snOPY snoRNA Orthological Gene Database

Family: SNORA72

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300042 ---------------------------------------------CGGTG C_familiaris300099 -------------------------------------------------C C_familiaris300117 -------------------------------------------------- C_familiaris300146 ---------------------------------------------CTGCA C_familiaris300162 -------------------------------------------------C C_familiaris300169 ---------------------------------------------CTGTG C_familiaris300191 --------------------------------------------TTCTGA C_familiaris300197 ---------------------------------------------CCACG C_familiaris300302 -------------------------------------------------- C_familiaris300329 ---------------------------------------------TTGTG C_familiaris300455 ---------------------------------------------CCGCG C_familiaris300457 ---------------------------------------------CTGTG C_porcellus300100 ---------------------------------------------CTGCA D_novemcinctus300006 ---------------------------------------------CTGCG D_novemcinctus300128 ---------------------------------------------ATGCG D_novemcinctus300135 ---------------------------------------------CTATG D_novemcinctus300141 -------------------------------------------CATCAAA D_novemcinctus300153 ---------------------------------------------CTGTG D_novemcinctus300177 ---------------------------------------------CTGCG D_novemcinctus300188 ---------------------------------------------TTGTG D_novemcinctus300339 ---------------------------------------------TTGCA D_novemcinctus300386 ---------------------------------------------CTGCG D_novemcinctus300476 ---------------------------------------------CTGCG D_novemcinctus300592 ---------------------------------------------CTGCG E_telfairi300164 ---------------------------------------------CTGTG E_telfairi300170 ---------------------------------------------ATGCG E_telfairi300217 ---------------------------------------------CTGCG E_telfairi300305 ---------------------------------------------CTGCG E_telfairi300342 ---------------------------------------------CTATG E_telfairi300578 ---------------------------------------------CTGCG E_telfairi300585 ---------------------------------------------CTGCG E_telfairi300594 -------------------------------------------------- E_telfairi300698 -------------------------------------------------- E_telfairi300748 ---------------------------------------------CTGCG E_telfairi300767 ---------------------------------------------CTGCG E_caballus300282 ---------------------------------------------CTGCG E_europaeus300060 ---------------------------------------------CAGTG E_europaeus300181 ---------------------------------------------TTGCA E_europaeus300200 ---------------------------------------------CCATG E_europaeus300684 ---------------------------------------------CTGCG F_catus300041 ---------------------------------------------TTGCA F_catus300060 ---------------------------------------------CTGCA F_catus300064 ---------------------------------------------CTGCG F_catus300073 ---------------------------------------------CTGTG F_catus300074 ---------------------------------------------CCACA F_catus300111 -------------------------------------------------- F_catus300182 ---------------------------------------------CCACG F_catus300219 ---------------------------------------------CAGCA F_catus300327 ---------------------------------------------ACGTG G_gallus300007 ---------------------------------------------ATGCG G_gallus300062 ---------------------------------------------ATGCG H_sapiens300675 ---------------------------------------------CTGCA H_sapiens300726 ---------------------------------------------CTGCG L_africana300306 ----------------------------------------------AACT L_africana300389 -------------------------------------------------- L_africana300476 ---------------------------------------------TGGCG M_mulatta300027 ---------------------------------------------CTGTG M_mulatta300051 ---------------------------------------------GTGCA M_mulatta300199 ---------------------------------------------TTATG M_mulatta300246 ---------------------------------------------TTGTG M_mulatta300257 ---------------------------------------------CTGAG M_mulatta300395 CTGCCAATATTCTCATTGCTCTGATT----AATAATCAGGACAGGCTAAA M_mulatta300641 ---------------------------------------------CTGCG M_murinus300147 ---------------------------------------------AAGTG M_murinus300228 ---------------------------------------------ATGAG M_murinus300246 -------------------------------------------------- M_domestica300146 ---------------------------------------------TTGCG M_musculus300834 ---------------------------------------------CTGCA M_musculus300854 ---------------------------------------------CTGCG M_lucifugus300089 ---------------------------------------------CTGCG M_lucifugus300190 ---------------------------------------------CTGCA M_lucifugus300523 ---------------------------------------------TTGCG M_lucifugus300787 ---------------------------------------------CTGCG O_anatinus304534 ---------------------------------------------CTGCG O_cuniculus300136 ---------------------------------------------TTGCA O_cuniculus300287 ---------------------------------------------TTGAG O_cuniculus300355 -------------------------------------------------- O_cuniculus300373 -------------------------------------------------- O_cuniculus300440 ---------------------------------------------TTGCG O_garnettii300090 ---------------------------------------------TTGTA O_garnettii300115 ---------------------------------------------ATGTG O_garnettii300317 ---------------------------------------------CTGCA O_garnettii300360 -------------------------------------------------- O_garnettii300398 ---------------------------------------------CTGCA O_garnettii300545 ---------------------------------------------CAGTG O_garnettii300564 ---------------------------------------------CTGCA O_garnettii300689 ---------------------------------------------CTGCG O_garnettii300699 ---------------------------------------------GTGCA O_garnettii300700 ---------------------------------------------CTGCG P_troglodytes300142 ---------------------------------------------CTGTG P_troglodytes300187 ---------------------------------------------CTGTG P_troglodytes300280 CTGCCAATATTCTCATTGCTCTGATTTTGTAATAGTCAGGACAGCCTAAA P_troglodytes300327 ---------------------------------------------TTATG P_troglodytes300387 ----------------------------------------------TTTA P_troglodytes300535 ---------------------------------------------CTGCA P_troglodytes300562 ---------------------------------------------CTGCG P_pygmaeus300013 CTGCCAATATTCTCATTGCTCTGATTTTGTAATAGTCAGGACAGCCTAAA P_pygmaeus300102 ---------------------------------------------CTGTG P_pygmaeus300192 ---------------------------------------------TTGTG P_pygmaeus300321 ---------------------------------------------CTGAG P_pygmaeus300334 ----------------------------------------------TTTA P_pygmaeus300453 ---------------------------------------------CTGTG P_pygmaeus300584 ---------------------------------------------CTGCA P_pygmaeus300710 ---------------------------------------------CTGCG R_norvegicus300146 ---------------------------------------------ATGCG R_norvegicus300777 -------------------------------------------------- R_norvegicus300887 ---------------------------------------------ATGCG S_araneus300018 ---------------------------------------------ATGTG S_araneus300089 ---------------------------------------------CTAAG S_araneus300128 ------------------------------------------------CA S_araneus300152 ---------------------------------------------CTGCA S_araneus300180 ---------------------------------------------CTGCA S_araneus300193 ---------------------------------------------CTGCA S_araneus300286 ---------------------------------------------CTATG S_araneus300298 ---------------------------------------------CTGAT S_araneus300365 ---------------------------------------------CTGCA S_araneus300379 ---------------------------------------------ATGCA S_araneus300415 ---------------------------------------------CTGTG S_araneus300418 ----------------------------------------------TAAA S_araneus300433 ---------------------------------------------CTGCG S_araneus300435 ---------------------------------------------CTGCA S_araneus300448 ---------------------------------------------TTGTG S_araneus300458 ---------------------------------------------ATGCA S_araneus300487 ---------------------------------------------TTATG S_araneus300510 ---------------------------------------------CTATG S_araneus300604 ---------------------------------------------CTATG S_araneus300659 --------------------------------------------CAGATA S_araneus300696 ---------------------------------------------CTGCG S_araneus300768 ---------------------------------------------CTGTG S_araneus300843 ---------------------------------------------ATGTG S_araneus300862 ---------------------------------------------CTGAG S_araneus300866 ---------------------------------------------CTAGG S_araneus300874 ---------------------------------------------CTGCA S_araneus300885 ---------------------------------------------CTGCA S_araneus300947 ---------------------------------------------CTGTG S_araneus300964 ---------------------------------------------CAGTG S_araneus300983 ---------------------------------------------CTGCG S_araneus300985 ---------------------------------------------CTGTG S_araneus300986 ---------------------------------------------CTGTG S_araneus300993 ---------------------------------------------CTGTG S_araneus301060 ---------------------------------------------CTGCT S_araneus301078 -----------------------------------------------TAA S_tridecemlineatus300002 ---------------------------------------------TTATG S_tridecemlineatus300032 ---------------------------------------------CTCTG S_tridecemlineatus300040 -------------------------------------------------- S_tridecemlineatus300117 ---------------------------------------------CTGTA S_tridecemlineatus300125 ---------------------------------------------CTGCG S_tridecemlineatus300142 -------------------------------------------------A S_tridecemlineatus300143 ---------------------------------------------CTGCG S_tridecemlineatus300178 ---------------------------------------------GTGCA S_tridecemlineatus300235 -------------------------------------------------- T_belangeri300157 ---------------------------------------------CTGCA T_belangeri300229 ---------------------------------------------TTGTT T_belangeri300251 ---------------------------------------------TTGCA T_belangeri300279 ---------------------------------------------CTGTG C_familiaris300042 -AATATT-CTTGCTGTTCTG--ATTTT-GTAA-TAATTGTGGCAGG-CTA C_familiaris300099 TGCTCTTAAAAAGTGTATTCAAAGATT--TTTTTAAT----GCAGGG-GG C_familiaris300117 --------------------------TTGTAA-TGCTCCTCCCAGG-CTA C_familiaris300146 -AATATTCC-TGCTGTTCTG--ATTTTGTAA--CAATTA------G-TTC C_familiaris300162 TGCTCTTAAAAAGTGTATTCAAAGATT--TTTTTAAT----GCAGGG-GG C_familiaris300169 -AATATT-CTTGCTAATCTG--ATTTT-GTAA-TAGTCAAGGCAGG-CTA C_familiaris300191 -AATATTCT-TGCTGTTCTA--ATTTT-GTAA-TAATCAGGGCAGG-CTA C_familiaris300197 -AATATT-CTCACTGTTCTG--ATTTT-GTAA-TAATCAGAGCAGG-CTA C_familiaris300302 CAGCAGCAGGAGCACCTGGGAACTTGTTAGAAACACAGTTTCCAGA-CTA C_familiaris300329 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCAAAGCAGG-CTA C_familiaris300455 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA C_familiaris300457 -AACATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA C_porcellus300100 -AATATTCT-CGCTGTTCTG--ATTGT-GTCA-TAATCAGGGCAGG-CTA D_novemcinctus300006 -AACGTT-CTCGCCGTCCTG--ATGTT-GTGA-TCGTCAGGGTAGG-CAC D_novemcinctus300128 -AATATT-CTCACTGCCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA D_novemcinctus300135 -AATATT-CTCTCTGTCCTG--ATTTT-GTGA-TAATCAGGGCAGG-GTA D_novemcinctus300141 -CATAATCT-TCCTG-------ATTTT-GTGA-CAATCAGGGTAGG-CTA D_novemcinctus300153 -AATATTTCTTGCTTTCCTG--ATTTT-GTGA-TAATGAGGACAGG-CTA D_novemcinctus300177 -AATAGT-CTCACTGTCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA D_novemcinctus300188 -AATATT-CTTGCTGTCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA D_novemcinctus300339 -AATATT-CTCACTATCCTG--GTTTT-GTGA-TAATCACGGCAGG-CTA D_novemcinctus300386 -AATATT-CTTGCTGTCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA D_novemcinctus300476 -AATATT-CACGCTGTCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA D_novemcinctus300592 -AATATT-CTCGCTGTCCTG--ATTTT-GTGA-TAATCAGGGTAGG-CTA E_telfairi300164 -AATATG-CTTACTGTCCTG--GTTCT-GTGA-TAGCCAGGGCAGG-CCA E_telfairi300170 -AATATT-CTCACTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300217 -AATATT-CTCGCTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300305 -AATATT-CTCGCTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300342 GAATATT-CTCGCTGTCCTG--ATTGT-GCGG-TAGCCAGGGCAGG-CTG E_telfairi300578 -AATATT-CTCGCTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300585 -AATATT-CTCGCTGTCCTG--GTTCT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300594 ---------ATACTAATAATAAATAAGACATGGTAGCCAGGGCAGG-CTA E_telfairi300698 ----------------CCTAGCACTTCAAGTG-TGGCCAGTGCAAA--TG E_telfairi300748 -AATATT-CTCGCTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_telfairi300767 -AATATT-CTCGCTGTCCTG--GTTTT-GTGG-TAGCCAGGGCAGG-CTA E_caballus300282 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCAGAGCAGG-CTA E_europaeus300060 -AATATT-CTTGCTGTTCTG--GTTTT-ATAA-TAATCAGGGAAGG-CTA E_europaeus300181 -AATATC-CTCACTGTTCAG--ATTCCCATAA-TAATAAGGGCAGG-CTA E_europaeus300200 -GATATT-CTCACCATTCTA--GTTTC-ACAA-TAATCGGGGGTGGACTA E_europaeus300684 -AATATT-CTCGCTGTTCTG--GTTTT-ATAA-TGATCAGGGCAGG-CTA F_catus300041 -AATATT-CGTGCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA F_catus300060 -AATATTCT-TGCTGTTCTG--ATTTT-GTAA-TAATCCGGGTGGG-CTA F_catus300064 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCATGGCAGG-CTA F_catus300073 --ACTGTTCCCGCCATCCTG--ATGTT-GTGA-TAATCAGCGCAGC-CTA F_catus300074 -ACTATT-CTCGCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA F_catus300111 --------------------------TTGTAA-TGGTCCTCCCAGG-CTA F_catus300182 -AATATT-CT---TGTTCTG--ATTTT-GTAA-TAATCAGGGGAGG-CTG F_catus300219 -AATATTCC-TGCTGTTCTC--ATTTTGTAAA-TAATCAAGACAGG-CTA F_catus300327 -AATATT-CTCACTGTTCTG--ATTTT-GTAA-TAATCAAGGCAGG-CTA G_gallus300007 -AATATT-CTCGCTGCCCTG--ATATT-CCGG-TGATCAGGGGAGG-CTA G_gallus300062 -AATATT-CTCGCTGCCCTG--ATATT-CCGG-TGATCAGGGGAGG-CTA H_sapiens300675 -GATATTCT-CACTGTTTTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA H_sapiens300726 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA L_africana300306 AAAAATT-CTCCGTGTCTTG--ATTTC-GTGA-TAACCAGGGCAGG-AGA L_africana300389 ------------CTGTTAAA--ACTCT-TTCC-TAATCAGGGCAGG-CTA L_africana300476 -AATATT-CTCGCTGTCCTG--ATTTT-GTGA-TAATCAGGGCAGG-CTA M_mulatta300027 -AATA-TTCTCAATGTTCTG--ATTAT-GTGA-TAGTCAGGATAAC-CTA M_mulatta300051 -AATATTCT-CACTGTTTTG--ATTTT-ATAA-T----AGGACAGG-CTA M_mulatta300199 -AATATT-CTCGCTATTCCG--ATTTT-GTAA-TAATCAGGACAGG-CTA M_mulatta300246 -AATATT-CTCACTGTTTTG--ATTTT-ATAA-TAGTAAGGACAAA-CTA M_mulatta300257 -AATATC--TTGCTGTTCTG--ACTTT-GTAA-TGG----GACAGG-CTC M_mulatta300395 CATTTGCTGTATATATTTTTTAATTTTTAATTTTAATTTTTGTGGGTACA M_mulatta300641 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA M_murinus300147 --ACTGTACTC----TTCT---ATTTT-GTAA-TAATCAGGACAGG-CTA M_murinus300228 -ACTATT-ATTACTGTTCTG--GTTTT-CTAA-TAATCAGGACAGG-CTA M_murinus300246 CCTCAAAAAGGGATTTTGAGTCAATTT-ATGG-AAAT-ATGACAGG-CTA M_domestica300146 -AATATT-CTCGCTGGCCTG--ATATT-ACTG-TGATCTGGTCAGG-CTA M_musculus300834 -GACATCCT-GGCTCTTCTG--GTCTG-CTAC-TAATCAGGTCAGG-CTG M_musculus300854 -AATATT-CTCGCTGTTCTG--ATTCT-GTGA-TAATCAGGACAGG-CTA M_lucifugus300089 -AATATTCT-CACTGTTCTG--ACTTT-GTAA-TTATCAGAGTAGG-CTA M_lucifugus300190 -AACACTCC-CACTGTTCTG--ATTTG-GTAA-TAATCAGGGCAGG-CTA M_lucifugus300523 -AATAAT-CTCCCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA M_lucifugus300787 -AATATT-CTCGCTGTTCTG--ATTTT-GTGA-TAATCAGGGCAGG-CTA O_anatinus304534 -AATATT-CTCGCTGGCCTG--ATATG-CCCG-TGATCAGGTCAGG-CTA O_cuniculus300136 -AATATGCT-CTCTGTTCTG--ATTTT-GTAA-TAATCAGGACAGG-CTG O_cuniculus300287 -AATATT-CTCGCTGCTCTG--ACTTT-GTAA-TAATTAGGACAGA-CTA O_cuniculus300355 ------------------------CTGTCAAACAAACAAAAAAAAA--A- O_cuniculus300373 -------------AATTAAAAAAGCGCACATGGTA---AGGACAGG-ATA O_cuniculus300440 -AATATT-CTCGCTGTTCTG--GTTTT-GCAA-TAATCAGGGCAGG-CTA O_garnettii300090 -TAAATT-GTTGTTAGTCTG--ATTTT-GTAA-TAG----GACAGG-CTA O_garnettii300115 -AGTATT-CTCACTGTTCTG--ATTCT-GTAA-TAATTAGGACAGG-CAA O_garnettii300317 -AATATTCT-TGCTGTTCTG--ATTTT-ATAA-TAATCAGTACAGA-CTA O_garnettii300360 ----------------AAGT---TGATAATGCCACAGATCCACAGG-CTA O_garnettii300398 -AATATTCT-CACTGTTCTG--ATGTT-GTAA-GTATCAAGACAGG-CTA O_garnettii300545 -AATATTCC-CGCTACTCTT--AATTTGGAA--TAATTGGGACAGG-CTA O_garnettii300564 -AATATTCT-TGCTGTTCTG--GTTTT-ATTA-TAATCAAGACAGG-CTA O_garnettii300689 -AATATT-CTCGCCGTTCTG--ATTTT-GTAA-TAATCAGCACAGG-CTA O_garnettii300699 -AATATTCT-CGCTGTTCTG--ATTTT-ATAA-TAATCAGCACAGG-CTA O_garnettii300700 -AATATTCT-CGCTGTTCTG--ATTTT-ATAA-TAATCAGCACAGG-CTA P_troglodytes300142 -AATATT-CTCGCTGTTCTG--ATTTT-GTGA-TAATCACGATAGG-CTA P_troglodytes300187 -AATA-TTCTCTGTGTTCTG--ATTAT-GTGA-GAGCCAGGACAGG-CTA P_troglodytes300280 CATTTGCTATAT---TTTTTTAATTTTTAATTTTAATTTTTGTGGGTATA P_troglodytes300327 -AATATA-CTCACCGTTTTG--ATTTT-ATAA-TAGTAACGACATG-CTA P_troglodytes300387 GAATGTCAAAATTGATTTTGTAATAGTCAGGA-----CAGGATAGG-CTA P_troglodytes300535 -GATATTCT-CACTGTTTTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA P_troglodytes300562 -AATATT-CTCGCTGTTCTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA P_pygmaeus300013 CATTTGCTATAT---TTTTTTAATTTTTAATTTTAATTTTTGTGGGTATA P_pygmaeus300102 -AATA-TTCTCAATGTTCTG--ATCAT-GTGA-GAGCCAGGACAGG-CTA P_pygmaeus300192 -AATATT-CTCACTGTTTTG--ATTTT-ATAA-TA-TAACAACAAG-CTA P_pygmaeus300321 -AATATC--TTGCTCTTCTG--ATTTT-GTAA-TAG----GACAGG-CTA P_pygmaeus300334 GAATGTCAAAATTGATTTTGTAATAGTCAGGA-----CAGGACAGG-CTA P_pygmaeus300453 -AATATT-CTCACTGTTCTG--ATTTT-GTAA-TAATCAGGACAGG-CTA P_pygmaeus300584 -GATACTCT-CACTGTTTTG--ATTTT-GTAA-TAGTCAGGACAGG-CTA P_pygmaeus300710 -AATATT-CTCGCTGTTCTG--ATTTT-GTAG-TAGTCAGGACAGG-CTA R_norvegicus300146 -AATATT-CTCGCTGTTCTG--ATTTT-GTGA-TAATCAGGACAGG-CTA R_norvegicus300777 -----------------------AAGAGGAGG-AGGAGGAGCCAGG-CTA R_norvegicus300887 -AATATT-CTCGCTGTTCTG--ATTTT-GTGA-TAATCAGGACAGG-CTA S_araneus300018 -AAT-ATTCTCACTGTTCTG--ATTTT-GTCA-TAATCAGGACAGG-CCA S_araneus300089 -AATA-CTCTCACTGTTCTG--ATTTT-GTCA-TAATCAGAAAAAG-ATG S_araneus300128 GATTCTAGTCTTATATTTTC---TTATAAAGCTTGGGAAACTCAAG-CTA S_araneus300152 -AAT-ATTATCATTGTTCTG--ATTTT-GTAA-TAATTGGGGTAGG-CTA S_araneus300180 -AAT-ATTCTTCATATTCTG--ATTTT-GTAA-TAATCGGGACAAG-CTA S_araneus300193 -AAT-ATTCTCACTGTTCTG--ATTTT-GTAA-TAATCAGGACAGG-CTA S_araneus300286 -AAT-ATTCTTGCTGTTCTC--ATTTT-GTAA-TAATCAGGGCAGA-TTA S_araneus300298 -AAT-CTTCTCAGTGTTCTG--ATTCT-GTAA-TAACCAGGACAGG-CTA S_araneus300365 -ACT-ACTCTTGCTGTTCTG--ATTTT-GTAA-TGATCAGGACAGG-CTA S_araneus300379 -AATACTCT-TGCTGTTCTA--ATTTT-ATAA-TAGTCAGGACAGG-CTA S_araneus300415 -AATGTT-CTTGTTGTTCTG--AATTT-GTAA-TAATTAGGGCAAG-CTA S_araneus300418 -TATAATTCTCATTGTTCTG--ATTTT-GTAA-TAATCAGAACAGG-CTA S_araneus300433 -AAT-ATTCTCACTGTTCTG--ATTTT-GTAG-TAATCAAGACAGG-CTA S_araneus300435 -AAT-AGTCTCGCTGTTCTG--ATTTT-GTAA-TAATCAGGACAGG-CTA S_araneus300448 -AAG---TCTCACTGTTCTG--ATTTT-ATAG-TAATCAGGACAGG-CTA S_araneus300458 -AATATTCT-CACTGTTCTG--ATTTT-TTAA-AAATTAGGACAGG-CTA S_araneus300487 -AAT-ATGCTCACTGTTCTG--ATTTT-GTAA-TGATCAGGACAGG-CTA S_araneus300510 -AATTATTCTTGCTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CCA S_araneus300604 -AAT-ATTCTTACTGTTCTT--ATTTT-GTAA-TAATCAGGACAGG-CTA S_araneus300659 -GACATTCTCTTCTGTTCTG--ATTTTTGTCA-TGATCAGGGCATG-CTA S_araneus300696 -AAT-ACTCTCACTGTTCTG--ATTTT-GTAA-TAATCAGGACAGG-CTA S_araneus300768 -AGT-ATTCTTGCTGTTCTC--ATTCT-GTGA-TAATCAGGACAGG-CTA S_araneus300843 -AAT-ACTCTTGCTGTTCTG--ATTTT-GTAA-AAATCAGGACAGT-CTA S_araneus300862 -AAT-ATTCTCACAGCTCTG--CTTTT-GCAA-AAATTAGGACATG-CTA S_araneus300866 -ACT-ATGCTCG-TGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA S_araneus300874 -AAT-ATTTTTGCTGTTCTG--ATTCA-GTAA-TAAT--GTGCAGG-CTA S_araneus300885 -AAT-GTTCTTGCTTTTCTG--ATTCT-GTGA-TACTCAGAACGGG-CTA S_araneus300947 -GAT-GTTCTCGTTATTCTG--ATTTT-GTAAATAATCAGGACAGG-CTA S_araneus300964 -AAT-ATTCTTGCTATTCTG--ATTTT-ATAA-TCATCAGGGCAGG-CTT S_araneus300983 -CAT-ATTCTCGCTGTTCTG--ATTTT-GGGA-TAATCAGGGCAGA-CTA S_araneus300985 -AAT-ATTCTCACTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGA-CTA S_araneus300986 -AAT-ATGCTCGCTGTTCTG--ATTTC-AAAA-TAATCATTACAAG-CTA S_araneus300993 -AGT-ATTCTCGCTGTTCTG--ATTTT-GTAA-TAATCAGAGTAG----- S_araneus301060 -AAT-ATTCTCACTGTTCTG--ATTTT-GTAA-TAATCAGGGCAGG-CTA S_araneus301078 AATTTATAATAATTATTGTAAAAAATTATTTTTTACA----GTAATCTAA S_tridecemlineatus300002 -AATA-TTATCATTGTTCTG--ATTTT-GTAA-TAATCAGAACAGA-CTA S_tridecemlineatus300032 -AATATT-CTCACTGTTCTG--ATTTT-GTAA-TAATCCGGACAGG-CTA S_tridecemlineatus300040 AAGTCAGATTAGAAAGACAGGTGGCACTGTCA-TTATCAGGACAGG-CTG S_tridecemlineatus300117 --ATATT-TTTGCTGTTCTG--AGTTA-GTAG-TAT-CGGGACAGG-CTA S_tridecemlineatus300125 -AACATT-CTCGCTGTTCTG--ATTTTTGTAA-TAATCAGGGCAGG-CTA S_tridecemlineatus300142 TTTCAAATATAAAAGTAATATGATTTTTGTAG-TAATCAGGACAGG-CTA S_tridecemlineatus300143 -AATATT-CTCGCTGTTCTGATGTTTT-GTAA-TGATCAGAACAGG-GTA S_tridecemlineatus300178 -AATATTCT-CACTGTTCTG--ATTTT-GTA--TAATCAGGATAG--CTA S_tridecemlineatus300235 ----------AACTAAACATACACTTCTCAAAAGAAGAAATATAAA--TG T_belangeri300157 -AGTA-TTCTCACTTTTCTG--ATTCT-GTAA-TAATCAGAACAGG-CTA T_belangeri300229 -AAT-ATCCTCTGT---CTG--ATTCT-GTAA-TAATCAGGACAGG-CTA T_belangeri300251 -CATATTCT-CGCTGTTCTG--ATTCT-GTAA-TAATCAGGACAGG-CTA T_belangeri300279 -AATA-TTCTCATGATTCTG--AATCT-GTAA-TAATCAGA-CAGG-TTA C_familiaris300042 A--ACATTCTGTATATCAA----------------GACCATGCAT-GTGT C_familiaris300099 A---CATTTGCTATATTAA----------------GATCACACAT-GTGT C_familiaris300117 A--ACATTTACTATATATT--------------AAGACCATGCAT-GTGT C_familiaris300146 A--ACATTTGCTA---TATTA-------------AAACCATGCAT-GTGT C_familiaris300162 A---CATTTGCTATATTAA----------------GATCACACAT-GTGT C_familiaris300169 AA-ACATTCACTATATTAAGA----------------CCATGCATG-TGT C_familiaris300191 A--ACATTCACAA-TATATTA-------------AGACTATGCAT-ACTT C_familiaris300197 A--ACATTTGCTGTATTAA----------------GACCATGCAT-GTGT C_familiaris300302 A--ATGTTCGCTATGTTAA----------------GACCGTGCGT-GTGT C_familiaris300329 A--ACATTCACTATATTA----------------ACACCATGCAT-GTGT C_familiaris300455 A--ACATTCGCTATATTAA----------------GACCATGCAT-GTGT C_familiaris300457 A--ACATTCACTATATTGAGA----------------CTATGCACG-TGT C_porcellus300100 A--ACATTTGCTA---TAGTA-------------AGACCATGCAT-GTGT D_novemcinctus300006 A--ACATTCGCTATGTTAGA---------------AACCATGCAT-GTGT D_novemcinctus300128 A--ACATTCGCTATAGTAAA---------------AAACATGTAT-GTGT D_novemcinctus300135 A--ACATTC-CTATATTAGA---------------AACCACGCAT-GTGT D_novemcinctus300141 A--GCATTCACTA-AAT-TAG-------------AAACCATGCAT-GTGT D_novemcinctus300153 A--ACATTTGCTATATTAGG---------------A-CCATGCAT-GTGT D_novemcinctus300177 A--GCATTCGCTGTATTAGA---------------AACCATGCAC-ATGT D_novemcinctus300188 A--ACATTTGCTATATTAG---------------AAACCATGCAT-GTGT D_novemcinctus300339 A--ACATTCACTGTATTAGA---------------GC-TGTGTAT-GTAT D_novemcinctus300386 A--ACATTCGCTGTATTAGA---------------AACCATGCAT-GTGT D_novemcinctus300476 A--ACATTCACTATATCAGA---------------AACCAGGCAT-GTGT D_novemcinctus300592 A--ACATTCGCTATATTAGA---------------AACCATGCAT-GTGT E_telfairi300164 A--ACAGTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300170 A--ACATTCGCTAGATTAA----------------GACCATGCAT-GTGT E_telfairi300217 A--CCATTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300305 A--CCATTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300342 A--ACATTCACTA---TAA----------------GACCATGCAT-GTGT E_telfairi300578 A--CCATTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300585 A--CCATTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300594 A--CCATTCGCTATATTAA----------------GACCATGCAT-GTGT E_telfairi300698 AG-AGACTGGATTCCTAATTTAATTTTAATTCTAAGACCATGCAT-GTGT E_telfairi300748 A--CCGTTTGCTATATAAAA---------------GACCATGCAT-GTGT E_telfairi300767 A--CCATTCGCTGTATTAA----------------GACCATGCAT-GTGT E_caballus300282 A--ACATTCGCTATATTAAAAT----A----------CCATGCATG-TGT E_europaeus300060 A--ACATTCACTACATTAA----------------GACCATGCAT-GTGT E_europaeus300181 A--ACATATGCTATATTA----------------AGATCATGCAT-GTGT E_europaeus300200 A--ACACTCACTACAGTAA----------------AGCCATGCAT-GTGT E_europaeus300684 A--CCATTCGCTACATTAAGA----------------CCACGCATG-TGT F_catus300041 A--ACATTCACTATATTAAGA----------------CCATGCATG---T F_catus300060 A--ATATTCGCTG---TATTA-------------AGACTATGCAT-ATGT F_catus300064 A--ACATTCGCTATATTAA----------------GACCATGCAT-GTGT F_catus300073 A--GCACTCGCCACGTTAA----------------GACCATGCAC-GTGA F_catus300074 A--ACATTCTCTATGT-AA----------------GACCGTGCAT-GTGT F_catus300111 A--TCATTCACTATATT----------------AAGACCAGGGAC-ATGT F_catus300182 A--ACATTCGCTGTATTTGACC----ATGCA-TGTGTCCATGCAT-GTGT F_catus300219 A--ACCTTTGCTA---TATTA-------------AGATCATGCAT-GTCT F_catus300327 A--ACATTCACTATATTAA----------------GACCATGCAT-GTGT G_gallus300007 G--ACATTCGCTATATTAA----------------AACTATGCATTGTGT G_gallus300062 G--ACATTCGCTATATTAA----------------AACTATGCATTGTGT H_sapiens300675 A--CCATTCACTT---TATTA-------------AGACCATGCAT-ATAT H_sapiens300726 A--ACATTCGCTATATTAAGA----------------CCATGCATG-TGT L_africana300306 G--ACATTCACTTTATGAA----------------GATAATGAAT-GTGT L_africana300389 A--ACGTCCGCCATATTAAGA----------------CCATACATG-CAT L_africana300476 A--ACATTCGCTATAGTAAAA----------------CCATGCATG-TGT M_mulatta300027 A--ACATTT---------------GCTACAT-TAAGAATATGCAT-ATGT M_mulatta300051 A--CCATTCACTT---TATTA-------------AGATCATGCAT-ATAT M_mulatta300199 A--ACATTCACAATATTAA----------------GACCATGCAT-GTAT M_mulatta300246 A--ACATTCACTATATTAA----------------GACCATGCAT-GTGT M_mulatta300257 TAAAGATTGGCTATATTAAGG----------------CCACGCATG-TGT M_mulatta300395 A---CATTCGCTATATTGA----------------GATCATGCAT-GTGT M_mulatta300641 A--ACATTCGCTATATTAAGA----------------CCATGCGTG-TGT M_murinus300147 A--ACATTCGCTATGTTAA----------------AGCTATGCAC-ATGT M_murinus300228 A--ACATTTACTACGTTAA----------------GACCATGCAT-GTGT M_murinus300246 A--ACATTCGCTATATTAA----------------AACCATGCATG-TGT M_domestica300146 G--ACATTCGCTAGATTAA----------------GACCATGCATTGTGC M_musculus300834 A--ACACTGACTA---TATTA-------------ATGTCAGGGAT-GTGT M_musculus300854 G--ACATTCGCTATAGTAAGA----------------CCATGCATG-TGT M_lucifugus300089 T--ACATTTGCTT---TATTA-------------AGACCATGCAT-GCGT M_lucifugus300190 A--GCGTTTGCTA---TATTA-------------AGACTATGCAC-GTGT M_lucifugus300523 C--ACATTCGCTATATTAAGA----------------CCAGGCATG-TGT M_lucifugus300787 A--ACATTCGCTATATTAAGA----------------CCATGCATG-TGT O_anatinus304534 G--ACATTCGCTATATTGA----------------GACCCAGCATTGTGT O_cuniculus300136 A--ACGTTTGCTA---TATT---------------GACTATGTAT-GTGT O_cuniculus300287 A--ACATTCGCTATATTAAGA----------------CCATACATG-TAT O_cuniculus300355 -------TCGCTATATCAA----------------GACCATGCAT-GTGT O_cuniculus300373 G--ACATTTGCTGTATTAA----------------GACCACGCGT-GTGT O_cuniculus300440 A--ACATTCGCTATATTAAAA----------------CCATGCATG-TGT O_garnettii300090 ---ACATTCACTTCGTTGAGA----------------CCATGCATG-TGT O_garnettii300115 A--ACATTTGCTGTATTA----------------AGACAACACAC-ATGT O_garnettii300317 A--ACATTCACTA---TATAA-------------AGACCATGCAT-GTGT O_garnettii300360 A--ACATTCGCTATATAAA----------------AACCATGCAT-GTGT O_garnettii300398 A--ATATTCACTA---TATAG-------------AAACCATGCAT-GTGT O_garnettii300545 A--ACATTTGCTA---TAT-A-------------AAAACATGCAC-GTGT O_garnettii300564 A--ACACTCGCTA---TATAA-------------AAACTATGCCT-GTGT O_garnettii300689 A--ACATTCGCTATATAA----------------AAACCATGCAT-GTGG O_garnettii300699 A--ACATTTGCTA---TATAA-------------AAACCAGGCAT-GTGT O_garnettii300700 A--ACATTCGCTA---TATAA-------------AAACCATGCAT-GTGT P_troglodytes300142 A--ACATTCGCAATATTAA----------------GACCATTC---GCAA P_troglodytes300187 A--ACATTT---------------GCTACAT-TAAGACCATGCAT-GTGT P_troglodytes300280 A---CATTCACTATATTAA----------------GATCATGCAT-GTGC P_troglodytes300327 A--ACATTCACTATATTAA----------------GACCACGCAT-GTGT P_troglodytes300387 A--ACAGTCGCTATATTAA----------------GATCATGTAC-GTGT P_troglodytes300535 A--CCATTCACTT---TATTA-------------AGACCATGCAT-ATAT P_troglodytes300562 A--ACATTCGCTATATTAAGA----------------CCATGCATG-TGT P_pygmaeus300013 A---CATTCACTATATTAA----------------GATCATACAT-ATGC P_pygmaeus300102 A--ACATTT---------------GCTACGT-TAAGACCATGCAT-ATGT P_pygmaeus300192 A--ACATTCACTATATTAA----------------AACCACGCAT-GTGT P_pygmaeus300321 TAAAGATTGACTATATTAAGG----------------CCACGCACA-TGT P_pygmaeus300334 A--ACATTTGCTATATTAA----------------GACCATGCAT-GTGT P_pygmaeus300453 A--ACATTCGCAATATTAA----------------GACCATGCAT-GTGT P_pygmaeus300584 A--CCATTCGCTT---TATTA-------------AGACCATGCAT-ATAT P_pygmaeus300710 A--ACATTCGCTATATTAAGA----------------CCATGCATG-TGT R_norvegicus300146 A--ACATTCGCTATAGTACGA----------------CCATGCATG-TGT R_norvegicus300777 G--ACATTCACTATAGTAA----------------GACCATGCATG-TGT R_norvegicus300887 A--ACATTCGCTATAGTACGA----------------CCATGCATG-TGT S_araneus300018 A--ACTTTTACAT-------------AATAA-TAAGATCATGCAT-GTGT S_araneus300089 A--ATATTC---------------TCTATAA-TGATATCACACGT-GTC- S_araneus300128 A--ACATTCGCTAT---GA----------------GACCATGCAT-GTGT S_araneus300152 A--ACATTTGCATGTGTCCATGCATGTGTAAGTAAGATCACACTT-GTGT S_araneus300180 A--ACATTCGT---------------TATAA-TAATACCACACAT-TTGT S_araneus300193 A--ACAT---TC-------------CTA----TAAGACTATACAT-GTGT S_araneus300286 A--ACAT---GTA------------CTATAA-TAAAACCATGCAT-GTGT S_araneus300298 A--ACATTA---------------GCCATAT-TGAG------CAT-GTGT S_araneus300365 A--ATAT---TCT------------CTA----TAA---TGCACAT-GT-- S_araneus300379 A--ACATTTGCTATAATATGA-------------TAA-------A-GTAT S_araneus300415 A--ACATTCATTATAATA----------------AGACCATGGAT-GTGT S_araneus300418 A--ACAGTC---------------GCTGAAA-TAAGACCATGCAT-GTCT S_araneus300433 A--ACATTTGC---------------TATAA-TAAGATCATGCAT-GTGT S_araneus300435 A--AGAT---TTG------------CTATTA-TAAGACCATCCAT-ATGT S_araneus300448 A--ACAT---TTG------------CTACAA-TAAGACAGTACAT-ATGC S_araneus300458 A--GCATTCGCTA---TA----------------AGACCATGCAT-GTGC S_araneus300487 A--AAAT---TTG------------CCAAAA-CAAGGCCATGAAC-TTGT S_araneus300510 A--ATATTCGGTA------------TAATAA-TAAGTCTTTGCAT-TTGT S_araneus300604 A--ACAT-----G------------CTATAA-TAAGACCATGCAT-TTGT S_araneus300659 A--ATATTTGTAGTTAAATAT-------------TTGCTACATTA-ATAT S_araneus300696 A--ATGT---TCG------------CTATAA-TAAGACTATGCAT-GTGT S_araneus300768 A--ACATCTG---------------CTGTAA-TAAGACCATGCAT-GTGT S_araneus300843 A--ACAT---TTG------------CTA----TAAGACCATGCAT-GTGC S_araneus300862 A--ACTTT--CAT-------------TATAA-TAAGATCATGCAT-GTGT S_araneus300866 A--ACATCCT---------------CTCTAA-TAAGACCATGTAT-GTGT S_araneus300874 A--ACTT---TTG------------CTACAA-TAAGATCATTCAG-GTGT S_araneus300885 A--ACATTCAC---------------TCTAA-CAAGGCCATGTGT-GTGT S_araneus300947 A--GCATTCAG---------------TATAA-TAAGTCCAAGCAT-GTGT S_araneus300964 G--ATCACTCG--------------CTATAA-TAAGTCCATGCAT-ATGT S_araneus300983 A--ACGT---TTG------------CTATAC-TGAGACCATTCAC-A-GA S_araneus300985 A--AT-ACTCG--------------CTATAA-TAAAACCATGCAT-GTGT S_araneus300986 A--ATATCTG---------------CTATAA-TAAGACCATACAT-GTGT S_araneus300993 -----ATTTGT---------------TATAA-TAAGACCATGATT-GTGT S_araneus301060 A--ACATTT---------------GCTAAAT-TAAGACTAGGCAT-GTGT S_araneus301078 A---CATTTACTGTAATAA----------------GACCATGCAT-ATGT S_tridecemlineatus300002 A--GCATTT---------------TCTATAT-TAATAATATACAT-ATGT S_tridecemlineatus300032 A--ATTTTCCCTATATCAA----------------GATCATGCAT-GGGT S_tridecemlineatus300040 A--ATATTCACTATAGA----------------AAGACTATGCAT-GTGT S_tridecemlineatus300117 A--ACATTCACTACA--AAGA----------------CCATGCA-G-TGT S_tridecemlineatus300125 A--ACATTCGCTATATTAAGG----------------CCATGCACGGTGT S_tridecemlineatus300142 A--ATATTCACTATATTAA----------------GACCATACATAATGT S_tridecemlineatus300143 A--ACATTCGCTATATTAAGC----------------CCACGTCTG-TGT S_tridecemlineatus300178 A--ACATATGCTG---TATTA-------------AGACCATGCAT-TTGT S_tridecemlineatus300235 G--ACATTCAATATATAAT----------------GACTATGCAT-GTGT T_belangeri300157 A--ACATTT---------------GCTACAT-TAAGACCACACAT-ATAT T_belangeri300229 A--ACATTC---------------ACTATAG-TAAGATCATGTGT-GTGT T_belangeri300251 A--ACATTTGCTA---TATTA-------------AGACCATGCAT-GTGT T_belangeri300279 A--CCGTTT---------------GATATAT-TGAGAGCATGCAT-ATGT C_familiaris300042 TCCT-----------AGATCTAGTTCTTC---CCC--TAG----TCTGG- C_familiaris300099 CTCC-----------AGACCTAATTCTTT-CTCTA----GG---TCTGG- C_familiaris300117 CCCC-----------AGACCTAGTTCTGT-----TTCTAAC---TCTGG- C_familiaris300146 T---CCC--------AGACCTACTTCTT----TCC-CTGGG---TCTGA- C_familiaris300162 CTCC-----------AGACCTAATTCTTT-CTCTA----GG---TCTGG- C_familiaris300169 CCCC-----------AGACCTAGTTCTTT---CCC--TAGG---TCTAGT C_familiaris300191 C---TCC--------AGATCTACTTTTT----TCC-CTAGG---TCTGT- C_familiaris300197 CCCC-----------AGACTTAGTTCCTT---CCC--TAGG---TCTGG- C_familiaris300302 CGCC-----------GGTTCTCGTTCCCT-----CCCTAGG----CCGGG C_familiaris300329 CCCC-----------AGACCTAGTTCTTT---CCT--TAGG---TCTGA- C_familiaris300455 CCCC-----------AGACTTAGTTCTTT---CCC--TGGG---TCTGG- C_familiaris300457 CCCC-----------AGACCTAGTTCTTT---CCC--TAGG---TCT-GG C_porcellus300100 ---CCCC--------AGACCTTGATCTT----TCC-CTAGG---TCTGG- D_novemcinctus300006 CC-CC----------AGACCTAGTTTTCC---TCC-TTAGG---GCTGG- D_novemcinctus300128 CC-CC----------AGACCTAATTTTTT---TCC-CTAGG---GCTGG- D_novemcinctus300135 CC-CC----------AAACCTAGTTTTTC---TCC-CTAGG---TTTGG- D_novemcinctus300141 C---CGC--------AGGTCTAGTTTTTC---TCC-CTAGG---TCTGG- D_novemcinctus300153 CC-CC----------AGACCTACTTTTTC----CC-CTAGC---TCTGG- D_novemcinctus300177 CC-CC----------AGACCTCGTTTTTC---TCC-CTTGG---GCTGG- D_novemcinctus300188 CTCC-----------AGATCTAGTTTTTC---TCC--CTAG---GGCTGG D_novemcinctus300339 CC-AC----------AGACCTAGTCTTTT---CCCTCTAGG---TCTGA- D_novemcinctus300386 CC-CC----------AGACCTAGTTTTTC---CCC-CTATT---TCTGG- D_novemcinctus300476 CC-CC----------AGACCTAGTTTTTC---TCC-CTAGG---GCTGA- D_novemcinctus300592 CC-CC----------AGACCTAGTTTTTC---TCT-CTAGG---GCTGG- E_telfairi300164 CC-CC----------AGGCCGAGTTC-TT---TCC-CTGAG---CCTGG- E_telfairi300170 CC-CC----------AGGCTGGGTTC-TT---TCC-CTGAG---CCTGG- E_telfairi300217 CC-CC----------AGGCTGAGTTC-TC---TCC-CTGAG---CCTGG- E_telfairi300305 CC-CC----------AGGCTGAGTTC-TC---TCC-CTGAG---CCTGG- E_telfairi300342 CT-C-----------AGGCCAAGTTC-TT---TCC-CTGAG---CCTGG- E_telfairi300578 CC-CC----------AGGCTGAGTTC-TC---TCC-CTGAG---CCTGG- E_telfairi300585 CC-CC----------AGGCTGAGTTC-TC---TCC-CTGAG---CCTGG- E_telfairi300594 CCCC-----------AGGCTGAGTTCTCT-----CCCTGAG---CCTGG- E_telfairi300698 CCCC-----------AGGTTCAGTTCTTT-----CCCTGCA---TCTGG- E_telfairi300748 CC-CC----------AGGCTGAGTTC-TT---TCC-CTGAG---CCTGG- E_telfairi300767 CC-CC----------AGGCTGAGTTC-TC---TCC-CTGAG---CCTGG- E_caballus300282 CCCC-----------AGACCTAGTTCTTT---CCC--TAGA---TCT-GG E_europaeus300060 C-CC-----------CAGA--------------CC--TAGT---TCTGG- E_europaeus300181 TCCC-----------AGACCTAATTTTTT---T-----AAA---TAATA- E_europaeus300200 C-CC-----------AGATTTATTTCTTT---TCC--TAGT---TCAGG- E_europaeus300684 CCCC-----------AGACCTAGTTCTTT---ACC--TAGT---TCT-GG F_catus300041 CCCC-----------AGACCTAGTTCTTT---GCC--TAGG---TCT-GG F_catus300060 C---TCC--------AGAAATAATTCTT----TCC-CTAGG---TCTGG- F_catus300064 CCCC-----------AGACTTAGTTCTTT---CCC--TGG----TCTGG- F_catus300073 CCCC-----------AGACCGACTTCTCT-----CCCTGGG---TCTGC- F_catus300074 CCTC-----------AGACCTAGTTCTTT---CTC--TAGC---TCTGG- F_catus300111 CCCC-----------AGACCTAGTCCTTT-----GTCTAGG---TCTGG- F_catus300182 CCCG-----------AGATCTAGTTCTTA---CCC--TAGG---TCTGG- F_catus300219 C---CCC--------AAACGTAGTTCTT----TCC-CTGGA---TCTGG- F_catus300327 CCCC-----------AGACTTAGTTCTTT---CCC--TAGG---TCTAG- G_gallus300007 CCTCC----------AGGACTGGACTGCT---GCT-CTAGT---ACTGG- G_gallus300062 CCTCC----------AGGACTGGACTGCT---GCT-CTAGT---ACTGG- H_sapiens300675 C---CCC--------AGAACTAGTTCTT----TCC-TGAGG---TCTAG- H_sapiens300726 CCCC-----------AAACCTAGTTCTTT---CCC--TAGG---TCT-GG L_africana300306 CC-CC----------AGGTCTAGTGC-CT---TCC-CTAAG---TCTGG- L_africana300389 CCCC-----------AGGCCTAGTTCTTT---CCC--AAGG---TCT-GG L_africana300476 CCCC-----------AGACCTAGTTCTTT---ACC--TAGG---TCT-GG M_mulatta300027 ACCC-----------ACATGTAGCC-ATT-C----CCTAGG---TCTGG- M_mulatta300051 C---CCC--------AGAACTAGTTATT----TCC-CTAGG---TCTAG- M_mulatta300199 CCCT-----------AGACCTAGTTATTT---CCC--CAGG---TCTGG- M_mulatta300246 C-TT-----------GGACCTACCTCTTT---CCC--TAGG---TCTGT- M_mulatta300257 CCCC-----------AGACCTAATTCTTT---CCC--TAGG---TCT-GG M_mulatta300395 CCTC-----------AAACCTAGTTCTTT-TCCTA----AG---TCTAG- M_mulatta300641 CCCC-----------AGACCTAGTTCTTT---CCC--TAGG---TCT-GG M_murinus300147 CCCC-----------AGACCTAGTTCTTT-----CCCTAGG---TTTGG- M_murinus300228 CTCC-----------AGAAATCGTTCTTT---TCC--TAGG---TTTAG- M_murinus300246 CCC------------AGACCTAGTTCTTT-----CCCTAGG---TTTGG- M_domestica300146 CT-CC----------AGAACTAGTTCTCT---TCC-CTAGT---TTTGG- M_musculus300834 C--CCC---------AGACCTAG-----------------G---TGTGG- M_musculus300854 CCCC-----------AGACCTAGTTCTTT---ACT--TCAG---TCT-GG M_lucifugus300089 C---CTT--------AGACCTAGTTCTT----TCC-CTAGG---TCTGG- M_lucifugus300190 TGTCCCC--------AGACCTAGTTCTT----TCC-CTAGG---TCTGA- M_lucifugus300523 GCCC-----------AGACCTAGTTCTTT---CCC--TGGG---TCT-GG M_lucifugus300787 CCCC-----------AGACCTAGTTCTTT---CCC--TAGG---TCT-GG O_anatinus304534 CC-CC----------GGGATTAGTCC-TT---GCC-CTAAT---CCTGG- O_cuniculus300136 ---CCCC--------AATTCTAGTTCTT----TCC-CTATG---TCTGT- O_cuniculus300287 CCCC-----------AGGCCTAGTTCTTT---CCC--TGTG---TTT-GG O_cuniculus300355 CCCC-----------AGGCCTAGTTCTTT-----CCCTATG---TCTGG- O_cuniculus300373 CCCC-----------AGACCTGGTTCTCT-----CCCTATG---TCTGC- O_cuniculus300440 CCCC-----------AGGCCTAGTTCTTT---CCC--TATG---TCT-GG O_garnettii300090 CCCC-----------AAACCTAATTCTTT---GCC--TAGG---TCT-GC O_garnettii300115 CC---------------ATCTAGCTTTAT---------AAA---TACTG- O_garnettii300317 C--CCCC--------AGACCTAGTTCTT----TTC-CTACG---TTT--- O_garnettii300360 CCCCC----------AGACCTAGTTCTTT-TCCTA----GG---TTTGG- O_garnettii300398 C--CCC---------AGACCTAGTTCTC----TCC-TTAGG---TTTGA- O_garnettii300545 C---CAC--------AGACTTAGTGCTT----TCC-CTAGG---TTTGG- O_garnettii300564 C--CTC---------AGACCTAGATCTT----TCC-CTAGG---TTTGG- O_garnettii300689 TTTCTATATAGTTCTAGACCTAGTTCTTT---TCC--TAGG---TTTGG- O_garnettii300699 C--CCC---------AGACCTAGTTCTT----TTC-CTAGG---TTTGG- O_garnettii300700 C--CCCC--------AGACCTAGTTCTT----TTC-CTAGG---TTTGG- P_troglodytes300142 TATT-----------AAAC-TAGTTCTTT---CCC--CAGG---TCTGG- P_troglodytes300187 ACCC-----------AGATGTAGCCCATT-C----CCTAGC---TCTGG- P_troglodytes300280 CCCC-----------AAACCTAATTCTTT-TCTTA----AG---TCTAG- P_troglodytes300327 C-TC-----------GGACCTACCT--TT---CCC--TAGG---TCTGT- P_troglodytes300387 CCCT-----------AGACCTAGTTCTTT-----CCCTACG---TCTGT- P_troglodytes300535 C---CCC--------AGAACTAGTTCTT----TCC-CGAGG---TCTAG- P_troglodytes300562 CCCC-----------AAACCTAGTTCTTT---CCC--TAGG---TCT-GG P_pygmaeus300013 CCCC-----------AAACCTAATTCTTT-TCTTA----AG---TATAG- P_pygmaeus300102 ACCC-----------AGATGTAGCCCATT-C----CCTAGC---TCTGG- P_pygmaeus300192 C-TC-----------GGACCCACCTCTTT---CCC--TAGG---TTTGT- P_pygmaeus300321 CCCC-----------AGACTTAATTCTTT---CCC--TAGG---TCT-GG P_pygmaeus300334 CCCT-----------AGACCTATTTCTTT-----CCCTACG---TCTGT- P_pygmaeus300453 TCCT-----------AGACCTAGTTCTTT---CCC--CAGG---TCTGG- P_pygmaeus300584 C---CCC--------AGAACTAGTTCTT----TCC-CTAGG---TCTAG- P_pygmaeus300710 CCCC-----------AAACCTAGTTATTT---CCC--TAGG---TCT-GG R_norvegicus300146 CCCC-----------AGACCTAGTTCTTT---ACC--TGGG---TCT-GG R_norvegicus300777 CACC-----------AGAACTAGTTCTTT-----ACCTGGG---TCTGG- R_norvegicus300887 CCCC-----------AGACCTAGTTCTTT---ACC--TGGG---TCT-GG S_araneus300018 CCCC-----------AGACCTAGTTCTTT-ACCTACCTAGA---TCTGG- S_araneus300089 --CC-----------GGACTTAGTTTTTT-C-----CTAGG---TCTGA- S_araneus300128 CCCC-----------AGGCCTGGTTCTTT-ACCTACCTAAG---TCTGG- S_araneus300152 CCTC-----------AGACCTAGTTCTTT-ACCTACCTAGG---TCTGA- S_araneus300180 CCT------------GGACCTAGGTCTTT-GCCTACCTAAG---TCTGG- S_araneus300193 TCCT-----------ATGCATAGTTCTTT-ATCCACCTAGG--TCTCCT- S_araneus300286 CCCT-----------ACACTTAGTTTATT-ACCTAC--AGG---TC-TA- S_araneus300298 TCCC-----------AAACCAAGTTCTTA-ATCTACCTAGG---TCTGA- S_araneus300365 -CCC-----------AGACCTAACTCTTT-ATCTACATAGG--TATAGT- S_araneus300379 CAGATCT--------GGTACTTAATCCG----TC---TAGG---TCTGG- S_araneus300415 CCCT-----------AGACCTAGTTTTTT---T-----TTT---TTCAT- S_araneus300418 TCCC-----------AGATTTAGTTCTTT-CACCACCTAGG---TCTGC- S_araneus300433 CCCC-----------AGGCCTGGTTCTTT-ACCTACCTAAG---TCTGG- S_araneus300435 CCCC-----------AGACCTAGTCATTT-ACCTATCTAGG--TCGGGT- S_araneus300448 TCCT-----------AGACCTAGTTCCTT-ACCAACTTA----------- S_araneus300458 C--CC----------AGACCTAGTTCTT----TAT-CTAGG---TTTGG- S_araneus300487 CGCC-----------AAACCTAGTTCTTT-ACCTATTTAGG---TCCAG- S_araneus300510 CCCC-----------AGACCTAGTTCTTT-ACCTAC--CTT---TCCTA- S_araneus300604 CTGT-----------AGACCTAGTTTTTT-ACTGACTTAGG---ACTGG- S_araneus300659 CATGTCC--------AGAACTAATTCTT----TCC-CTAGG---TCTGG- S_araneus300696 GTCC-----------AGACCCAGTTT-TT-ACCCACCTAGG---TCTGG- S_araneus300768 CCCC-----------AGATCGAGTTCTTT-ACCCACCTAGG---TCTGG- S_araneus300843 CCCC-----------AAATCTACCTCTTT-ACCGACTTAAG--TCTGAT- S_araneus300862 CCCC----------------TAGTTCTTT-ACCTACCTGGG---TCTGG- S_araneus300866 CCCC-----------AGACCTAGTTCTTT-ACCCA----GG---TCTGG- S_araneus300874 TCTC-----------AGACCTAGTTTTTT-ATCTACTCAG---TTCTGT- S_araneus300885 GCCC-----------AGGCCTAGTTCTTTTGTCTACCTTGG---TCTGG- S_araneus300947 CCCC-----------AGGCCCAGTT-TTTTATCTACCTTGG---TCTGG- S_araneus300964 CCCC-----------AGACCTAGCTCTTT-ACCTATGAAGG---TCTGG- S_araneus300983 TCTC-----------CAACCTAGTTCTTT-GCTTACCCAGGGCTGCTGG- S_araneus300985 CCCC-----------ACACCTAGTTCTTT-ACCTCCCTAAG---TCTGG- S_araneus300986 CCCC-----------AGACCTAGTTCTTT-ACCTACCTAAA---TCTGG- S_araneus300993 CCCC-----------AGGCCTAATTCTTT--ACTACCTAGG---TCTGA- S_araneus301060 CCCC-----------AGACCTAGTTCTTT-ACCTACCTAAG---TCTGA- S_araneus301078 CCCT-----------AGACCTGGTTCTTT-ACCTACCTAGG---TCTGG- S_tridecemlineatus300002 CTCC-----------AGACCTAGTTATAT-T----TATAGG---TTTAG- S_tridecemlineatus300032 CTCC-----------ATACTTAGTTCTCT---CGC--TGGG---TCTGG- S_tridecemlineatus300040 CCCC-----------AGACCTATTTCTTT-----CTCCAGG---TCTGA- S_tridecemlineatus300117 CCCT-----------AGACCTAATTCTTT---CAC--TGGG---TCT-GG S_tridecemlineatus300125 CCCC-----------AGACCTAGTTCTTT---CCC--TGGG---TCT-GG S_tridecemlineatus300142 CCCC-----------AGATGTAGTTCTTT-----CCCTGGG---TCTGG- S_tridecemlineatus300143 CCCC-----------AGACCTCCTTCTTT---CCC--TGGG---TCT-GG S_tridecemlineatus300178 C---CTC--------GGACCTAGTTTAT----TCT-TTAG----TCTGG- S_tridecemlineatus300235 CCCC-----------AGACATAGTTCTTT-----CCCTGGG---TCGGA- T_belangeri300157 CTCC-----------AGACCTTGTTCTTT-C----CCTATG---TCTGG- T_belangeri300229 CCCC-----------AGACCTAATTCTTT-CTCTAT----G---TCTGA- T_belangeri300251 ---TCCC--------AGATCTAGTTCTT----GCC-TTACG---TCTGG- T_belangeri300279 CCCC-----------AAACCTAGTTCTTT-C----CCTTTG---TCTGG- C_familiaris300042 -TTTTAT-CAATGCTG-GTGATTAAC----------- C_familiaris300099 -TTTTAT-AAAGACTG-ATGATAAAC----------- C_familiaris300117 -CTTTAT-TAATGCTG-GTGATAAGT----------- C_familiaris300146 -TTTTAT-AAACGCTG-GTGATAAAA----------- C_familiaris300162 -TTTTAT-AAAGACTG-ATGATAAAC----------- C_familiaris300169 -TTTTAT-AAATGTTG-GTGATCAAC----------- C_familiaris300191 -TTTTTTTAAATGCTG-GTGATAAAC----------- C_familiaris300197 -TTTTAT-CAGTGCTG-GTGATAGAC----------- C_familiaris300302 -TTTTAT-AAATGCTA-GTGATACAC----------- C_familiaris300329 -TTTTAT-CAAGGCTG-GTGATAAAT----------- C_familiaris300455 -TTTTAT-CAATGCAG-GTGATAAAC----------- C_familiaris300457 -TTTTAT-CAATGCTG-GTGATAAAC----------- C_porcellus300100 -TTTTAT-AAATGCTG-CTGATAAAT----------- D_novemcinctus300006 -TTTTTA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300128 -TTTTTA-AAATGCTG-GTGATAAAC----------- D_novemcinctus300135 -TTTTTA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300141 -TTTTTA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300153 -TGGTTA-AAATGCTG-GTGATATAC----------- D_novemcinctus300177 -TTTTGA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300188 TTTTTAA-CCAAGCCT-GATTTATTATA--------- D_novemcinctus300339 -TTTTTA-AAATGCTG-GTGATAAAC----------- D_novemcinctus300386 -TTTTTA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300476 -TTTTTA-GAATGCTG-GTGATAAAC----------- D_novemcinctus300592 -TTTTTA-GAATGCTG-GTGATAAAC----------- E_telfairi300164 -TTTTAT-AAATGCAG-GTGATAAGT----------- E_telfairi300170 -TTT-AT-AAATGCTG-GTGATTAGA----------- E_telfairi300217 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300305 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300342 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300578 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300585 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300594 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_telfairi300698 -TTTTCT-AAATGGTG-GTGCTAAGT----------- E_telfairi300748 -TTTTAT-AAATGCTG-GTGATAAGT----------- E_telfairi300767 -TTTTAT-CAATGCTG-GTGATAAGT----------- E_caballus300282 -TTTTAT-AAATGCTG-GGGATAAAC----------- E_europaeus300060 -GTTTAT-AAATGCTG-GTGATAAAC----------- E_europaeus300181 -TTTTAT-TTATTTTG-AATAAAGAC----------- E_europaeus300200 -TTTTAT-AAATGTTG-GTAGCAAAC----------- E_europaeus300684 -CTATCT-AAATGCGG-GTGATAAAC----------- F_catus300041 -TTTTCT-CAGTTGTG-GTGGGAAAC----------- F_catus300060 -TTTTGT-TAATGCTT-GTGATAAAT----------- F_catus300064 -TTTTAT-CAATGCTG-GTGATAAAC----------- F_catus300073 -TTTTAT-CAACGCTG-GTGAGAAAC----------- F_catus300074 -TGTTGT-CAATGCTG-GTGATAAAC----------- F_catus300111 -TTTGAT-AAGTGCTG-GTGATCAAC----------- F_catus300182 -TTTTAT-CAATGCTC-ATGATAAAC----------- F_catus300219 -TTTTAT-CAATGCTG-GTGATTCAT----------- F_catus300327 -TTTTAT-CAATGCTG-GTGATAAAC----------- G_gallus300007 -CTTTGA-AAATGCTA-GTGACATAC----------- G_gallus300062 -CTTTGA-AAATGCTA-GTGACATAC----------- H_sapiens300675 -TTTTATAAA-TGTTG-CTGATAAAC----------- H_sapiens300726 -TTTTAT-AAATGCTG-GTGATAAAC----------- L_africana300306 -CTTTAA-AAATGCTG-GTGATACAC----------- L_africana300389 -TTTTAT-AAATGCTG-GTGATAAAC----------- L_africana300476 -TTTTAT-AAATGCTG-GTGATAAAC----------- M_mulatta300027 -TCTTAT-AAATGCTG-GTAATAAAC----------- M_mulatta300051 -TTTTATAAAATGCTG-CTGATAAAC----------- M_mulatta300199 -TTTCAT-AAATGCTG-GTGATAAAA----------- M_mulatta300246 -TTTTAT-CAATGCTG-GCGATAAAC----------- M_mulatta300257 -TTTTAC-AAACTCTG-GTAATAAAC----------- M_mulatta300395 -TTTTAT-AAATGCTA-GTGATGAAC----------- M_mulatta300641 -TTTTAT-AAATGCTG-GTGATAAAC----------- M_murinus300147 -TTTTAT-AAATGCTT-GTGATAAAC----------- M_murinus300228 -TTTTAT-AAATGATG-GTGATAAAC----------- M_murinus300246 -TTTTGT-AAATGCTT-GTGATAAGC----------- M_domestica300146 -TTTTAT-AAATGCTG-GTAACAAAC----------- M_musculus300834 -TATTAT-AAATTCTG-GTGATAAAT----------- M_musculus300854 -TTATCT-AAATGCTG-GTGACAGAC----------- M_lucifugus300089 -TTTTAT-AAATGCTG-GTGATAAAC----------- M_lucifugus300190 -TTTCAT-AAATGATG-GTGATAAAC----------- M_lucifugus300523 -TTTTAT-AAATGCTG-GTGATAAAC----------- M_lucifugus300787 -TTTTCT-AAATGCTG-GTGATAAAC----------- O_anatinus304534 -TTTTGC-AAATGCTG-GTGACAAAT----------- O_cuniculus300136 -TTTCAT-CAATGCTG-GTGTGAAAG----------- O_cuniculus300287 -TTTTAT-AAATGTTC-CTGATAAAA----------- O_cuniculus300355 -TTTTAT-AAATGCTG-GCAATAAAA----------- O_cuniculus300373 -TTTCAT-AAACACTG-GTGATCAAA----------- O_cuniculus300440 -TTTTAT-AAATGCTG-GTGATAAAA----------- O_garnettii300090 -TTTTAT-AAATGGTG-ATAAACCAG----------- O_garnettii300115 -GTGAAA-ACC-------------------------- O_garnettii300317 -----AT-AAATGCTG-GTGATAAAC----------- O_garnettii300360 -TTTTAT-AAATGCTG-GTGATAAAT----------- O_garnettii300398 -TTTAAT-AAATGCTG-GTGATAAAA----------- O_garnettii300545 -TTTTAT-AAATGCTG-GTGATAAGC----------- O_garnettii300564 -TATCAT-AAATGCTG-GTGATAAAC----------- O_garnettii300689 -TTTTAT-AAATGCNN-NNNNNNNNN----------- O_garnettii300699 -TTTTAT-AAATGCTG-TTGATAAAC----------- O_garnettii300700 -TTTTAT-AAATGCTG-GTGATAAAT----------- P_troglodytes300142 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_troglodytes300187 -TCTTAT-AAATGCTG-GTGATAAAC----------- P_troglodytes300280 -TTTTAT-AAATGCTA-ATGATGAAC----------- P_troglodytes300327 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_troglodytes300387 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_troglodytes300535 -TTTTATAAA-TGTTG-CTGATAAAC----------- P_troglodytes300562 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_pygmaeus300013 -TTTTAT-AAATGCTA-ACGATGAAC----------- P_pygmaeus300102 -TCTTAC-AAATGCTG-GTGATAAAC----------- P_pygmaeus300192 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_pygmaeus300321 -TTTTAT-AAACTCTG-GTAATAAAC----------- P_pygmaeus300334 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_pygmaeus300453 -TTTTAT-AAATGCTG-GTGATAAAC----------- P_pygmaeus300584 -TTTTATAAA-TGTTG-C-GATAAAC----------- P_pygmaeus300710 -TTTTAT-AAATGCTG-GTGATAAAC----------- R_norvegicus300146 -TTTTCT-CAATGCTG-GTGACAAGC----------- R_norvegicus300777 -TTTTCT-GAATGCTG-GTGACCAGC----------- R_norvegicus300887 -TTTTCT-CAATGCTG-GTGACAAGC----------- S_araneus300018 -TCTTAG-AAATGCTG-GCGATTTTT----------- S_araneus300089 -TCTTCG-GA-TGCTG-ATGATAAAT----------- S_araneus300128 -TCTTAG-AAATGCTG-GTGATAAAA----------- S_araneus300152 -GCTTAG-AAATG--G-CTGAGATCTCC--------- S_araneus300180 -TCTTAG-AAATGCTG-CTGATAAAT----------- S_araneus300193 -TCTTAG-AAAT-AAG-GTGATAATT----------- S_araneus300286 -CCTAGT-TCATTAC---------------------- S_araneus300298 -TCTTAT-AAACACTG-GTGATAAAA----------- S_araneus300365 --CTTAG-AAATGAAG-GTGAAAAAT----------- S_araneus300379 -TCTTTG-AAATGCTG-GTGATAAAT----------- S_araneus300415 -TTTTTT-TCACGTCA-CATGC--------------- S_araneus300418 -TCTTAG-AAATGTTG-GATACATTT----------- S_araneus300433 -TCTTAG-AAATTCTG-GTGATAAAT----------- S_araneus300435 --CTGGG-AAGTGATG-GTGATAACT----------- S_araneus300448 ------G-AAATAATG-GTGATAAAT----------- S_araneus300458 -TTTTAG-AAATGCTG-GTGATCAGG----------- S_araneus300487 -TCTTAG-AAATGATC-ATGATTTTT----------- S_araneus300510 -CCTTGT-TCTAGTCT-TAGAAATGATGGTGTTAACT S_araneus300604 -TCTTAG-AAATGCTG-GTGATGAAT----------- S_araneus300659 -TTTTGT-AAATGCTG-GTGATAAAC----------- S_araneus300696 -TCTTAG-AAATGCTG-GTGATGGGG----------- S_araneus300768 -TCTTAG-AAATGCAG-GTCATAAAA----------- S_araneus300843 --CTTAG-AAATGATA-GTGATAAAT----------- S_araneus300862 -TCTTAG-AAACGCTG-CTAGATAAG----------- S_araneus300866 -TCTTAT-AAATGCTG-GTGATAATT----------- S_araneus300874 -TCTTAG-AAATTATG-GTGATAGGG----------- S_araneus300885 -TCTGAG-AAATGTCA-GCGGTAGAT----------- S_araneus300947 -TCTTAG-AAATGCTC-GCGATAAAT----------- S_araneus300964 -TCTTGA-AAATGATG-GTGATAAAT----------- S_araneus300983 -TCTTAG-AAACGATG-GTGATAAAT----------- S_araneus300985 -TCTTAG-AAATGAGA-ATGAGAAGG----------- S_araneus300986 -TCTTAG-AAATGCTT-GTGATAACT----------- S_araneus300993 -CTTTAG-AAATGTTG-GTGATAAAT----------- S_araneus301060 -TCTTAA-AGGTGTTG-GTGATAAAC----------- S_araneus301078 -T--CAG-AAATGATG-GTGATAAGG----------- S_tridecemlineatus300002 -TTTTAC-AAATGCTG-GTAATATAC----------- S_tridecemlineatus300032 -TTTTAT-AAATGCTG-GTGATAAAC----------- S_tridecemlineatus300040 -TTTTAT-AAATGCCT-GTGATAAAC----------- S_tridecemlineatus300117 -TTTTGT-AAATGCTG-GTGATAAAC----------- S_tridecemlineatus300125 -TTTTAT-AAGTGCTG-GTGATAAAC----------- S_tridecemlineatus300142 -TTTTAT-AAATGCTG-GTGATAAAT----------- S_tridecemlineatus300143 -TTTTCT-AGATGCTG-GTGAGAAAC----------- S_tridecemlineatus300178 -TTTTAT-AAATGCTG-GTGATAAAC----------- S_tridecemlineatus300235 -TTTTAT-AAATGCTA-GTGATAAAA----------- T_belangeri300157 -TTTTAT-AAATGCTG-GTAATAAGG----------- T_belangeri300229 -TTTTAT-AAATGTTC-ATAATAAGC----------- T_belangeri300251 -TTTTAT-AAATACTG-GTGATAAGG----------- T_belangeri300279 -ATT-AT-AAATGCTGTATAGCC--------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved