snOPY snoRNA Orthological Gene Database

Family: SNORA71

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300114 -------------TAGCAGGCTG-CGGACATGGG-CAGCC-CGG----GT C_familiaris300115 --------ACCTGCATTCAAGAG-CGATCATGGG-CTGTC-TGT----GC C_familiaris300193 --------TACTGCATCCAACAG-TGATTGCAAG-CTACC-TGT----GC C_familiaris300194 --------TCCTGCATTCGAAAG-TGATCGTGGG-CT-GCCTGT----GC C_familiaris300195 --------CCCTGTGTTT--CAGGTGATTACGGGCTGCCTCTGT------ C_familiaris300196 --------ACCTGCATTCGAAAG-TGATCGTGGT-CTGTC-GGT----GT C_familiaris300256 --------AATTGCATTCGAAAG-TGCTCACGGT-CTGTC-AGT----GT C_porcellus300150 --------CCCTGTATTCGAAAG-TGATTGTGGG-CTGAC-TGT----GC C_porcellus300151 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ C_porcellus300152 --------CACAGTATTTGAAAA-TGAT--TAGGGCTGCC-TGT----GC C_porcellus300171 -----------CCTAACCAAACA-TGATCTTTGG-CT-GCCTGT----GC C_porcellus300172 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ C_porcellus300173 --------CACAGTATTTGAAAA-TGAT--TAGGGCTGCC-TGT----GC C_porcellus300549 --------TCCTGCATTCGT-AAGTGATCAGGGA-CC-CC-CAT----GC C_porcellus300738 ------AATTAAATAAAAAGATT-TGATTGTGGG-CT-GACTGT----GC C_porcellus300761 ------AATTAAATAAAAAGATT-TGATTGTGGG-CT-GACTGT----GC C_porcellus301040 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ C_porcellus301041 --------CCCTATATTCGAAAG-TGATTGTGGG-CTGAC-TGT----GC C_porcellus301042 ------------CTAACCAAATA-CGATCTTGGG-CT-GCCTGT----GC D_rerio300292 --------CCCTGTTT-CGAAAG-TGACCGTGGT-GTGTGTGGT----CT D_rerio300293 --------ACCTGTTT-CGAAAG-TGACCGTGGT-GTGTGTGGT----CT D_novemcinctus300040 --------TCCTGCATTTGAAAG-TGATCATGGG-CTGCC-GGT----GC D_novemcinctus300102 --------CCCTGCATACGAAAG-TGATTGTGGG-CTGCC-TGT----GT D_novemcinctus300193 --------ACCTGCAGTCAAAAG-TGATCGTGGG-CTGCC-TGT----GT D_novemcinctus300203 --------CACTGCGTTTCAGGG-CAATCGCT-G-CT-GCTTGT----GT D_novemcinctus300288 --------ATCTGCCATCGAAAG-TGACCATGGG-CTGCC-CGT----GT D_novemcinctus300302 --------CCCTGCATTCGT-AAGTGATCATGGG-CTACC-CCC----AT E_telfairi300059 --------ACCTGCTTTC-AAAG-TGG-CTCGGA-CTGCC-CGT----GT E_telfairi300075 --------ACCTGCATTCGAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300307 --------ACCTGCATTCAAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300362 --------ACCTGCATTCGAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300381 --------ACCTGCATTCAAAAG-GGACCTCGGA-CTGCC-CGT----GT E_telfairi300434 --------ACCTGCATTCAAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300445 --------CCCTGCATCCGAAAG-TGACCGTGGG-CTG-CA-GT----GT E_telfairi300464 --------ACCTGCATTCAAAAG-TGGGCTCGGA-CTGCC-CGT----GT E_telfairi300469 --------ACCTGCATTCAAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300527 --------ACCTGCATTCAAAAG-GGACCTCGGA-CTGCC-CGT----GT E_telfairi300530 --------ACCTGCATTCGAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_telfairi300574 --------ACCTGCATTCAAAAG-GGACCTCGGA-CTGCC-CGT----GT E_telfairi300606 --------ACCTGCATTCGAAAG-TGGCCTCGGA-CTGCC-CGT----GT E_caballus300110 --------CCCTGCATTCGAAAG-TGATTGTGGG-CTGCC-TGT----GC E_caballus300111 --------ACCTGCATTCGAAAG-TGATCGTGGG-CTGCC-TGT----GC E_caballus300112 --------CCCTGTGT----GAAGTGATTACAGCCTGCCTGTGC------ E_caballus300113 --------CCCTGCATTCGAAAG-TGAT-GTGGG-CTGCC-TGT----GC E_caballus300183 --------CCCTGCATTCGAAAG-TGAT-GTGGG-CTGCC-TGT----GC E_caballus300184 --------CTCTGCATTTGG-AAGTGATCACAG--CTGCC-CGT----GT E_caballus300185 --------ACCTGCATTCAAAAG-TGATCACGGG-CTGTC-TGT----GC E_europaeus300021 --------ACCTGCATTCGAAAG-TGATCACGGG-CTG-CCTGT----GC F_catus300008 --------TCCCGTGTCTGAAAG-TGACTGCAGG-CT-GCCTGT----GC F_catus300101 --------TCCCGTGTCTGAAAG-TGACTGCAGG-CT-GCCTGT----GC F_catus300102 --------TCCTGCATTCGAAAG-TGATCGTGGG-CG-GCCCGT----GC F_catus300103 --------ACCTGCATTCGAAAG-TGATCATGGT-CTGTC-CGT----GT F_catus300177 --------ACCTGCATTCAGAAG-CGATCACGGG-CTGTC-TGT----GC F_catus300199 --------TCTTTCATTCAAAAG-TGCTC-TGGG-CT-GCCAGC----GC G_gallus300038 --------ACCTGCATTCGAAAG-TGATCGTGGT-CTGCTGCGT----GG H_sapiens300485 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTTTGC------ H_sapiens300486 -------CTCCTGCATCCGAAAG-TGATCATAGG-CT-GCCTGT----GC H_sapiens300487 --------CCCTGCATTCGAAAG-TGATCATGAG-CTGCC-CGT----GC H_sapiens300488 --------ACCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ L_africana300362 --------TCCTGCATTCGAAAG-TGATCATGGG-CT-GCCTGT----GC L_africana300391 --------TCCTGCATGTGAACG-TGACT-CTGGGT-----GAT------ L_africana300392 --------TCCTGCATTCGT-AAGTGGTCACAGA-CTGCC-CGT----GT L_africana300393 --------TCCTACATTTGAAAG-TGACTGTGGA-CTACC-CAT----GT L_africana300394 --------ACCTGCATTGAAAAG-CGATCACGGG-CTGCC-TGT----GC L_africana300428 --------CTCTGCATACGAAAG-TGACCCTGGG-CTG-CCCAT----GT L_africana300429 --------CCCTGCATTCGAAAG-TGACCCTGGG-CTG-CT-GT----GT L_africana300477 --------TCCTGCATGTGAACG-TGACT-CTGGGT-----GAT------ M_mulatta300062 --------ACCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ M_mulatta300063 --------CCATGCATTAGAAAG-TGATTATGGG-CTGCC-CGT----GC M_mulatta300064 --------TCCTGCATCCGAGAG-TGATCATGGG-CT-GCCTGT----GC M_mulatta300065 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ M_mulatta300066 --------TCTTGTATCCAAAAA-TGGCCACGGG-TT-GCCTGC----GC M_mulatta300129 --------GTCTGCATTTGAAAG-CGATCATCAG-CT-GCCTATTGATGC M_mulatta300201 -------------------CCCT-ATATTCTGAAGT-----GAT------ M_mulatta300470 --------ACCTGCATTCAAAAA-TGATCACGGG-CTGCC-TGT----GC M_mulatta300471 --------GCCTGCATTCGT-AAGTGATCACGGG-CCGCC-CAT----GT M_murinus300006 --------CCCTGCATTCGAAAG-TGATCGTGGG-CTG-CCCGT----GC M_murinus300007 --------CCCTGCATTCGAAAG-TGATCGTGGG-CTG-CCCGT----GC M_murinus300373 --------CCATGCATTCGT-AAGTGATCATGGT-CTGCC-CAT----GT M_murinus300374 --------ACCTGCATTCAAAAG-TGATCACGGG-CTGCC-TGT----GC M_domestica300021 --------CCCTGCATTCGAAAG-TGATCATGGT-CTA-ACTGT----GA M_musculus300279 --------CCCTGTATTCAAAAG-TGATTGTAGGCTGCCTGTGT------ M_musculus300282 --------CCCTGTATTTGAAAG-TGATTGTGGG-CTGCT-GGT----GC M_musculus300295 --------CCCTGAATTCAAGAG-TGATTTTGTAATACCTATGC------ M_musculus300343 --------CCCTGTATTTGAAAG-TGATTGTGGG-CTGCA-GGT----GC M_musculus300398 --------CCCTGTATTCGAGAG-TGACTGTGGGCTGCCATGTC------ M_musculus300417 --------CCCTGTATTCGAAAG-TGATTGTGGG-CTGCC-GGT----GC M_musculus300418 --------CCCTGCATCCGAAAG-TGATCTTG-G-CTGCC--GT----GT M_musculus300419 --------CCCTGTATTCGAAAG-TGATTGTGGG-CTGCC-TGT----GC M_musculus300420 --------CCCTGTGTTGGAAAG-GGATTGTGGGCTTCCCAAAC------ M_musculus300533 --------CCCTGTATTCCAAAG-TGATTGTGGG-CTGCCATGC------ M_musculus300554 -------CCATGGCACTCAGAAA-GAACCTT-GG-CT-GCCTGT----GT M_musculus300684 --------CCATGTTTCTGAAAG-TAATCATAGT-CTTTT--GT----GC M_musculus300703 --------GCCTGTATTCCAAGT-TGATTGTGGATTGCTTATGC------ M_musculus300986 --------CCCTGCGTTCGT-AAGTGATCAGGG--ATACC-CAT----GC M_musculus300987 --------ACCTGCATTTAGAAGCCGACCATGGG-CTGCG-TGT----GC M_lucifugus300872 --------CCCTGCATTCGAAAG-TGATCGTGGG-CT-GCCTGT----GC M_lucifugus300343 --------TCCTGCACTGGACCG-CGGGTGCGGG-CTGCC-TGC----GC M_lucifugus300191 TCATGGCATTAA--GAAGGGATA-CGATCGTGGG-CT-GCCTGT----GC M_lucifugus300082 ---------CCTTCTAGTGCAGG-AGACAGTTGGAT-----TAT------ M_lucifugus300873 --------CCCTGCATTCGAAAG-TGATCGTGGG-CT-GCCGGT----GC M_lucifugus300648 --------TGCTACATTCAGAAG-TGATCATGTG-CT-ACCTGT----GC M_lucifugus300385 --------TCCTGCATTCGAAAG-TGATCGTGGG-CT-GC-TGT----GC O_anatinus304343 --------ACCTGCATTCGAAAG-TGATTATGGT-ATT--CTGT----GA O_cuniculus300080 --------CCTGGTATTCGAAAG-TGATCGTGGG-CTG-CCCGT----GC O_cuniculus300148 --------CCCTGCATTCGAAAG-TGATCGTGGG-CTG-CCCGT----GC O_cuniculus300149 --------CCCTGCATTCGT-AAGTGACCACAGG-CTGTC-CGT----GT O_cuniculus300150 --------ACCTGCATTCAAAAG-TGATCATGG--CTGCC-AGT----GC O_garnettii300070 --------ACCTGCATCCGAAAG-TGAGTGTGGT-CTGCT-TGT----GT O_garnettii300071 --------CCCTGCATTCGAAAG-TGATCATGGG-CTGCC-CGT----GC O_garnettii300072 --------CCCTGCATTTGAAAG-TGATCATGGG-CT-GCCGGT----GC O_garnettii300394 --------ACCTGCATCCGAAAG-TGAGTGTGGG-CTGCT-TGT----GC O_garnettii300506 --------CCCTGCTTTCCAAAG-GGATCATGGG-CTTCC-CGT----GC P_troglodytes300035 -------------------CCCT-ATATTCGAAAGT-----TAT------ P_troglodytes300734 --------ACCTGCATTCAAAAA-TGATCACGGG-CTGCC-TGT----GC P_troglodytes300732 --------ACCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ P_troglodytes300731 --------CCCTGCATTCGAAAG-TGATCATGAG-CTGCC-CGT----GC P_troglodytes300730 --------TTCTGCATCCGAAAG-TGATC-TAGG-CT-GCCTGT----GC P_troglodytes300729 --------CCCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ P_troglodytes300728 --------TCTTGTATCCAAAAG-TGATCATGGG-TT-GCCTGT----GT P_troglodytes300317 --------GTCTGCATTTGAAAG-TGATCATCAG-CTAGCCTGT----GT P_troglodytes300733 --------GCCTGCATTCGT-AAGTGATCACGGG-CTGCC-CGT----GT P_pygmaeus300041 --------GTCTGCATTTGAAAG-TGATCATCAG-CT-GCCTGT----GT P_pygmaeus300196 -------------------CCCT-ATATTCGAAAGT-----GAT------ P_pygmaeus300510 --------GCCTGCATTCGTTAAGTGATCACGGGGCTGCC-CAT----GT P_pygmaeus300511 --------ACCTGCATTCAAAAAATGATCATGGG-CTTCCCTGT----GC P_pygmaeus300628 --------TCTTGTATCCAAAAG-TGATCATGGG-TT-GCCTGT----GT P_pygmaeus300629 --------CCCTGTATTCGAAAG-TGATCGTGAGCTGCCTGTGC------ P_pygmaeus300630 --------TCCTGCATCCAAAAG-TGATGGTAGG-CT-GCCTGT----GC P_pygmaeus300631 --------CCCTGCATTCGAAAG-TGATCATGGG-CTGCC-CGT----GC P_pygmaeus300632 --------ACCTGTATTCGAAAG-TGATCGTGGGCTGCCTGTGC------ R_norvegicus300584 --------CCCTGTTTTGGAAAG-TGACTATGGGCTGCCTGTGT------ R_norvegicus300652 --------CCCTGTGTTGGAAAG-TGATTGTGGGCTTCCCATAC------ R_norvegicus300655 ---------------GCCTGTAT-TGATTCTGGATTGCCTGGAT------ R_norvegicus300957 --------CCCTGCATTCGT-AAGTGATCAGGGG-ATACC-CAT----AC R_norvegicus300958 --------ACCTGCATTTGGAAGCCGACCACGGG-CTGCC-TGT----GC R_norvegicus300020 --------CCCTGTATTCGAAAG-TGATTGTGGG-CTGCC-GGT----GC R_norvegicus300018 --------CCCTGTATTCGAAAG-TGATTATGGGCTGCCCGTGC------ R_norvegicus300019 --------CCCTGCATCCGAAAG-TGATCTTG-G-CTGCC-TGT----GC R_norvegicus300053 --------CCCTATATTCGAAAG-TGATTGTAGG-TTGCC-AGT----GC R_norvegicus300265 -------CCATGACACCCAAAAG-CGATCTT-GG-CT-GCCTGT----GT R_norvegicus300286 --------CCCTGAACTCAAGAG-TGACTCTGGGACACTCATGC------ R_norvegicus300398 --------TTCTGTTTCTGGAAG-TGTTCATGGG-CTTTCAGGT----GC S_araneus300209 --------CCCTGTATTCGAAAG-TGATCGCTGGCTGCCTGTGC------ S_araneus300210 --------TCCTGCATCCGAAAG-TGGTCGT-GG-CT-GCCTGT----GC S_araneus300573 --------CCCTGTATTCGAAAG-TGATCGCTGGCTTCCTGTGC------ S_araneus300668 --------CCCTGTATTCGAAAG-TGATCGCTGGCTGCCTGTGC------ S_araneus300801 --------CCCTGTATTCGAAAG-TGATCGCTGGCTGCCTGTGC------ S_tridecemlineatus300216 --------TCCTGCATTCGAAAG-TGATCATGGG-CT-GCTTGT----GC S_tridecemlineatus300217 --------CCCTGTATTCGAAAG-TGATCATGGG-CTGCC-TGT----GT S_tridecemlineatus300275 --------CCCTGTATTCGAAAG-TGATCATGGGCTACCTGTGC------ S_tridecemlineatus300088 --------ACCTGCATTCAAAAGT-GATCACGGG-CTGCC-TGT----GC S_tridecemlineatus300215 --------CCCTGTATTCGAAAG-TGATCATGGGCTACCCGTGC------ T_nigroviridis300085 --------ACCTGTAT-CGAAAG-TGATCATGGT-AAC-CTTGT----AG T_nigroviridis300087 --------ACCTGTAT-CGAAAG-TGATCATGGC-GTG-CTGGT----TG T_nigroviridis300088 --------ACCTGTAT-CGAAAG-TGATCATGGC-GTG-CTGGT----TG T_nigroviridis300086 --------TCCTGTAT-CGAAAG-TGGTCATGGC-GTC-GTTGT----TG T_belangeri300155 --------CCTTGCATTCGT-AAGTGATCATGGG-CTGCC-GGT----GT T_belangeri300186 --------CCCTGTATTCGAAAG-TGACCCTGGG-CTG-CCTGT----GC T_belangeri300187 --------CCCTGCATTCGAAAG-TGATCGTGGG-CTGCC-TGT----GC T_belangeri300188 --------GCCTGCATCCGAAAG-TGATCCTGGC-TTG-CTGGT----GC T_belangeri300222 --------CCCTGCATTCAAAAG-TGACCCTAGG-CAG-CCTGA----GC T_belangeri300258 --------CCTTGCATTCGT-AAGTGATCATGGG-CTGCC-GGT----GT T_belangeri300259 --------ACCTGCATTCAAAAG-TGATCATGGG-CTGCC-TGT----GC T_belangeri300267 --------CCCTGCATTGGT-AAGTGATCACAGA-CTGCT-CGT----GT T_belangeri300081 --------CCCTGCATTTGT-CAGTGGTCACGGG-CTGCC-CGT----GT T_belangeri300347 --------CCCTGCATTCGAAAG-TGACCCTGGG-CTG-CCCGT----GC X_tropicalis300040 --------ACCTGCAT-CGAAAG-TGATTGTGGC-CTAATTTGT----GG X_tropicalis300127 --------ACCTGCAT-CGAAAG-TGATTAGGGT-TTC-CTTGT----GG C_familiaris300114 CCAGGTCA-TTGATGGTG----CAGAGAAAGGATTTTTTGAAAGCG--CT C_familiaris300115 TCTGGTCA-TTGATAATG----CAGGGAGAGGAATTGTTGAAAGCA--GC C_familiaris300193 CCTGGTCA-TTGATAGGC----CGGGAGAAG--AAT-CACTGAAA--AAA C_familiaris300194 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCTGAAAGCA--CA C_familiaris300195 CCTGGTCA-TTGGTAACA----CAGGATGAGGAGAAGCTGCAAGGT--TT C_familiaris300196 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAGTCGCTGAAAGCG--CT C_familiaris300256 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAGCTGCTGAAGG-G--CT C_porcellus300150 CCCGGTCA-TTGATAGTG----CAGGGAGAG-AAATATTGAAAGATGTTT C_porcellus300151 CCTGGTCA-TTGATAGCG----CACGGAGAGGAACTGGTGAAAGCC-TTT C_porcellus300152 CCTGGGCA-TTGGTAATG----CAGGGAGAGAAACTGCTGAAAGCC--TT C_porcellus300171 CTCATTTA-TTGGCAGTG----CATGGAGAGGAA-C-ATGGAAGACCTTT C_porcellus300172 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAACTGCTGAAAGCC-TTT C_porcellus300173 CCTGGGCA-TTGGTAATG----CAGGGAGAGAAACTGCTGAAAGCC--TT C_porcellus300549 CCTGGGCA-TTGGTAGTG----CAGGTAGAGGAAATGTGGAAAGAA--TT C_porcellus300738 CCCGGTCA-TTGATAGTG----CAGGGAGAGAAG-CTCTGAACGATGTTT C_porcellus300761 CCCGGTCA-TTGATAGTG----CAGGGAGAGAAG-CTCTGAACGATGTTT C_porcellus301040 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAACTGGTGAAAGCC-TTT C_porcellus301041 CCTGGTCA-TTGATAGTG----CAGGGAGAG-AAATATTGAAAGATGTTT C_porcellus301042 CTCATTTA-TTGGCAGTA----CATAGAGACGAA-C-ATGGAAGACCTTT D_rerio300292 CCAGGTCA-TTGATAAAA----CAGGAAGAGGAA---GTGAAAGT---GT D_rerio300293 CCAGGTCA-TTGATAAAA----CAGGAAGAGGAA---GTGAAAGT---GT D_novemcinctus300040 CCT-GTCA-CTGATTGTG----CATGGAAAAGAATCGCTGAAAGTA--TT D_novemcinctus300102 CCTGGTCA-TTGATAACG----CAGGGAGAG--AAATCACTGAAAGCAAT D_novemcinctus300193 CCTGGTCA-TGGATAATG----CAGGGAGAGGAATTGTGGAAAGCA--GT D_novemcinctus300203 CCTGGTCA-CTGAGAGTG----CAGTGAGAAGAATTGCAGAAAGCA--TT D_novemcinctus300288 CCTGTTCA-TGGATATTG----CAGGGAGAGGAAT-GTGGAAAGCA--GT D_novemcinctus300302 CCTGGTCA-TTGGTAATG----CAGGCAGAGGAAATGTGGAAAGGG--TC E_telfairi300059 CCTGGTCG-TCAACCATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_telfairi300075 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_telfairi300307 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--AT E_telfairi300362 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_telfairi300381 CCTGGTCA-TCACCGATG----CAGGGAGAGCGAGTGTGGAAAGCC--GT E_telfairi300434 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_telfairi300445 CCCGGTCA-TTGATAGTG----CAGGGAGAGGAATTGTGGAAAGCC--TT E_telfairi300464 CCTGGTCA-TCAACGATG----CAGGGAGAGCAATTGCGGACAGCC--GT E_telfairi300469 CCTGGTCA-TCAACGATG----CAGGGAGAGTGATTGCGGACAGCC--GT E_telfairi300527 CCTGGTCA-TCACCGATG----CAGGGAGAGCGAGTGTGGAAAGCC--GT E_telfairi300530 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_telfairi300574 CCTGGTCA-TCACCAATG----CAGGGAGAGCGAGTGTGGAAAGCT--GT E_telfairi300606 CCTGGTCA-TCAACGATG----CAGGGAGAGCGATTGCGGACAGCC--GT E_caballus300110 CCTGGTCA-TTGATAGTG----CAGGAAGAGCAAGTGCTGAAAGATGTTT E_caballus300111 CCTGGTCA-TTGATAGTG----CAGGGAGAGCAAATGCTGAAAGC--CTT E_caballus300112 CCTGGTTG-TTGGTAATG----CAGGCAAAGGAAAAGTTGGGAGGT--TT E_caballus300113 CCTGGTCA-TTGATTGTG----CAGGGAGAGGAAGTGCTGAAAGC--CTT E_caballus300183 CCTGGTCA-TTGATTGTG----CAGGGAGAGGAAGTGCTGAAAGC--CTT E_caballus300184 CCTGTTCA-TTGGTAGTG----CAGACAGAGGAAACGTGGAGAGGA--TT E_caballus300185 TCTGGTCA-TTGATAACG----CAGGGAAAGGAATTGTTGAAAGCA--GT E_europaeus300021 CCTGGTCA-TTGATAGTG----CAGGGAGAGCAACTGCCAAAAGCG--TT F_catus300008 CTTGGTCA-TTGGTAGGG----CAGGGAGAGGAGTCACCGAGAGAAGTT- F_catus300101 CTTGGTCA-TTGGTAGGG----CAGGGAGAGGAGTCACCGAGAGAAGTT- F_catus300102 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCCGAAAGCG--TT F_catus300103 CCTGGTCA-TCGATAGTG----CAGGGAGAGGACTTGCAGAAAGCA--CT F_catus300177 TCTGGTCA-TTGATAATG----CAGGGAGAGGAATTGTTGAAAGCA--GT F_catus300199 CCTGGTCA-TTGATAGTA----TAGGGAGAGGAACCGCTGAAAGCA--TT G_gallus300038 CCCGGTCA-TTGATAGTG----CAGGGAGAGGAA--CACGAAGGC---GT H_sapiens300485 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATCAATGAAAGCG--CT H_sapiens300486 CTAGGTCA-TTGATAGTG----CAGGGAGAGGAA-CGCTGAAAGAGGTTG H_sapiens300487 CCTGGTCA-TTGGTAGTG----CAGGGAGAGGAACTGCCGAGAGCA--CT H_sapiens300488 CCTGGTCA-TTGATAGTG----CAGGGAAAGAAATCGCGGAAAGTG--CT L_africana300362 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGGTGGAAGGCATTT L_africana300391 CCTGATCA-TTGATAGTT----CAGGGAGAGGAATTGC-TAAAGTG--CG L_africana300392 TCTGGTCA-TTGGTAGTG----CAGGCACAGGAAATGTGGAAAGGT--TG L_africana300393 CCTGGTCA-TTCATGGTG----CACAGAGAGGAATTGCCGAAACCG--TT L_africana300394 CCTGGTCA-TCGATAATG----TAGGGAGAGGAATTGTGGAAAGCA--GT L_africana300428 CCTGGTCA-TTGATAGTG----CAGGGAGACCAATTGCT-AAAGCA--TT L_africana300429 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCTGAAAGCA--TT L_africana300477 CCTGATCA-TTGATAGTT----CAGGGAGAGGAATTGC-TAAAGTG--CG M_mulatta300062 CCTGGTCA-TTGATAGTG----CAGGGAGAGAAATCGCTGAAAGCG--CT M_mulatta300063 CCTGGTCA-TTGGTGGTG----CAGGGAGAGGAACTGCCGGGAGCA--CT M_mulatta300064 CTAGGTCA-TTGATAGTG----CAGGGAGAGGAA-CACCGGAAGAAGTTG M_mulatta300065 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATCAATGAAAGCA--CT M_mulatta300066 CCCGATCA-TTCATAGTG----CAGGGGTAGGAG-TGCTAAGAGACGTTT M_mulatta300129 CTTGGTCA-TCGATAGTA----CAGGCAGTTGAACTGCACAAAGCA--TT M_mulatta300201 CCTGGTCA-TTGACAGTC----CAGGGAGAGAAGCTGCTGAAAGCA--TT M_mulatta300470 TCTGGTCA-TCGATAACG----CAGGGAGAGGAATTGCTGAAAGCC--GT M_mulatta300471 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATGTGGGAAAGG--TT M_murinus300006 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCCGAAAGCG--TT M_murinus300007 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCCGAAAGCG--TT M_murinus300373 CCTGGTCA-CTGGTAGTG----CAGGCAGAAGAAATGTGGGAAGGG--TT M_murinus300374 CCTGGTCA-TCAGTAATG----CAGGGAGAGGAATTGCTGAAAGCC--GT M_domestica300021 CCTGGTCA-TTGATAGTG----CAGGGAAAGAAACTCCTGAAAGGG--TT M_musculus300279 CCTGGACA-TTGATACTG----CAGGG-GAAGA--TACTGAAAGCC-TTT M_musculus300282 CCTGGTCA-TTGATGCTG----CTGGGAAAGGA--TGCTGAAAGCC--TT M_musculus300295 CCTGCTCA-TTGTTACTA----TAGGGAGAGGA--TGCCAAAAGCC-TTT M_musculus300343 CCTGGTCA-TTGATACTG----CAAGGAGAGGA--TTTGAAAAACT--TT M_musculus300398 CCCTGTCA-TTGGTACTAACTACATGGAGAGGA--TGTTGAA-GTT-TTT M_musculus300417 CCTGGTCA-TTGATACTG----CAGGGAGAGGA--TGCCGAAAGCC--TT M_musculus300418 CCTGGTCA-TTGGTAGTG----CAGGGAAAG--GATGCGGAAAGA--CGG M_musculus300419 CCTGGTCA-TTGATACTG----CAGGGAGAGGA--TTTGGAAAGCC--TT M_musculus300420 CCTAGGCA-CGGATACTG----CAGGGAGAGGA--TGCTAAAAGCC-ATC M_musculus300533 CCTGGTCA-TTGATACTG----CAGTGAGAGGA--TTCGGAAAGCT--TT M_musculus300554 CCCAGTCA-CTGGTATTG----CAGGGAAAGGAT-G-CTGAGAGACATGT M_musculus300684 CCTAGTCA-TTGATACTG----CAGGTAAAGTA--TGCTGAAAGCC--TT M_musculus300703 CCTGGTCA-TTGATACAG----CAGGGATAGGA--AGC-GAAAGCC-TTT M_musculus300986 CCTGACCA-TTGGTAGTG----CAGGCAGAGGAAATGTGGAAAGAA--CT M_musculus300987 TCTGGCCA-TACATGATG----CAGGGAGAGGAGTTGCTGAAGGCC--GT M_lucifugus300872 CCTGGTCA-TTGATAGTG----CAGGGAGA-GGACTGCG-AAAGCT--TT M_lucifugus300343 CCTGGGC--TGGATGGTG----CGGGGAGAGCAGCTGCTGAGGGCA---T M_lucifugus300191 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAA-CTGTGAAAGCA--TT M_lucifugus300082 AAAAAGAA-TGAAAATTG----CAGGGAGAGGAACTGC-GAAAGCA--TT M_lucifugus300873 CCTGGTCA-TCGATAGTG----CAGGGAGAGGAACTGCG-AGAGCA--TT M_lucifugus300648 CCTGGTCA-TTGATAGCA----CAGGGAGAG-AATTGCTGAAAGGCATTT M_lucifugus300385 CCTGGTCA-TTGATAGTG----CAGGGAGAG-GATTGCTGAAAGGAGTTT O_anatinus304343 CCTGGTCA-TTGATAGTG----CAGGGAGAGAAACTTAAGAAAGT---TT O_cuniculus300080 CCTGGTCA-TTGATAGTG----CAGGGAGAGCAGCTGCTGAAAGCG--CT O_cuniculus300148 CCTGGTCA-TTGATAGTG----CAGGGAGAGCAGCTGCTGAAAGCG--CT O_cuniculus300149 CCTGGTCA-TTGGTTCTG----CAGGCAGAGGAGATGCAGAAAGGG--TT O_cuniculus300150 CCTGGTCA-TCTGTGATG----CAGGGAAAGGAAGTGCTGAAGGCC--GT O_garnettii300070 CCTGGTCA-TTGGTAGTG----CAGGGAGAG-GAAAGCTGAAAGG-GTTT O_garnettii300071 CCTGGTCA-TCGATAGTG----CAGGGAAAGGAGTCGTTGAAAGCC--TT O_garnettii300072 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATCGCTGAAAGCA--TT O_garnettii300394 CGAGGTCAGTTGGTTGTT----TGGGGAGAG-GAAAGCTGAAAGAAGTTT O_garnettii300506 CCT-GTCA-CTGATAGTG----TGGGGAGAGGAACTGATGAACGCCA-TT P_troglodytes300035 CCTGGTCA-TTGACAGTG----CAGGGAGAGAAACTGCTGAAAGCA--TT P_troglodytes300734 TCTGGTCA-TCAATAACG----CAGGGAGAGGAATTGCTGAAAGCC--GT P_troglodytes300732 CCTGGTCA-TTGATAGTG----CAGGGAGAGAAATCGCTGAAAGTG--CT P_troglodytes300731 CCTGGTCA-TTGGTAGTG----CAGGGAGAGGAACTGCCGAGAGCA--CT P_troglodytes300730 CTAGGTCA-TTGATAGTG----CAGGGAGAGGAA-CGCTGAAAGAGGTTG P_troglodytes300729 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATCAATGAAAGCA--TT P_troglodytes300728 CCCGATCA-TTAACAGTG----CAGGGGCAGGAG-TGCTGAAAGACATCT P_troglodytes300317 CTTCGTCA-TCGATAGTA----CAGGCCGGTGAAATGCGCAAAGCA--TT P_troglodytes300733 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATGCGGGAAAGG--TT P_pygmaeus300041 CTTGGTCA-TTGATAGTA----CAGGCAGGTGAACTGTGCAAAGCA--TT P_pygmaeus300196 CCTGGTCA-TTGAAAGTG----CAGGGAGAAAAACTGCTGAAAGCA--TT P_pygmaeus300510 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATGCGGGGAAAGGTTT P_pygmaeus300511 TCGGGTCA-TCGATAATG----CAGGGAGAGGAATTGCTGAAAGCC--GT P_pygmaeus300628 CCCGATCA-TTAATAGTG----CAGGGGTAGGAG-TGCTGAAAGACATCT P_pygmaeus300629 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATCAATGAAAGCG--CT P_pygmaeus300630 CTAGGTCA-TTGGTAGTG----TAGGGAGAGGAA-TGCTGAAAGAGGTTG P_pygmaeus300631 CCTGGTCA-TTGGTAGTG----CAGGGAGAGGAACTGCCGAGAGCA--CT P_pygmaeus300632 CCTGGTCA-TTGATAGTG----CAGGGAGAGAAATCGCTGAAAGCG--CT R_norvegicus300584 CCTGGTCA-TTTATACTG----TAGGAAGAGGA--TACTGAAAGCC-GTT R_norvegicus300652 CCTAGACG-TGGATACTG----CTGGAAGAGGA--TGCCGAAAGCC-GTT R_norvegicus300655 TCTGGTCA-TTGGTACTG----CAGGGAGAGGA--AGC-GAACGCC-TTT R_norvegicus300957 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATGCGGGAAGAA--CT R_norvegicus300958 TCTGGTCA-TCCATAATG----CAGGGAGAGGAGTTGCTGAAAGCC--AT R_norvegicus300020 CCTGGTCA-TTGATACTG----CAGGGAGAGGA--TGCGGAAAGCC--TT R_norvegicus300018 CCCGGTCA-TTGATACTG----CAGGGAGAGGA--TACGGAAAGCC-TTT R_norvegicus300019 CCTGGTCA-TTGGTAGTG----CAGGGAAAT--CATGCCGAAAGA--CGT R_norvegicus300053 CCTGGTCA-TTGGTACTG----AAGGGAGAGGA--TGCAGAAAGTC--TT R_norvegicus300265 CCCAGTCA-CCGGCAATG----CAGGGAAAGGAT-A-CAGAAAGACCTGT R_norvegicus300286 C-TGCTCA-TTGTTCCTA----TTTGGAGAGGA--TGCTAAAAGCC-TTT R_norvegicus300398 CCTGGTCA-TTGATACTG----CAGGGAGAGGA--TGCCATGAGCT--TT S_araneus300209 CCCGGTCA-TTGATAGTG----CAGGGAGAGAAGTTGATGAAAGCC--TT S_araneus300210 CCTGGCCA-TTGGTAGTG----CAGGGACAGGAATCGCGGGAAGGCGTTT S_araneus300573 CCCGGTCA-TTGATAGTG----CAGGGAGAGAAGTTGATGAAAGCC--TT S_araneus300668 CTCGGTCA-TTGATAGTG----CAGGGAGAGAAGTTGATGAAAGCC--TT S_araneus300801 CCCGGTCA-TTGATAGTG----CAGGAAGAGAAGTTGATGAAAGCC--TT S_tridecemlineatus300216 CCTGGTCA-TTGATAGTG----CAGGGACAGGAATGGCTGGAAGACATTT S_tridecemlineatus300217 CCTGGTCA-TTGGTAGTG----CAGGGAGAGGAACCACTGAAAGCG--TA S_tridecemlineatus300275 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCTGAAAGCA--TT S_tridecemlineatus300088 TCTGATCA-TCCATAATG----CAGGGAGAGGAATTGCTGAAAGCC--AT S_tridecemlineatus300215 CCTGGTCA-TTGATAGTG----CAGGGAGAGGAATTGCTGAAAGCA--TT T_nigroviridis300085 CCAGGTCA-TCGATAGTA----CAGGAAGAGCAA--CCAGAGAGC---TT T_nigroviridis300087 CCAGGTCA-TCGATAGTG----CAGGAAGAGCAA--CGTGCGAGC---CT T_nigroviridis300088 CCAGGTCA-TCGATAGTG----CAGGAAGAGCAA--CGTGCGAGC---CT T_nigroviridis300086 CCAGGTCA-TTGATAGTA----CAGGAAGAACAC--CCTGTGAGC---CT T_belangeri300155 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATG-GGAAAGGG--TT T_belangeri300186 CCTTGTCA-TTGATAGTG----CAGGGAGAGGACTTGCTGAAAGCG--TT T_belangeri300187 CCTGGTCA-TTGATAGTG----CAGGGAGAGAAATCGCTGAAAGA-CGTT T_belangeri300188 CCTGGTCT-TTGATAGTG----CAGGAAGAGGACTTGTTGAAAGCG--TT T_belangeri300222 CCTTGTCA-TTGATAGTG----CAGGAGA--GACTTGCTGAAAGCG--TT T_belangeri300258 CCTGGTCA-TTGGTAGTG----CAGGCAGAGGAAATG-GGAAAGGG--TT T_belangeri300259 TCTGGTCG-TCGACAATG----CAGGGAGAAGAATTGCTGAAAGCC--GT T_belangeri300267 CCTGGTCA-TTGGTAGTG----CAGACAGAGGAAATG-GGAAAGGG--TT T_belangeri300081 CCTGGTCA-GCGGAAGTG----CAGGCAGAGGAGACG-GAAAAAGG--TG T_belangeri300347 CGTTGTTA-TTGATAGTG----CAGGGAGAGGACTTGCTAAAAGCG--TT X_tropicalis300040 CCTGGTCA-TTGATACTG----CAGGAATATCAGCATGTGTCAGT---TT X_tropicalis300127 CCCAGTCA-TTGATACTG----CAGGAAGAGTAAAATGTTAAAGC---TT C_familiaris300114 TCCCCGTGTT-TGAAGGGACCCTTCCTG----TCCCTTC--CAAACCTGG C_familiaris300115 TTCCCGTGTT-TGGAGGGTCCACAC-TG----TCCCTTT--CAAATGCTG C_familiaris300193 TTCCTGTGTG-TGAGGGATCCA-----------GCT--------GTCCTG C_familiaris300194 TCCCCGTGTTAGAAGG-GCCCATCC-------CATCCCTTCCAAACCCTG C_familiaris300195 TCTTGATGTT-CACAGGTTCCAAAATGG-----GACAGCCTGAGGTGACG C_familiaris300196 TCCCCGTGTT-TGGAGGGTCCACTCCTG----TCCCTTC--CAAACTCTG C_familiaris300256 TCCTCCT--C-TGGAGGGTCCACTCCCG----TCTCTTC--CAAATTCTG C_porcellus300150 TCCCCGTGTT-TGGAGGGTCC--ATC------TGTCCCTTCTGAACCCTG C_porcellus300151 -CCCCGTGTT-TAGAAGGTCTACTGC------TGTCCT-ACCAGACCCTG C_porcellus300152 TCTCTGTGTT-TGGAGGGTTCACTCC------CGTCCCTTCCAAACTCTG C_porcellus300171 TCCCTGTGTTTGCAGGGGCCTCTTTC------CATCGCTTGCAAGCTCAG C_porcellus300172 -CCCCGTGTT-TGGAAGGTCTACTGC------TGTCCT-ACCAGACCCTG C_porcellus300173 TCTCTGTGTT-TGGAGGGTTCACTCC------CGTCCCTTCCAAACTCTG C_porcellus300549 GTCCTATGTT-TGGAGGGTCTGCATGCT----TGCCTTT--CATTTCTAG C_porcellus300738 TCCCCGTGTTTGGAGG-GTCCATT--------TGTCCCTTCTGAACCCTG C_porcellus300761 TCCCCGTGTTTGGAGG-GTCCATT--------TGTCCCTTCTGAACCCTG C_porcellus301040 -CCCCGTGTT-TGGAAGGTCTACTGC------TGTCCT-ACCAGACCCTG C_porcellus301041 TCCCCGTGTT-TGGAGGGTCC--ATC------TGTCCCTTCTGAACCCTG C_porcellus301042 TCCCTGTGTTTGCAGGGGCCTCTTTT------CATTGCTTGCAAACTCAG D_rerio300292 TTCCCGTGTG-TGCTG-----GACTC------TGTTCCTGACAGACCCTG D_rerio300293 TTCCCGTGTG-TGCTG-----GACTC------TGTTCCTGACAGACCCTG D_novemcinctus300040 TCCCCATGTT-TGGAGGGTC------TG----TCCTTTT--CAGACCCTG D_novemcinctus300102 TCCCCGTGTT-TGGAGGGTCCATTCC------TGTCCCTTTCAAACCCTG D_novemcinctus300193 TTCCCGTGTT-TGGAGGGTCCACACCTG----TCCCTTT--CAAATGCTG D_novemcinctus300203 TCCCCAGGTTTGGAGG-GCCCATCCC------CATCCCCTGGGAAGACAG D_novemcinctus300288 TTCCTGTGTT-TGAAGGGTCCACAGCTG----TCCCTTT--CAAATGACG D_novemcinctus300302 ACCCCATGTTCTGGAGGGTCTGCAT-CC----CCCTTTC--CAGTTCCAG E_telfairi300059 TTCCCGTGTT-TGGAGGGTGCAGCATGC----CTGTCCCTGCAAATGCTG E_telfairi300075 TTCCCGTGTT-TGGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGCCG E_telfairi300307 TTCCCGTGTT-TGGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGCCG E_telfairi300362 TTCCCGTGTT-TAGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGCCG E_telfairi300381 TTCCCGTGTT-TGGAGGCTTATTTGGAG----TTGATCT--CGGGCACTG E_telfairi300434 TTCCCGTGTT-TGGAGGGTTCGGGGTAC----CTGTCTCTGCAAATGCTG E_telfairi300445 TCCCCGTGTT-TGGAGGGTCTGCTCC------TGTCCCTCCCAGACCCTG E_telfairi300464 TTCCCGTGTT-TGGAGGGTTCGG--TAC----CTGTCCCTGCAAATGCCG E_telfairi300469 TTCCCGTGTT-TGGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGGCG E_telfairi300527 TTCCCGTGTT-TGGAGGCTTATTTGGAG----TTGATCT--CGGGCACTG E_telfairi300530 TTCCCGTGTT-TGGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGCCG E_telfairi300574 TTCCCGTGTT-TGGAGGGTGTGTACCTG----TCCCTCG--CAAATGCTG E_telfairi300606 TTCCCGTGTT-TGGAGGGTTCGGCGTAC----CTGTCCCTGCAAATGCCG E_caballus300110 TCCCCGTGTT-TGGAGGGTCCC-ATC------CGTCCCTTCCAAACCCTG E_caballus300111 TCCCCGTGTT-TGGAGGACCCA-TCC------TGTCCTTTTCAAACCCTG E_caballus300112 TCCTTGCATT-CAGGACATCCATA-TGT-----GTCCCTTCCAAACG--- E_caballus300113 TCTCTGTGTT-TGGAGGGCCCA-TCC------TGTCCCTTCCAAACCCTG E_caballus300183 TCTCCGTGTT-TGGAGGGCCCA-TCC------TGTCTCTTCCAAACCCTG E_caballus300184 GTCACATGTT-TGGAGGGTCCACATCCT----CCCCTTC--CAGATCTGG E_caballus300185 TTCCCGTGTT-TGGAGGGTCCACACCTG----TCCCTTT--CAAATGCTG E_europaeus300021 TCCCCGTGTT-TGGAGG----GTCTCCCC---TGTCCCTTCTGAACCCTG F_catus300008 --CCCGTGTTTGAAGG-GTCCAGCC--------ATCCTTTCCAAACCCTG F_catus300101 --CCCGTGTTTGAAGG-GTCCAGCC--------ATCCTTTCCAAACCCTG F_catus300102 TCCCCGTGTTGGAAGG-GCCCATCC-------TGTCCCTTCCAAACTCTG F_catus300103 TCCCCGTGTT-TGGAGGGTCC-CCTCTG----TCCCTTC--CAAACCCTG F_catus300177 TTCCCGTGTT-TGGAGGGTCCACACCCA----TCCCTTT--CAAATGCTG F_catus300199 TCCCCATGCTGGAAGA-GCTCATCC-------TGTCCTTTCCAAACTCTG G_gallus300038 TTCCCGTGTT-TGGTTGG---GTCTGTGC---TATCCCTCCCAAACCCTG H_sapiens300485 TCCCCGTGTT-TGAAGGGTC-CACT-----CCTATCCCTTCCAAACTCTG H_sapiens300486 TCCCCGTGTTTGGAGG-GTCCACCC-------TATCCCATCCGAACCCTG H_sapiens300487 TCCCCGTGTT-TGGAGGGTCCACTCCTG----TCTCTTC--CAAACCCTG H_sapiens300488 TCCCCGTGTT-TGGAGGGTC-CGCT-----CCTGTCCCTTTCAAACTCTG L_africana300362 -CCCCGTGTTTGGAGG-GTCCACTC--------GTCCCTTCCGAACCCTG L_africana300391 TCT-TGTGTT-TAGAGGTCCACACCTGTCCCCTGTCCCTTCCAAACCCTG L_africana300392 -CCCCACATT-TGAAAGGTCCACATCCT----CCCCTTC--CAGTTCCGG L_africana300393 TCCCTGTGTT-TGGAGGGTCCATTCCTG----TCCCTTC--CAGACCTCC L_africana300394 TTCTCGTGTT-TGGAGGGTCCATACCCA----TCCCTTT--CAA-TGCTG L_africana300428 TGCTCGTGTT-TGGAGG-TCCACTCC------TGTCCCTTCCAGACCCTG L_africana300429 TCCCCGTGTT-TGGAGGGTCCACTCC------TGTCCCTTCCAGACCCTG L_africana300477 TCT-TGTGTT-TAGAGGTCCACACCTGTCCCCTGTCCCTTCCAAACCCTG M_mulatta300062 TCCCCGTGTT-TGGAGGGTC-CACT-----CCTGTCCCTTCCAAACTCTG M_mulatta300063 TCCCCGTGTT-TGGAGGGTGCGCTCCTG----TCTCTCC--CAACCCCTG M_mulatta300064 TCCCCGTGTTTGGAGG-GTCCACCC-------TATCCCATCCGAACCCTA M_mulatta300065 TCCCCGTGTT-TGCAGGGTC-CACT-----CCTGTCCCTTCCAAACTCTG M_mulatta300066 TCCCTGCGTT-----G-GCCCAGCC--------TTCCCTTTCAAACCCTG M_mulatta300129 -CTCCGTGTTTGGAAA-CGCTGGTGC------TTTTCTCGCA-------- M_mulatta300201 TCCCCTTGTT-TGGAGGGTC-CACT-----GCTGTCCCTTCTAAACTCTG M_mulatta300470 TTCCCGTGTT-TGGAGGGTTCACACCTG----TCCCTTT--CAAATGCTG M_mulatta300471 GCCGTGT--T-TGGAGGGTCCACATCTT----CACCTTC--CTGTCCCGG M_murinus300006 TCCCCGTGTT-TGGAGGGTCTCTACCT------GTCCCTGCCAAACTCTG M_murinus300007 TCCCCGTGTT-TGGAGGGTCTGCTCCC------GTCCCTGCCAAACTCTG M_murinus300373 GCCCTGTG-T-TGGAGGGTCAACAGCCT----CACCTTC--CTGTTCCGG M_murinus300374 TTCCCGTGTT-TGGAGGGTTCACACCTA----TCCCTTT--CAAATGCTG M_domestica300021 TTCCCGTGTT-TGAAGGGTCAGCATC------CGGCCCTTGCAAACCCTG M_musculus300279 -CCCGGCGTG-TGGAAGGTCTGATTC------TATCCTTGTCAATCCCTG M_musculus300282 TCCCCGTGTT-TGGAGGATCTACACT------TGTCCTTGCCAAACGCTG M_musculus300295 -CTCTGTGTT-TTGAAGATCCATTCC------TGTTCTTGCTAAACCCTG M_musculus300343 TCCC-GTGTT-TGGAGGATCCACACT------CATCCTTGCCAAACCCTG M_musculus300398 -CCATGTGTT-TGGAAGGTT-GCTTC------TGTCCTTGCCAAACTCTG M_musculus300417 TCCCCGTGTT-TGGAGGATC-ACACT------TGTCCTTGCCAAACCCTG M_musculus300418 GCTCCGAGCT-CGGGGCGTCTG-----------G------------CCTG M_musculus300419 TCCCCGTGTT-TGGAGGATCCACACT------CGTCCTTGCCAAACCCTG M_musculus300420 -CTC-ATGTT-TGGAAGGTCCACTCC------TATCCTTACCAGATCCTG M_musculus300533 TCCCTGTGTT-TAGGGGATTCACATT------CGTACTTGCCAAACCCTG M_musculus300554 TTCCCAAGTTTGAGAGCATCCATCCT------GACC-CCTCCAAAGCCTG M_musculus300684 TCCTGATGTC-TGGAAGGTCAGCTCCTG----TCCTTGC--CAAACCCTG M_musculus300703 -TCCTGTGTT-TGGAAGGTCAACTCC------TGTCCTTGTGAAACCTTG M_musculus300986 GTCCCGTGCT-TGGAAGGTCCACACCCA----TGCCTTC--CAATGCTGG M_musculus300987 TTCCCGTGTT-TGAAGGGTCCACTCC------TCCCTCT--CAAATGCTG M_lucifugus300872 TCCCCGTGTTTGGAGG-GTCCACCCA------TGTCCCTTCCAAACCCTG M_lucifugus300343 TCCCCCTGTT-TGGAGGGCCCACCCCTG----TCTCATC--CACACCCTG M_lucifugus300191 TCCCCGTGTTTGGAGG-GTCCACCCA------TGTCCCTTCCAAACCCTG M_lucifugus300082 TCCCTGTGTT-TGGAGGGTC-CACC-----CATGTCCCTTTCAAACCCTG M_lucifugus300873 TCCCCGTGTTTGGAGG-GTCCA-CCC------CGTCCCTTGCGAACCCTG M_lucifugus300648 TCCCCATGTTTGAAGG-GTCCAGC--------TCTCCCTTCCAAATCCTG M_lucifugus300385 TCCCCGTGTTTGAAGG-GTCCAGC--------TGTCCCTTCCAAACCCTG O_anatinus304343 TTCCCGTGTT-TGGAGGGTC--CACC------TGTCCCATCCAAACCCTG O_cuniculus300080 TCCCCGTGTT-TGGAGGGTCCGCGCC-------GTCCCTGCCGAACCCTG O_cuniculus300148 TCCCCGTGTT-TGGAGGGTCCGCGCC-------GTCCCTGCCGAACCCTG O_cuniculus300149 -TCCC-TGTT-TGGAGGGGCCGTATCCT----GGCCTTC--CAGCTCTAG O_cuniculus300150 TTCCCGTGTT-TGGAGGGTCCACGCCTG----TCCCTTT--CAAATGCTG O_garnettii300070 TCCCCGTGTT-TGGAGGGTCCGCTC-------TGTTGCTTCCAAATCCTG O_garnettii300071 TCCCCGTGTT-TGGAGGGTCCACTCCTG----TCCCTTC--CAAACCCTG O_garnettii300072 TCCCCGTGTTTGGAGG-GCCCTCACC------TGTCCCTTACAAACCCTG O_garnettii300394 TCCTCGCGCT-TGGAGGGGCCGTT--------TGTCCCTT------CCTG O_garnettii300506 TCCCCATGTT-TGCAAGGTCCATTCCTG----TCTCTTC--CAAACCCTG P_troglodytes300035 CCCCCTTGTT-TGGAGGGTC-CACT-----CCTGTCCCTTCTAAACTCTG P_troglodytes300734 TTCCCGTGTT-TGGAGGGTTCACACCTG----TCCCTTT--CAAATGCTG P_troglodytes300732 TCCCCGTGTT-TGGAGGGTC-CACT-----CCTGTCCCTTTCAAACTCTG P_troglodytes300731 TCCCCGTGTT-TGGAGGGTCCGCTCCTG----TCTCTTC--CAAACCCTG P_troglodytes300730 TCCCCGTGTTTGGAGG-GTCCACCC-------TATCCCATCCAAACCCTG P_troglodytes300729 TCCCCGTGTT-TGAAGGGTT-CACT-----CCTATCCCTTCCAAACTCTG P_troglodytes300728 TCCCTGCGTT-----G-GTCCAGCC--------TTCCCTTTCAAACCAGG P_troglodytes300317 -TTCTGTATTTGGAGG-GTCCATCTC------TATCCTTGGAAATGCTAG P_troglodytes300733 GCTGTGT--T-TGGACGGTCCACATCTT----CACCCTC--CTGTCCCAG P_pygmaeus300041 -TTCTGTATTTGGAGG-GTCCATCTC------TATCCTTGGAAATGCTAG P_pygmaeus300196 TCTCCTTGTT-TGGAGGGTC-CACT-----CCTGTCCCTTCTAAACTCTG P_pygmaeus300510 GCTGTGT--T-TGGAGGATCCACATCTT----CACCTTC--CTGTCCCAG P_pygmaeus300511 TTCCCGTGTT-TGGAGGGTTCACATCTG----TCCCTTT--CAAATGCTG P_pygmaeus300628 TCCCTGCGTT-----G-GTCCAGCC--------TTCC-TTTCAAACCCTG P_pygmaeus300629 TCCCCGTGTT-TGAAGGGTC-CACT-----CCTGTCCCTTCCAAACTCTG P_pygmaeus300630 TCCCTGTGTTTGGAGG-GTCCACCC-------TATCCCATCCCAACCCTG P_pygmaeus300631 TCCCCGTGTT-TGGAGGGTCCACTCCTG----TCTCTTC--CAAACCCTG P_pygmaeus300632 TCCCCGTGTT-TGGAGGGTC-CACT-----CCTGTCCCTTTCAAACTCTG R_norvegicus300584 -CTGGGTGTT-TGGAAAGTCTGCTCC------CGTCCTTGTCAAAGCCTG R_norvegicus300652 -CCCTATGAT-TGCAAGGTCCACTTC------TGTCCTTACCAGATCCTG R_norvegicus300655 -CCCTGTATT-TGGAAGGTCCACTCC------TGTCCTTGTCAAACCTTG R_norvegicus300957 GTCCAGTGTT-TGGAAGGTCCACACCCA----TGTCTTC--CAATGCTGG R_norvegicus300958 TTCCCGTGTT-TGAAGGGTCCACTCC------TCCCTCT--CAAATGCTG R_norvegicus300020 TCCCCGTGTT-TGGAGGACCCACACT------TATCCTTGCCAAACCCTG R_norvegicus300018 TCCCCGTGTT-TGGAAGGTC---TCC------TGTCCTTACCAAACCCTG R_norvegicus300019 GTTCTGAGTT-CGGTCTATCCT-----------GACCCCTCCAAATCCTA R_norvegicus300053 TCCCCATGTT-TGGAGGACCCAACCT------TATCCTTGCCAAACCTTG R_norvegicus300265 TCCCCAAGTTTGAGGGCATCCATCCT------GACT-CCTCCAAAGTCTG R_norvegicus300286 -TTCTG-GTT-TTGAAGGTCCATTTC------TATCCTTGCTAAACCTTG R_norvegicus300398 CCGTCATGTC-TGGAAGGTC-GCCCCTG----TCCTTGC--CAAACCCAG S_araneus300209 TCCCCGTGTT-TGGGGGGTC-TCC--------TGTCCCTTCCAGACCCTG S_araneus300210 TCCCCGTGTTCGGAGG-GTCAGCCC-------TGTCCCTCCCGAACCCTG S_araneus300573 TTCCCGTGTC-TGGGGGGTG-TCC--------TGTCCCTTCCAGACCCTG S_araneus300668 TCCCCGTGTC-TGGGGGGTG-TCC--------TGTCCCTTCCAGACCCTG S_araneus300801 TCCCCGTGTT-TGGGGGGTC-TCC--------TGTCCCTTCCAGACCCTG S_tridecemlineatus300216 TCCCCGTGTTTGGAGG-GTCCACCC--------ATCCCTTCCAAACCCTG S_tridecemlineatus300217 TCCCCGTGTT-TGGAGGGTCCACTTC------TGTCCTTGCCAAACCCTG S_tridecemlineatus300275 TCCCCGTGTT-TGGAGGGTC-TGCT-----TTTGTCCCTTTCGAATTCTG S_tridecemlineatus300088 TTCCCGTGTT-TGGAGGGTCCAGTCTG-----TCCCTCT--CAAATGCTG S_tridecemlineatus300215 TCCCCGTGTT-TGGAGGGTC-TGCA-----TTTGTCCCTTTCAAACTCTG T_nigroviridis300085 TTCCCGTGTT-TGTGG-----GACTG--------TTCCCATCAAACCCTG T_nigroviridis300087 TTCCCGTGTT-TGCAG-----GAGCGTG----CGTTCCTCTCAGACCCTG T_nigroviridis300088 TTCCCGTGTT-TGCAG-----GAGCGTG----CGTTCCTCTCAGACCCTG T_nigroviridis300086 TTCCCGTGTT-TGAAG-----GCCTGAA----CGTTCCTCTCAGACCCTG T_belangeri300155 GCCCCGTGTT-AGGAGGGTCCATGTATT----TGCCTTT--CAGTTCTGA T_belangeri300186 TCCCCGTGTT-TGGAGGGTCCAC-CC------TGTCCCTTCCGAACCCTG T_belangeri300187 TCCCCGTGTT-TGGAGGGTCTA-CGC------TGTCCCTTTCAAACCCTG T_belangeri300188 TCCCCGTGTT-TGGAGCGTCCAC-CC------TGTCCCTTCCGAACCCTG T_belangeri300222 TCCCCGTGTT---GAGGGTC-AC-CC------TGTCCTTC---GACCCTG T_belangeri300258 GCCCCGTGTT-AGGAGGGTCCATGTATT----TGCCTTT--CAGTTCTGA T_belangeri300259 TTCCCGTGTT-TGGAGGGTTCGCGCCTG----TCCCTTT--CAAATGCTG T_belangeri300267 GCCCAATGTT-TGGAGGGTCCATGTATT----TGCCTTT--CAGTTCTGA T_belangeri300081 GCC-AGCGTT-TGCAGGTTCCATGTGGT----TGCCTTC--CAGTTCTGG T_belangeri300347 TCCCTGTGTT-TGGAGGGTCCAC-CC------TGTCCCTTCCGAACCCTG X_tropicalis300040 TTCCCGTGTT-TGTAGTGT-TGCTTG------TATACTGAC-AAACCCTG X_tropicalis300127 ATCCCGTGTT-TGGCGAGTGTGACTT------TGTATTAGCCAAACCCTG C_familiaris300114 A-GCATTCT-GCA---------------- C_familiaris300115 GTGCTTTCACACA---------------- C_familiaris300193 GAGCTTTCTCATGCTAGCTTTTTTTTCTC C_familiaris300194 GAGCTTTCATACA---------------- C_familiaris300195 GAGCACGAC-------------------- C_familiaris300196 GAGCTTTCCCACA---------------- C_familiaris300256 GGGCTTTCCCACA---------------- C_porcellus300150 GAGCTTTCCCACA---------------- C_porcellus300151 ATGCTTCCACACA---------------- C_porcellus300152 GAGCTTTTGCACA---------------- C_porcellus300171 GAGCTTTCCCACA---------------- C_porcellus300172 GTGCTTTCCCACA---------------- C_porcellus300173 GAGCTTTTGCACA---------------- C_porcellus300549 GCGCTTTCCCACA---------------- C_porcellus300738 GAGCTTTCCCACA---------------- C_porcellus300761 GAGCTTTCCCACA---------------- C_porcellus301040 GTGCTTTCCCACA---------------- C_porcellus301041 GAGCTTTCCCACA---------------- C_porcellus301042 GAGCTTTCCCACA---------------- D_rerio300292 AATCTTTCACACA---------------- D_rerio300293 AATCTTTCACACA---------------- D_novemcinctus300040 GAGTTTGCTATA----------------- D_novemcinctus300102 GAGCTTTCCCACA---------------- D_novemcinctus300193 GCGCTTTCACACA---------------- D_novemcinctus300203 GCGCTTTAACACA---------------- D_novemcinctus300288 GCACTTTCATACA---------------- D_novemcinctus300302 A-GCTTTCCAACA---------------- E_telfairi300059 G-GCTTTCACACA---------------- E_telfairi300075 GTGTTTTCACGCA---------------- E_telfairi300307 GTGCTTTCACACA---------------- E_telfairi300362 GTGTTTTCACGCA---------------- E_telfairi300381 GAACAAG---------------------- E_telfairi300434 GTGCTTTCACACA---------------- E_telfairi300445 GAGCTTTCCCACA---------------- E_telfairi300464 GCGCTTTCACACA---------------- E_telfairi300469 GTGCTTTCACACA---------------- E_telfairi300527 GAACAAG---------------------- E_telfairi300530 GTGTTTTCACGCA---------------- E_telfairi300574 GTGCTTTCACACA---------------- E_telfairi300606 GTGTTTTCACGCA---------------- E_caballus300110 AAGCTTTCCCACA---------------- E_caballus300111 GAGCTTTCGTACA---------------- E_caballus300112 ----------------------------- E_caballus300113 GAGCTTTCCCACA---------------- E_caballus300183 GAGCTTTCCTGCA---------------- E_caballus300184 GAGCTTTTCCACA---------------- E_caballus300185 GCGCTTTCACACA---------------- E_europaeus300021 AAGCTTTCTCACA---------------- F_catus300008 GAGCTTTCCCACA---------------- F_catus300101 GAGCTTTCCCACA---------------- F_catus300102 GAGCTTTCGTACA---------------- F_catus300103 GAGCTTTCCCACA---------------- F_catus300177 GCGCTTTCGCACA---------------- F_catus300199 GAGCTTTCATACA---------------- G_gallus300038 TAGCGTTCGGACA---------------- H_sapiens300485 GAGCTTTCGTACA---------------- H_sapiens300486 AAGCTTTCACACAACT------------- H_sapiens300487 GAGCTTTCCCACA---------------- H_sapiens300488 GAGCTTTCTCACA---------------- L_africana300362 AAACTTTCACACA---------------- L_africana300391 GAACTCTCCCTCA---------------- L_africana300392 GAGCCCTCCCACA---------------- L_africana300393 C-ACATGTCTTTCT--------------- L_africana300394 ACGCTTNNNNNNN---------------- L_africana300428 GAGCTTTCTCACG---------------- L_africana300429 GAGCTTTCCTACA---------------- L_africana300477 GAACTCTCCCTCA---------------- M_mulatta300062 GAGCTTTCTCACA---------------- M_mulatta300063 GAGCTTTCCCACA---------------- M_mulatta300064 AAGCTTTCACACA---------------- M_mulatta300065 GAGCTTTCGTACA---------------- M_mulatta300066 GAGCTTTCCCATG---------------- M_mulatta300129 ----------------------------- M_mulatta300201 GAGTTTTTCCACA---------------- M_mulatta300470 GCGCCTTCACACA---------------- M_mulatta300471 GAACTTTCCTACA---------------- M_murinus300006 GAGCTTTCGTACA---------------- M_murinus300007 GAGCTTTCCCACA---------------- M_murinus300373 GA-CTTTCCCCTAC--------------- M_murinus300374 GCGCTTTCACACA---------------- M_domestica300021 TACCTTTCACACA---------------- M_musculus300279 GCGCTTTGGAATA---------------- M_musculus300282 GTGCTTTTTAATA---------------- M_musculus300295 GTGCGTTTGAACA---------------- M_musculus300343 GTGCTTTCCCACA---------------- M_musculus300398 GTGCTTCTAACA----------------- M_musculus300417 GTGCTTTCGAACA---------------- M_musculus300418 GAGCTTTCCTACA---------------- M_musculus300419 GTGCTTTCCCACA---------------- M_musculus300420 GTGCTTTTGAACA---------------- M_musculus300533 GTGTTTTCCCACA---------------- M_musculus300554 GAGCTTTTCTACA---------------- M_musculus300684 GTATTTTTAGCACA--------------- M_musculus300703 GTGCTTTCGAAGA---------------- M_musculus300986 GAGCTTTCCCACA---------------- M_musculus300987 GCGCTTTCACACA---------------- M_lucifugus300872 GCGCTTTCGGACA---------------- M_lucifugus300343 A-GCGTCCTCGCCTG-------------- M_lucifugus300191 GCGCTTTCGGACA---------------- M_lucifugus300082 GTGCTTTCGGACA---------------- M_lucifugus300873 GCGCTTTCACACA---------------- M_lucifugus300648 GAGCTTTCACACA---------------- M_lucifugus300385 GAACTTTCACACA---------------- O_anatinus304343 TAACTTTCTAACA---------------- O_cuniculus300080 GAGCTGTCGCACA---------------- O_cuniculus300148 GAGCGTTCGCACA---------------- O_cuniculus300149 GAATGCCCTCACA---------------- O_cuniculus300150 GCGCTTTCACACA---------------- O_garnettii300070 GAGCTTTCACACA---------------- O_garnettii300071 GCGCTTTCC-CACA--------------- O_garnettii300072 GAGCTTTCTCACA---------------- O_garnettii300394 GAGCTTTCACACA---------------- O_garnettii300506 GAGCCGCCTTCCCCCC------------- P_troglodytes300035 GAGTTTT-CCACA---------------- P_troglodytes300734 GCGCTTTCACACA---------------- P_troglodytes300732 GAGCTTTCTCACA---------------- P_troglodytes300731 GAGCTTTCCCACA---------------- P_troglodytes300730 AAGCTTTCACACA---------------- P_troglodytes300729 GAGCTTTCGTACA---------------- P_troglodytes300728 GAGCTTTCCCACG---------------- P_troglodytes300317 TGCTTTTCTCACA---------------- P_troglodytes300733 GAGCTTTCCTACA---------------- P_pygmaeus300041 TGGTTTTCTCACA---------------- P_pygmaeus300196 GAGTTTTTCCACA---------------- P_pygmaeus300510 GAGCTTTCCTACA---------------- P_pygmaeus300511 GCGCTTTCACACA---------------- P_pygmaeus300628 GAGCTTTCCCACA---------------- P_pygmaeus300629 GAGCTTTCGTACA---------------- P_pygmaeus300630 AAGCTTTCACACA---------------- P_pygmaeus300631 GAGCTTTCCCACA---------------- P_pygmaeus300632 GAGCTTTCTCACA---------------- R_norvegicus300584 GTGCTTTGGAACA---------------- R_norvegicus300652 GTGCTTTTAAACA---------------- R_norvegicus300655 GTGCTTTAGAACA---------------- R_norvegicus300957 GAGCTTTCCCACA---------------- R_norvegicus300958 GTGCTTTCACACA---------------- R_norvegicus300020 GTGCTTTCCCACA---------------- R_norvegicus300018 GTGCTTTCGAACA---------------- R_norvegicus300019 GAGCTTTCCTACA---------------- R_norvegicus300053 GTGCTTTCCCACA---------------- R_norvegicus300265 GAACTTTTCTACA---------------- R_norvegicus300286 GTATTCTTGAAAA---------------- R_norvegicus300398 GTATTTTATATATA--------------- S_araneus300209 GTGCTTTCGTACA---------------- S_araneus300210 AAGCTTCCCCACA---------------- S_araneus300573 GTGCTTTCGTACA---------------- S_araneus300668 GTGCTTTCGTACA---------------- S_araneus300801 GTGCTTTCGTACA---------------- S_tridecemlineatus300216 TAGTTTTCCCACA---------------- S_tridecemlineatus300217 GAGCTTTCCCACA---------------- S_tridecemlineatus300275 GAGCTTTTGTACA---------------- S_tridecemlineatus300088 GTGCTTTCACACA---------------- S_tridecemlineatus300215 GAGCTTTTGTACA---------------- T_nigroviridis300085 GCGCTCTCATACA---------------- T_nigroviridis300087 GTGCTCTCACACA---------------- T_nigroviridis300088 GTGCTCTCACACA---------------- T_nigroviridis300086 ATGCTCTCAGACA---------------- T_belangeri300155 GCGCTTTCTCATA---------------- T_belangeri300186 AAGCTTTCGTACA---------------- T_belangeri300187 GAGCTTTCCCACA---------------- T_belangeri300188 GAGCTTTCCTACA---------------- T_belangeri300222 AAGCTTTCGTACA---------------- T_belangeri300258 GCGCTTTCTCATA---------------- T_belangeri300259 GCGCTTTCACACA---------------- T_belangeri300267 GAGCTTTCCCACA---------------- T_belangeri300081 GAGCTTTGCCACA---------------- T_belangeri300347 AAGCTTTCGTACA---------------- X_tropicalis300040 TAACTTACACACA---------------- X_tropicalis300127 TGACTTTTGCACA----------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved