CCT-TCACTGTTCTGGTGACGTGTGGCACTGGTACAAGGC--AGTACTGTGC-------- M_lucifugus300734 CTG-TCACTGTTCTGGTGGCATCAGGCACTGGTGCAAGGC--AGAACTATGC-------- M_lucifugus300865 CCT-TCACTGCTCTGGTGACGCGTGGCACTGGTGCAAGGC--AGTACTGTGC-------- M_lucifugus300866 CCT-TCACTGTTCTGGTGACATGTGGCACTGGTACAAGGC--AGTACTGTGC-------- M_lucifugus300867 CCT-TCACTGCTCTGGTGACCTGTGGCACTGGTGCAGG-C--AGAACTGTGC-------- M_lucifugus300868 CAT-TCACTGTTCTGGTGACGTGTGGCACTGGTGCAGGGC--AGAACTGTGC-------- O_anatinus302862 CCG-CCGCTGTTTTAGCGTCGGGTCCGGCTGGGCCCGGGC--GGCGCTTTGC-------- O_anatinus304316 CTG-TCACCGTTCTGGTAACTGCTGGTACCAGTGCAGGGC--AGAACTCTGC-------- O_cuniculus300170 GCA-CTGTTCTGGTGTGTTGTGGGCAAGAACCC-TTAGGC--AGTGTTTTGT-------- O_cuniculus300422 GCA-CTGTTTTGGTGTGTTGGGGGCAAGAACCC-TTGGGC--AGTGTTTTGT-------- O_cuniculus300465 CCC-TCACCGTTCTGGTGGCAGGTGGCACTGGTGCAGGGC--AGAACTGTGC-------- O_garnettii300074 TCA-CTGTTTTGGTGCTG---GGCAGAATACCT-TTGGAC--AATGTTTTCC-------- O_garnettii300720 CCA-TCGCTGTTCTGGTGGTGTCTGGCACTGATACAAGGC--AGAACTGTGC-------- P_troglodytes300339 GTG-CTGTTTTGGTGTGG---GGCCAAGTGCCT-TTGGGC--AGTGTTTTGC-------- P_troglodytes300538 CCA-TCACTGTTCTGGTGGTGTCTGGCACTGGTGCAAGGC--AGAACTGTGC-------- P_troglodytes300711 GCA-CTGTTTTGGTGTTGT--AGCTGAGTACCT-TTGGGC--AGTGTTTTGC-------- P_troglodytes300714 GCG-CCACTGTTCTGGTGGCGTCTGGCACTCGTGCAAGAC--AGAGCTGTGC-------- P_pygmaeus300063 GCA-CTGTTTTGGTGTTGT--AGCTGAGTACCT-TTGGGC--AGTGTTTTGC-------- P_pygmaeus300375 GTG-CTGTTTTGGTGTGG---GGCCAAGTACCT-TTGGGC--AGTGTTTTGA-------- P_pygmaeus300420 GTG-CCACTGTTCTGGTGGCGTCTGGCACTGGTGCAAGAC--AGAGCTGTGC-------- P_pygmaeus300666 CCA-TCACTCTTCTGGTGGTGTCTGGCAGTGGTGCAAGGC--AGAACTGTGC-------- R_norvegicus300371 GCA-CTGTTTTGGTGTTTGG-TGCTGAGTACCT-TCAGGC--AGTGTATTGC-------- S_cerevisiae300073 GGA--AGCCTCATGGGTAAATTAGAAGGACAACCTTTGTTTTAAAGGTATACCT----TC S_araneus300153 GTG-TCACTGTTCTGGTGGCTGCTGGCACTGGTGTAAGGC--AGGGCTGTGC-------- S_araneus300988 CTG-TCACTGTTCTGGTGGCTGCTGGCACTGGTACAAGGC--AGAACTGTGC-------- T_nigroviridis300004 A-G-ACTCTGTGTTAGAGTGTGCTGCTGCTGCGCTGCTGC--AGGGTCGAGC-------- T_belangeri300044 GCA-CTGTTTTGGTGTGAC--AGCCAAGAACCT-TTGGGA--AGTGTTTTGT-------- T_belangeri300052 GCA-CTGTTTTGGTGTGAT--AGCCAAGAACCT-TTGGGC--AGTGTTTTGC-------- T_belangeri300198 GCA-CTGTTTTGGTGTGAC--AGCCAAGAACCT-TTGGGC--AGTGTTTTGC-------- T_belangeri300353 TCG-TCACTGTTCTGGTGGCGTCTGGCACTGGTGCGAGGC--AGGACT--GC-------- A_thaliana300151 -TTCTGCTAAGTATCAAGCTTCTCCCAA-----------GCAGCCTCA--GACATAT--- C_elegans300126 -CTCGTT--GGAGTTGTTTATTTAA-------------TGAGCAATTA--CCTCTAAACT C_familiaris300288 -ACCTCT-GAGAGTGGAAGAACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT C_familiaris300352 -TTCCTT-GAGAGTATGCTGAGCGTTCA-------CTCTGGCCGCTTG--GTTCTAGTCA C_porcellus300322 -ACTTCT-GAGAGTGGACTGGCTCCTGC----------TGTGGAGTTG--ATCCTAGTCT D_rerio300203 --CCTCT-GAGCTAGGACTGAGTCTGCTT-------CGCTGTGGCTCA--GCCCTTGACA D_rerio300246 --CTTCT-GAGAGTGGCCTGTACTCAC----------AAAATGAGGCA--GGCCTAGTCT D_novemcinctus300009 -ACCTCT-GAGAGTGGAGTGGCTCCCTT----------TGTGGGCTTG--GTCCTAGTCT D_melanogaster300113 CTTCCCTAGAGAGTTGAATTACCTGAGTGGGGGGAGGACGACGACTTGTTGTTGTTGTCC E_telfairi300231 -ACCTCT-GAGAGTGGAGTGACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT E_telfairi300232 -ACCCTT-GAGAGGGGGGTGACTCCTCC----------CGTGGAGTTG--GTCCTAGTTT E_telfairi300385 -ACCTTT-GAGAGTGGAGTGCCCCCTCC----------TGTGGAGTTG--GTCCTAGTCT E_telfairi300462 -ACCTGT-GAAGCTGGAATGGCTCCTCC----------TGTGGAGTTG--GTGCTAGTCT E_telfairi300471 -ACCTATTGGGAGTGGAATGGCTCCTCC----------TGTGGAGCTG--GTCCTAGTCT E_telfairi300555 -ACCTAT-GAGAGTGGACTGACTCCTCC----------TATGGAGTTG--GTCCTAGTCT E_telfairi300631 -ACCTTT-GAGAGTAAAAAAAAA------------------------------------- E_telfairi300826 -ACCTAT-GAGAGTGGAATGACTTCTCC----------TGTGGAGTTG--GTCCTAGTCT E_caballus300082 -ACCTCT-GAGAGTGGAGTAACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT E_caballus300360 -TTCCTT-GAGAGTGTGCTAAGCATTCA-------CTTTGGCTGCTTA--GTTCTAGTCT E_europaeus300095 -ACCTCTTGAGAGTGGAATGACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT E_europaeus300494 -ACCTCT-GAGAGTGGAGTAGCTCCTCCT---------TGTGGAGTTG--GTCCTAGTCT F_catus300197 -ACCTCT-GAGAGTGGAGTAACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT H_sapiens300551 -ACCTCT-GAGAGTGGAATGACTCC-------------TGTGGAGTTG--ATCCTAGTCT H_sapiens300554 -TTCCCC-GAGAGTGTGCTAAGCATTCA-------CTTTGGCTGCTTA--GTTCTAGTCT L_africana300332 -ACCTCT-GAGAGTGGAGTGACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT M_mulatta300171 -ACCTCT-GAGAGTGAAATGACTCCT-------------GTGGATTAA--GTCCTAATCT M_mulatta300593 -TTCCTT-GAGCGTGTGCTGAGCATTCA-------CCTTGGCTGCTTG--GTTCTAGTCT M_mulatta300724 -ACCTCT-GAGAGTGGAATGACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT M_mulatta300727 -TTCCCC-GAGAGTGTGCTAAGCATTCA-------CTTTGGCTGCTTA--GTTCTAGTCT M_murinus300162 -ACCTCT-GAGAGTGGAATGACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT M_murinus300227 -ACCTCT-GAGAGGGGAATGACTCCTCC----------TGTGGAACTG--GTCCCAGTCT M_musculus300550 -ATCCCT-GAGAGTGGAATGACTCCT------------TGTGGAGTTG--GTCCTGGTCT M_musculus300821 -TTCCTT-GAGAGTGTGCTAAGCATTCG-------CTTTGACTGCTTA--GTTCTAGTAT M_lucifugus300032 -TTCCTC-AAGAGTGAGCTAATCAT-CA-------CTTTCGCTGCTTA--GTTGTAGTGT M_lucifugus300045 -TTCCAG-GAGAGTGAGCTAAGCAT-CA-------CTTTGGTTGCTTT--GTTCTAGTGA M_lucifugus300056 -TTCCTC-GAGAGTGAGCTAAGCAT-CA-------CTTTCGCTGCTTA--GTTGTAGTGT M_lucifugus300140 -ACCTCT-GAGAGTGGAATAACTTCTCC----------TGTGGAGTTA--GTTCTAGTCT M_lucifugus300187 -TTCCTC-GAGAGTGAGCTAAGCAT-CA-------CTTTCGCTGCTTA--GTTGTAGTGT M_lucifugus300250 -TTCCTC-GAGAGTGAGCTAAGCAT-CA-------CTTTTGCTGCTTA--GTTGTAAT-T M_lucifugus300357 -TTCCAT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGTTGCTTT--GTCCTAGTGA M_lucifugus300387 -TTCCTT-GAGAGTGAGCTAAGCAG-CA-------CTTTGGCTGCTTA--GTTGTAGTGT M_lucifugus300417 -TTCCTT-GAGAGTGAGCTAAGCAG-CA-------CTTTGGCTGCTTA--GTTGTAGTGT M_lucifugus300418 -TTCCTT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGCTGCTTA--GTTGTAGTGT M_lucifugus300462 -TTCCTC-GAGAGTGAGCTAAGCAT-CA-------CTTTCGCTGCTTA--GTTGAAGTGT M_lucifugus300466 -TTCCAT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGTTGCTTT--GTTCTAGTGA M_lucifugus300501 -TTCCTT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGCTGCTTA--GTTGTAGTGT M_lucifugus300734 -TTCCTT-GAGAGTGTGCTAAGCATCCA-------CTTTGGCTGCTTA--GTTCTAGTGT M_lucifugus300865 -TTCCTT-GAGAGTGAGCTAAGCAG-CA-------CTTTGGCTGCTCA--GTTGTTGTGT M_lucifugus300866 -TTCCTT-GAGAGTGAGCTAAGCAG-CA-------CTTTGGCTGCTTA--GTTGTAGTGT M_lucifugus300867 -TTCTAT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGTTGCTTT--GTTCTAATGA M_lucifugus300868 -TTCCAT-GAGAGTGAGCTAAGCAT-CA-------CTTTGGTTGCTTT--GTTCTAGTGA O_anatinus302862 -GTTCCC-GAGAGTGGACGGACTCTTGCC-------CCGTA-GAGTCG--GCCCTAGATT O_anatinus304316 -CTTTTGAGAGTGCGCTAAACATGTACTT-------CCCTGCTGTTTG--GTGCTAGTCT O_cuniculus300170 -GCCTCT-GAGAGTGGAATGACTCCTCC----------TGTGGGGTTG--GTCCTAGTCT O_cuniculus300422 -GCCTCT-GAGAGTGGAATGTCTCTTCC----------TGTGGAGTTG--CTCCTAGTTT O_cuniculus300465 -TTCCTT-GAGAGTGTGCTAAGCATTTCGTT----TTTTGGCTGCTTA--GTTCTAGTCT O_garnettii300074 -ACCTCC-AAGAGTGGAAAGCCTCCTCC----------AGAGGAGTTG--GTCCTAATCT O_garnettii300720 -TTCCTT-GAGAGTGTGCTAAGCATTCA-------CTTTGACTGCTTA--GTTCTAGTCG P_troglodytes300339 -ACTTCT-GAGAGTGAAATGACTCCT-------------GTGGAGTCA--GTCCTAATCT P_troglodytes300538 -TTCCTT-GAGAGTGTGCTGAGCATTCA-------CCTTTGCTGCTTG--GTTCTAGTCT P_troglodytes300711 -ACCTCT-GAGAGTGGAATGACTCCTCC----------TGTGGAGTTG--ATCCTAGTCT P_troglodytes300714 -TTCCCC-GAGAGTGTGCTAAGCATTCA-------CTTTGGCTGCTTA--GTTCTAGTCT P_pygmaeus300063 -ACCTCT-GAGAGTGGAATGACTCCTCC----------TGTGGAGTTG--ATCCTAGTCT P_pygmaeus300375 -ACCTCT-GAGAGTGAAATTACTCCT-------------GTGGAGTCG--GTCCTAATCT P_pygmaeus300420 -TTCCCC-GAGAGTGTGCTAAGCATTCA-------CTTTGGCTGCTTA--GTTCTAGTCT P_pygmaeus300666 -TTCCTT-GAGAGTGTGCTGAGCATTCA-------CCTTGGCTGCTTG--GTTCTAGTCT R_norvegicus300371 -ATCCCT-GAGAGTGGAATGACTCCT------------TGTGGAGTTG--GTCCTAGTCT S_cerevisiae300073 GCTTTTTAGAACAGCGAGGATCTTATGAGTTGAG-CTTTTGTTATTTGAGACTTTATCTC S_araneus300153 -TTCCTT-GAGAGTGTACTAAGCAATTG-------CTCTGGCTGCTTA--GTTCTAGTCT S_araneus300988 -TTCCTC-GAGAGTGTGCTAAGCATTCA-------CTTCGGCTGCTCA--GTGCTAGTCT T_nigroviridis300004 --CCGCT-GAGAGTGGCCTGCCCTGACCC-------ACCAGCAAGGCA--GGCCT-AGTA T_belangeri300044 -ACCTCT-GAGAGTGAAATAATTCCTCC----------TGTGGAGTTT--GTCCTAGTCT T_belangeri300052 -ACCTCT-GAGAGTGGAGTAACTCCTCC----------TGTGGAGTTG--GTCCTAGTCT T_belangeri300198 -ACCTCT-GAGAGTGGAGTAATTCCTCC----------TGTGGAGTTG--ATCCTAGTCT T_belangeri300353 -TTCCTC-GAGAGTGTGCTAAGCACTCA-------CTCTGGCTGCTTG--GTGCTAGTCT A_thaliana300151 ----------------------------------------- C_elegans300126 GAAAGC--AACAATT-------------------------- C_familiaris300288 GGGTGC-AAACAGT--------------------------- C_familiaris300352 GGGAGC-AGACATA--------------------------- C_porcellus300322 GGGTAC-AAACATT--------------------------- D_rerio300203 GGAGGCCTCACAGA--------------------------- D_rerio300246 GGAGGC-AAACACT--------------------------- D_novemcinctus300009 GGGTGC-AAACAGT--------------------------- D_melanogaster300113 CCCTGCAAACCATCTAATTCCTAGTTGGGAAGGTTACATTT E_telfairi300231 GGATGC-AAACATT--------------------------- E_telfairi300232 GCATGC-AAACATT--------------------------- E_telfairi300385 GGATGC-AAACCTT--------------------------- E_telfairi300462 GGATGC-AAACATT--------------------------- E_telfairi300471 GTATGC-AAACATT--------------------------- E_telfairi300555 GGATGC-AAACATT--------------------------- E_telfairi300631 ----------------------------------------- E_telfairi300826 GGATGC-AAACATT--------------------------- E_caballus300082 GGGTGC-AAACAAT--------------------------- E_caballus300360 GGAAGC-AGACACA--------------------------- E_europaeus300095 GGGTGC-AAACATA--------------------------- E_europaeus300494 GGGTGC-AAACAGT--------------------------- F_catus300197 GGGTGC-AAACAAT--------------------------- H_sapiens300551 GGGTGC-AAACAATT-------------------------- H_sapiens300554 GGGAGC-AGACAGAG-------------------------- L_africana300332 GGGTGC-AAACAAT--------------------------- M_mulatta300171 GAGTGC-AAACAAT--------------------------- M_mulatta300593 GGGAGC-AGACCCA--------------------------- M_mulatta300724 GGGTGC-AAACAAT--------------------------- M_mulatta300727 GGGAGC-AGACAGA--------------------------- M_murinus300162 GGGTGC-AAACAGT--------------------------- M_murinus300227 GGGTGC-AAACAAT--------------------------- M_musculus300550 GGGTGC-AAACAAT--------------------------- M_musculus300821 GGGAGC-AGACAGT--------------------------- M_lucifugus300032 GGGAGC-AGACACA--------------------------- M_lucifugus300045 AGGAGC-AGACAGA--------------------------- M_lucifugus300056 GGGAGC-AGACACA--------------------------- M_lucifugus300140 GGGTGC-GAACAAT--------------------------- M_lucifugus300187 GGGAGC-AGACACA--------------------------- M_lucifugus300250 GGGAGC-AGACACA--------------------------- M_lucifugus300357 AGGAGC-AGACACA--------------------------- M_lucifugus300387 GGGAGC-AGACACA--------------------------- M_lucifugus300417 GGGAGT-AGACACA--------------------------- M_lucifugus300418 GGGAGT-AGACACA--------------------------- M_lucifugus300462 GGGAGC-AGACACA--------------------------- M_lucifugus300466 AGGAGC-AGACACA--------------------------- M_lucifugus300501 GGGAGT-AGACGCA--------------------------- M_lucifugus300734 GGGAGC-AGACACA--------------------------- M_lucifugus300865 GGGAGC-AGACACA--------------------------- M_lucifugus300866 GGGAGT-AGACACA--------------------------- M_lucifugus300867 AGGAGC-AGACACA--------------------------- M_lucifugus300868 AGGAGC-AAACAAA--------------------------- O_anatinus302862 GGATGC-AAACATC--------------------------- O_anatinus304316 GGGGGC-AGACATA--------------------------- O_cuniculus300170 GGGTAC-AAACAAT--------------------------- O_cuniculus300422 GGGTGC-AAACAAT--------------------------- O_cuniculus300465 GGGAGC-AGACACA--------------------------- O_garnettii300074 GAGTAT-AAACAAT--------------------------- O_garnettii300720 GGGAGC-AGACACA--------------------------- P_troglodytes300339 GAGTGC-AAACAAT--------------------------- P_troglodytes300538 GGGAGC-AGACACA--------------------------- P_troglodytes300711 GGGTGC-AAACAAT--------------------------- P_troglodytes300714 GGGAGC-AGACAGA--------------------------- P_pygmaeus300063 GGGTGC-AAACAAT--------------------------- P_pygmaeus300375 GAGTGC-AAGCAAT--------------------------- P_pygmaeus300420 GGGAGC-AGACAGA--------------------------- P_pygmaeus300666 GGGAGC-AGACACA--------------------------- R_norvegicus300371 AGGTGC-GAACAAT--------------------------- S_cerevisiae300073 GGGCTCCATACAATATGTTCGTAGTAAAGATCCTCACAATT S_araneus300153 GGGAGC-AAACACT--------------------------- S_araneus300988 GGGAGC-AAACATG--------------------------- T_nigroviridis300004 CAGGGCTGCACATG--------------------------- T_belangeri300044 GGGTGC-AAACAAT--------------------------- T_belangeri300052 GGGTGC-AAACAAT--------------------------- T_belangeri300198 GGGTGC-AAACAGT--------------------------- T_belangeri300353 GGGAGC-AGACACG---------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved