snOPY snoRNA Orthological Gene Database

Family: SNORA69

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300216 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- C_porcellus300471 AAAGCAGGTT-GCAATTACGGTGCT--TCAT-TTTGTGGAAGTACTG--- D_rerio300125 AAAGCAGGAC-GCAATTACAGTGCTAAACTCTTTTGTGGGAGTACTG--- E_telfairi300071 AAAGCAGGCT-GCAATTACAGTACT--TCAG-TTTGTGGAAGTACTG--- E_telfairi300094 AAAGCAGGCT-GTAATTGCAGTGCT--TTAG-TTTGTGGAAGTACTG--- E_telfairi300526 AGAGCAGGCT-GCAATTACAGTACT--TCAG-TTTGTGGAAGTACTG--- E_telfairi300560 CAAGCAAGCT-GCAATTACAGTACT--TCTG-TTAGTGGAAGTCCTG--- E_telfairi300680 AAAGCAGGCT-GCAATTACAGTACT--TCAG-TTTGTGGAAGTACTG--- E_telfairi300746 AAAGCAGGCT-GCAATTACAGTACT--TCGG-TTTGTGGAAGTACTG--- E_caballus300272 TAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- E_europaeus300292 AAAGCAGGTT-GCAATTACAGTGCT--TCATGTCTGTGGAAGTACTG--- F_catus300240 AAAGCAGGTT-GCAATTACAGTGCT--TCGT-TTTGTGGAAGTACTG--- G_gallus300083 ATAGCAGGCT-GCAATTGCAGTGCT--TCAT-TCTGTGGGAGTACTG--- G_gorilla300489 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- G_gorilla300270 AAAGCAAGCT-GGAATTACAGTGCT--TCAT-TTTGTGAA-ATACTAAAT H_sapiens300643 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- M_mulatta300071 AAAGCAAGCT-GCAATTACAGTGCT--TCAT-TTTGTGAA-ATACTAAAT M_mulatta300697 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- M_murinus300143 AAATCAGGTT-GCAATTATAGTGCT--TCAT-TTTCTGGA-GCACTG--- M_murinus300245 TACGCAGGTT-GTAATTACAGTGCT--TTGT-TTTGGGGAAGTACTG--- M_murinus300558 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- M_musculus300829 AAAGCAGGTA-GCAATTACAGTGCT--TCAT-TTTGTGGGAGTACTG--- M_musculus300901 AAAGCAGGTT-ACAAGTATAGCTCT--TCAT-TTTGTGGAATTACTGCTC O_anatinus304448 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TCTGTGGGAGTACTG--- O_cuniculus300182 AAAACAGTTT-GCAGTTATA---CT--ACAT-TTTGTGGCAATACTG--- O_cuniculus300406 AAAGCAGGTT-GCAATTACAGTGCT--TTAT-TTTGTGAAAGTACTG--- O_garnettii300335 TAGGCAGGTT-GCAATCATAGTGCT--TCAT-TTGGGGGAAGTACTG--- O_garnettii300482 AAAGCAGGTT-GCAATTC---TGCT--TCAT-TTTGTGGA-GTATAG--- O_garnettii300585 AAAGCAGGTT-GCAATTACAGTACT--TCAT-TCTGTGGAAGTATTG--- P_troglodytes300209 AAAGCAAGCT-GGAATTGCAGTGCT--TCAT-TTTGTGAA-ATACTAAAT P_troglodytes300504 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- P_pygmaeus300213 AAAGCAAGCT-GCAATTACAATGCT--TCAT-TTTGTGAA-ATACTAAAT P_pygmaeus300248 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- R_norvegicus300369 AGAGCAGGTA-GCAATTACAGTGCT--TCAT-TTTGTGGGAGTACTG--- R_norvegicus300004 TGAGCAGGTA-GCAATTACAGTGCT--TCAT-TTTGTGGGAGTACTG--- S_araneus300400 TGAGCAGGTT-GCAATTCCAGTGTT--TTGTTTTTGTGGGAGTACTG--- S_tridecemlineatus300022 AAAGCAGATT-GCTATTATGGTATT--CCTT-TTCTTGAAAATATT---- S_tridecemlineatus300246 AGAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- T_nigroviridis300154 AAAGCAGGTCTGCAATTGCAGC----AGTTCTTGTGGTGGAGTGCTG--- T_nigroviridis300006 AAAGCAGGTCTGCAATTGCAGC----AGTTCTTGTGGTGGAGTGCTG--- T_belangeri300243 AAAGCAGGTT-GCAATTACAGTGCT--TCAT-TTTGTGGAAGTACTG--- X_tropicalis300018 AAAGCAGGTT-GCAATTACAGTTCT--TCAT-TCTGTGGAGTTGCTG--- ** * C_familiaris300216 -ACATTA-CCCTGCT--GAAAGAAAATGT-GTGTC-GATC--ATTTTTGA C_porcellus300471 -CCATTA-CCCTGCT--AAAAGAAAAGGCTGTGTT-GGTT--GGTTTTGA D_rerio300125 -CCATTA-TCCTGCT----GAGAGCATCTTCTGCT--GTGGAGTCTTGAT E_telfairi300071 -CCATTA-TCCTGCT--GAGAGAAAAAGCCATATT-GGCACAGGCTCTGG E_telfairi300094 -CCATTG-TCCTGCT--GAAAGAAATAGCCATGTT-GGCC---GGCCTGG E_telfairi300526 -CCATTA-TCCTCCT--GAGAGAAAAAGCCATGTT-GGCC--GGCTCTGG E_telfairi300560 -CCATTA-TCCTACT--GAGAGAAAAAGCCATGTT-GGCC--GGCTCTGG E_telfairi300680 -CCATTA-TCCTGCT--GAGAGAAAAAGCCATGTT-GGCC--GGCTCTGG E_telfairi300746 -CCATTA-TCCTGCT--GAGAGAAAAAGCCATGTT-GGCC--GGCTCTGG E_caballus300272 -ACATTA-TCCTGCT--GAAAGAAAATCTTGTGTG-GATC--ATTTTTGA E_europaeus300292 -CCATTA-CCCTGCT---GAGAGAAAACCTGTGTC-AATCG-TTTTTGTT F_catus300240 -ACATTA-TCCTGCT--GAAAGAAAAACA-GTGTT-GATC--ATTTTTGA G_gallus300083 -CCATTT-TCCTGCT---GAGAGTAATTCTGTT---AATGCTGTGTTTGG G_gorilla300489 -CCATTA-TCCTGCT---GAAAGAAAAGCCGTGTT-AATC--ATTTTTGA G_gorilla300270 ACCATCA-TTATGCTGCTGAAAGAAAAGCTGTTTT-AATG--ATTTTTGA H_sapiens300643 -CCATTA-TCCTGCT---GAAAGAAAAGCCGTGTT-AATC--ATTTTTGA M_mulatta300071 ACTGCCA-TTATCCTGCTGAAAGAAAAGCTGTGTT-AATG--ATTTTTGA M_mulatta300697 -CCATTA-TCCTGCT---GAGAGAAAAGCCGTGTT-AATC--ATTTTTGA M_murinus300143 -CCATTA-TCCTGCT---GAAAGAATACCTGTGTT-AATC--ATTTTTTA M_murinus300245 -CTGTTA-TCCTGCT---GAAAGACAAGCTGTGTT-AGTC--ATTTTTGA M_murinus300558 -CCATTAATCCTGCT---GAAAGAAAAGCTGTGTT-AATC--GTT-TTGG M_musculus300829 -CCATTA-TCCTGCT--GAAAGAAAAG-CCATGTT-GGTT--GTTTCTGA M_musculus300901 TTTACTA-CCCTGCT----AAAGAGCAGCCATGTT-GATG--C-CTCTGA O_anatinus304448 -CCATTA-CCCTGCT---GAGAGTAAAGCTGTGTTAAATATTGCTTTGGT O_cuniculus300182 -ATATTA-TCCTGCT----GAAA-GAAGCTGTGTT-ACTC--ATTTTCGA O_cuniculus300406 -TCATTA-TCCTGCT--GAAAGAAA-AGCTGTGTT-GGTCC--TTTTTGA O_garnettii300335 --CATTA-TCCTGGTTGGGGAAAAAAAGCTGTGCT-AATC--ATTTTTGA O_garnettii300482 -TCATTA-TCTTGCT---GAAA-AATATCTGTGTT-AATC--ATTTTT-A O_garnettii300585 -CCATTA-TCCTGCT---GAAAGAAAAGCCGTGTTTAATC--ATTTCCGG P_troglodytes300209 ACCATCA-TTATGCTGCTGAAAGAAAAGCTGTTTT-AATG--ATTTTTGA P_troglodytes300504 -CCATTA-TCCTGCT---GAAAGAAAAGCCGTGTT-AATC--ATTTTTGA P_pygmaeus300213 ACCATCA-TTATCCTGCTGAAAGAAAAGCTGTTTT-AATG--ATTTTTGA P_pygmaeus300248 -CCATTA-TCCTGCT---GAAAGAAAAGCCGTGTT-AATT--ATTTTTGA R_norvegicus300369 -CCATTAATCCTGCT--GAAAGAAAAG-CCATGTT-GAT---GTTTCTGA R_norvegicus300004 -CCATTAATCCTGCT--GAAAGAAAAG-CCATGTT-GAT---GTTTCTGA S_araneus300400 -GCATAA-CCCTGCT---GAAAACAAATCTGTGCC-AATCA-TTTTCTTA S_tridecemlineatus300022 TCAACTA-TCCTACT----AAAA--CAGGCATGCT-GATA--AGTTTTTA S_tridecemlineatus300246 -CCATTA-TCCTGCT--GAAAGAAA-AGCTATGTT-GATC--ATTTTTGA T_nigroviridis300154 -TCATTAACCCTGCT----GAGAGCATCTTCATCC--TCCTG--CCGGAG T_nigroviridis300006 -TCATTAACCCTGCT----GAGAGCATCTTCATCC--TCCTG--CCGGAG T_belangeri300243 -CCATTA-TCCTGCT---GAAAGAAAAGCTGTGTT-GATC--GTTATTGA X_tropicalis300018 -TCATTA-TCCTGCT---GAGAATAAAGATGTC----AGACTGAAT--GG * * C_familiaris300216 TTTTGCCTTTA-TGAGGGTAAAA-TCATG-ACAGATTGATATGGACAATT C_porcellus300471 TTTT-GCCTTTATGAGGGTAAAA-TCATG-ACAGATTGGCATGGACAGTT D_rerio300125 TACTGTCATCT----CTATATGACCAGTGAACGCTCTGCTGTGGAGACAT E_telfairi300071 TTAAAAAAA----------------------------------------- E_telfairi300094 TTTTGCCTCCT-CG--GGTGAGA-TCATG-ATCGATTATCACATACAATT E_telfairi300526 TTTTGCCTCTT-TA--GGTGAGA-TCATG-ACCGGTTAGCATGTACAATT E_telfairi300560 TTT-GCCTCTT-CA--GGTGAGA-TCATG-ACCAGTTAGCACATACAATT E_telfairi300680 TTTTGCCTCTT-CA--GGTGAGA-TCATG-ACCGGTTAGCATGTACAATT E_telfairi300746 TTTTGTCTCTT-CA--GGTGAGA-TCATG-ACCGGTTAGCACGTACAATT E_caballus300272 TTTTGCCTTTG-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAATT E_europaeus300292 TTTCCTTTTTTTTT------------------------------------ F_catus300240 TTTTGCCTCTC-TGAGGGTAAAA-TCAGG-ACAGATTGACATGGACAATT G_gallus300083 TTTTACCTATA-TGTTGGTGAAACTGTTT--GTCCTTAACATGAACATCA G_gorilla300489 TTTTGCCTTTA-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAATT G_gorilla300270 TTTTGTCTTTG-TGAGAGTAAAA-TCACG-ACAGATTGACATGGACAATT H_sapiens300643 TTTTGCCTTTA-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAATT M_mulatta300071 TTTTGTCTTTG-TGAGAGTAAAA-TCATG-ACAGATTGACATGGACAATT M_mulatta300697 TTTTGCCTTTA-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAATT M_murinus300143 TTTTGCCTTTA-TGAGGGTAAAA-TAATG-ACAGAATGAAACGGACAATT M_murinus300245 TTTTGCCTTTA-TGAGGGTAAAAATCATG-ACAGATTGGCATGGACAATT M_murinus300558 TTTTGCCTTTA-TGGGGGTAAAA-TCATG-ACAGATTGACATGGACAATT M_musculus300829 TTTTTGCTTTT---GGGGTAAAAATCGTG-ACACCTTGACATGAACAGTT M_musculus300901 TTTTACCTTTA-TGAAAGTAAAA---ATA-ACAGCCTGACAAAGACAGTC O_anatinus304448 CTTCACATTCA-TAGAGGTGAAGCCCTCC--AGT-TTAACATGTACACAT O_cuniculus300182 TTTTGCCTAAAATGCAGGTAAAA-TCATG-ACAGACTGACATGAACAATT O_cuniculus300406 TTTTGCCACTG-TGCTGGTAAAA-TCATG-ACAGACTGACATCGACAATT O_garnettii300335 TTTTGCTTTTA-TGAGAATAAGA-TGATGGACAGATTGGCACAGTCAATT O_garnettii300482 CTTTGTCTCTA-TGAGGATAAAA-TAATG-ACAAAATGACATGGACAATT O_garnettii300585 GTTTGCCTGTA-TGGGGGTAAAA-TCCTA-ACAGATTGACACGGACAATT P_troglodytes300209 TTTTGTCTTTG-TGAGAGTAAAA-TCACG-ACAGATTGACATGGACAATT P_troglodytes300504 TTTTGCCTTTA-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAATT P_pygmaeus300213 TTTTGTCTTTG-CGAGAGTAAAA-TCATG-ACAGATTGACATGGACAATT P_pygmaeus300248 TTTTGCCTTTG-TGAGGGTAAAA-TCATG-ACAGATTGACATGGACAGTT R_norvegicus300369 TTTTTGCATTTATTGGAGTAAAAATCATG-ACACTTGCATGGGGACAGTT R_norvegicus300004 TTTTTGCATTTATTGGAGTAAAAATCATG-ACACTTGCATGGGGACAGTT S_araneus300400 TTTTACTTTTTTTGGAGGTAAAATTATTG--CTGATTAGCACAGACAGTT S_tridecemlineatus300022 TTTTGCCTTTA-GGAGGTTAAAA-TCATG-ACAGATTGACAAA-ACAACA S_tridecemlineatus300246 TTTTGCCTTCT-GGG-GGTAAAA-TCATG-ACAGATTGACATGGACAATT T_nigroviridis300154 AGCTCACACTC--------------------------------------- T_nigroviridis300006 AGCTCACACTC--------------------------------------- T_belangeri300243 TTTTGCCCATA-TGGGGGTAAAA-TCAGG-ACAGATTGGCATGGACAATT X_tropicalis300018 TTTCACCTTAA-CATGGGGGAAATTGTTG--CTTCTTGACATTGACAACT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved