snOPY snoRNA Orthological Gene Database

Family: SNORA69

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300216 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT C_porcellus300471 AAAGCAGGTT-GCAATTACGGTGCTTCAT-TTTGTGGAA------GTACT D_rerio300125 AAAGCAGGAC-GCAATTACAGTGCTAAACTCTTTTGTGG----GAGTACT E_telfairi300071 AAAGCAGGCT-GCAATTACAGTACTTCAG-TTTGTGGAA------GTACT E_telfairi300094 AAAGCAGGCT-GTAATTGCAGTGCTTTAG-TTTGTGGAA------GTACT E_telfairi300526 AGAGCAGGCT-GCAATTACAGTACTTCAG-TTTGTGGAA------GTACT E_telfairi300560 CAAGCAAGCT-GCAATTACAGTACTTCTG-TTAGTGGAA------GTCCT E_telfairi300680 AAAGCAGGCT-GCAATTACAGTACTTCAG-TTTGTGGAA------GTACT E_telfairi300746 AAAGCAGGCT-GCAATTACAGTACTTCGG-TTTGTGGAA------GTACT E_caballus300272 TAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT E_europaeus300292 AAAGCAGGTT-GCAATTACAGTGCTTCATGTCTGTGGAA------GTACT F_catus300240 AAAGCAGGTT-GCAATTACAGTGCTTCGT-TTTGTGGAA------GTACT G_gallus300083 ATAGCAGGCT-GCAATTGCAGTGCTTCAT-TCTGTGGGA------GTACT H_sapiens300643 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT M_mulatta300071 AAAGCAAGCT-GCAATTACAGTGCTTCAT-TTTGTGAAATACTAAATACT M_mulatta300697 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT M_murinus300143 AAATCAGGTT-GCAATTATAGTGCTTCAT-TTTCTGGA-------GCACT M_murinus300245 TACGCAGGTT-GTAATTACAGTGCTTTGT-TTTGGGGAA------GTACT M_murinus300558 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT M_musculus300829 AAAGCAGGTA-GCAATTACAGTGCTTCAT-TTTGTGGGA------GTACT M_musculus300901 AAAGCAGGTT-ACAAGTATAGCTCTTCAT-TTTGTGGAA------TTACT O_anatinus304448 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TCTGTGGGA------GTACT O_cuniculus300182 AAAACAGTTT-GCAGTTATA---CTACAT-TTTGTGGCA------ATACT O_cuniculus300406 AAAGCAGGTT-GCAATTACAGTGCTTTAT-TTTGTGAAA------GTACT O_garnettii300335 TAGGCAGGTT-GCAATCATAGTGCTTCAT-TTGGGGGAA------GTACT O_garnettii300482 AAAGCAGGTT-GCAATTC---TGCTTCAT-TTTGTGGA-------GTATA O_garnettii300585 AAAGCAGGTT-GCAATTACAGTACTTCAT-TCTGTGGAA------GTATT P_troglodytes300209 AAAGCAAGCT-GGAATTGCAGTGCTTCAT-TTTGTGAAATACTAAATACC P_troglodytes300504 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT P_pygmaeus300213 AAAGCAAGCT-GCAATTACAATGCTTCAT-TTTGTGAAATACTAAATACC P_pygmaeus300248 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT R_norvegicus300004 TGAGCAGGTA-GCAATTACAGTGCTTCAT-TTTGTGGGA------GTACT R_norvegicus300369 AGAGCAGGTA-GCAATTACAGTGCTTCAT-TTTGTGGGA------GTACT S_araneus300400 TGAGCAGGTT-GCAATTCCAGTGTTTTGTTTTTGTGGGA------GTACT S_tridecemlineatus300022 AAAGCAGATT-GCTATTATGGTATTCCTT-TTCTTGAAA------ATATT S_tridecemlineatus300246 AGAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT T_nigroviridis300006 AAAGCAGGTCTGCAATTGCAGC----AGTTCTTGTGGTG----GAGTGCT T_nigroviridis300154 AAAGCAGGTCTGCAATTGCAGC----AGTTCTTGTGGTG----GAGTGCT T_belangeri300243 AAAGCAGGTT-GCAATTACAGTGCTTCAT-TTTGTGGAA------GTACT X_tropicalis300018 AAAGCAGGTT-GCAATTACAGTTCTTCAT-TCTGTGGAG------TTGCT ** * C_familiaris300216 G----ACATTA-CCCTGCT---GAAAGAAAATGT-GTGTC-GATC--ATT C_porcellus300471 G----CCATTA-CCCTGCT---AAAAGAAAAGGCTGTGTT-GGTT--GGT D_rerio300125 G----CCATTA-TCCTGCT-----GAGAGCATCTTCTGCT--GTGGAGTC E_telfairi300071 G----CCATTA-TCCTGCT---GAGAGAAAAAGCCATATT-GGCACAGGC E_telfairi300094 G----CCATTG-TCCTGCT---GAAAGAAATAGCCATGTT-GGCC---GG E_telfairi300526 G----CCATTA-TCCTCCT---GAGAGAAAAAGCCATGTT-GGCC--GGC E_telfairi300560 G----CCATTA-TCCTACT---GAGAGAAAAAGCCATGTT-GGCC--GGC E_telfairi300680 G----CCATTA-TCCTGCT---GAGAGAAAAAGCCATGTT-GGCC--GGC E_telfairi300746 G----CCATTA-TCCTGCT---GAGAGAAAAAGCCATGTT-GGCC--GGC E_caballus300272 G----ACATTA-TCCTGCT---GAAAGAAAATCTTGTGTG-GATC--ATT E_europaeus300292 G----CCATTA-CCCTGCT----GAGAGAAAACCTGTGTC-AATC--GTT F_catus300240 G----ACATTA-TCCTGCT---GAAAGAAAAACA-GTGTT-GATC--ATT G_gallus300083 G----CCATTT-TCCTGCT----GAGAGTAATTCTGTT---AATGCTGTG H_sapiens300643 G----CCATTA-TCCTGCT---GAAAGAAAAGCC-GTGTT-AATC--ATT M_mulatta300071 G----CCATTA-TCCTGCT---GAAAGAAAAGCT-GTGTT-AATG--ATT M_mulatta300697 G----CCATTA-TCCTGCT---GAGAGAAAAGCC-GTGTT-AATC--ATT M_murinus300143 G----CCATTA-TCCTGCT---GAAAGAATACCT-GTGTT-AATC--ATT M_murinus300245 G----CTGTTA-TCCTGCT---GAAAGACAAGCT-GTGTT-AGTC--ATT M_murinus300558 G----CCATTAATCCTGCT---GAAAGAAAAGCT-GTGTT-AATC--GTT M_musculus300829 G----CCATTA-TCCTGCT---GAAAGAAAAG-CCATGTT-GGTT--GTT M_musculus300901 GCTCTTTACTA-CCCTGCT----AAAGAGCAGCC-ATGTT-GATG--C-C O_anatinus304448 G----CCATTA-CCCTGCT----GAGAGTAAAGCTGTGTTAAATATTGCT O_cuniculus300182 G----ATATTA-TCCTGCT----GAAA-GAAGCT-GTGTT-ACTC--ATT O_cuniculus300406 G----TCATTA-TCCTGCT---GAAAGAAA-AGCTGTGTT-GGTCC--TT O_garnettii300335 G-----CATTA-TCCTGGTTGGGGAAAAAAAGCT-GTGCT-AATC--ATT O_garnettii300482 G----TCATTA-TCTTGCT---GAAA-AATATCT-GTGTT-AATC--ATT O_garnettii300585 G----CCATTA-TCCTGCT---GAAAGAAAAGCC-GTGTTTAATC--ATT P_troglodytes300209 A----TCATTA-TGCTGCT---GAAAGAAAAGCT-GTTTT-AATG--ATT P_troglodytes300504 G----CCATTA-TCCTGCT---GAAAGAAAAGCC-GTGTT-AATC--ATT P_pygmaeus300213 A----TCATTA-TCCTGCT---GAAAGAAAAGCT-GTTTT-AATG--ATT P_pygmaeus300248 G----CCATTA-TCCTGCT---GAAAGAAAAGCC-GTGTT-AATT--ATT R_norvegicus300004 G----CCATTAATCCTGCT---GAAAGAAAAG-CCATGTT-GAT---GTT R_norvegicus300369 G----CCATTAATCCTGCT---GAAAGAAAAG-CCATGTT-GAT---GTT S_araneus300400 G----GCATAA-CCCTGCT----GAAAACAAATCTGTGCC-AATC--ATT S_tridecemlineatus300022 ----TCAACTA-TCCTACT----AAAA--CAGGC-ATGCT-GATA--AGT S_tridecemlineatus300246 G----CCATTA-TCCTGCT---GAAAGAAA-AGCTATGTT-GATC--ATT T_nigroviridis300006 G----TCATTAACCCTGCT-----GAGAGCATCTTCATCC--TCCTG--C T_nigroviridis300154 G----TCATTAACCCTGCT-----GAGAGCATCTTCATCC--TCCTG--C T_belangeri300243 G----CCATTA-TCCTGCT---GAAAGAAA-AGCTGTGTT-GATC--GTT X_tropicalis300018 G----TCATTA-TCCTGCT----GAGAATAAAGATGTC----AGACTGAA * * C_familiaris300216 TTTGATTTT-GCCTTTA-TGAGGGTAAAATCATG-ACAGATTGATATGGA C_porcellus300471 TTTGATTTT-GCCTTTATGAGGGTAAAA-TCATG-ACAGATTGGCATGGA D_rerio300125 TTGATTACTGTCATCTCTATATGACCAGTGAACGCTCTGCTGTGGAGACA E_telfairi300071 TCTGGTTAA-AAAAA----------------------------------- E_telfairi300094 CCTGGTTTT-GCCTCCT-CG--GGTGAGATCATG-ATCGATTATCACATA E_telfairi300526 TCTGGTTTT-GCCTCTT-TA--GGTGAGATCATG-ACCGGTTAGCATGTA E_telfairi300560 TCTGGTTT--GCCTCTT-CA--GGTGAGATCATG-ACCAGTTAGCACATA E_telfairi300680 TCTGGTTTT-GCCTCTT-CA--GGTGAGATCATG-ACCGGTTAGCATGTA E_telfairi300746 TCTGGTTTT-GTCTCTT-CA--GGTGAGATCATG-ACCGGTTAGCACGTA E_caballus300272 TTTGATTTT-GCCTTTG-TGAGGGTAAAATCATG-ACAGATTGACATGGA E_europaeus300292 TTTGTTTTTCCTTTTTTTTT------------------------------ F_catus300240 TTTGATTTT-GCCTCTC-TGAGGGTAAAATCAGG-ACAGATTGACATGGA G_gallus300083 TTTGGTTTT-ACCTATA-TGTTGGTGAAACTGTT-TGTCCTTAACATGAA H_sapiens300643 TTTGATTTT-GCCTTTA-TGAGGGTAAAATCATG-ACAGATTGACATGGA M_mulatta300071 TTTGATTTT-GTCTTTG-TGAGAGTAAAATCATG-ACAGATTGACATGGA M_mulatta300697 TTTGATTTT-GCCTTTA-TGAGGGTAAAATCATG-ACAGATTGACATGGA M_murinus300143 TTTTATTTT-GCCTTTA-TGAGGGTAAAATAATG-ACAGAATGAAACGGA M_murinus300245 TTTGATTTT-GCCTTTATGAGGGTAAAAATCATG-ACAGATTGGCATGGA M_murinus300558 TT-GGTTTT-GCCTTTA-TGGGGGTAAAATCATG-ACAGATTGACATGGA M_musculus300829 TCTGATTTTTGCTTTT---GGGGTAAAAATCGTG-ACACCTTGACATGAA M_musculus300901 TCTGATTTT-ACCTTTA-TGAAAGTAAAA--ATA-ACAGCCTGACAAAGA O_anatinus304448 TTGGTCTTC-ACATTCA-TAGAGGTGAAGCCCTC-CAGT-TTAACATGTA O_cuniculus300182 TTCGATTTT-GCCTAAAATGCAGGTAAAATCATG-ACAGACTGACATGAA O_cuniculus300406 TTTGATTTT-GCCACTG-TGCTGGTAAAATCATG-ACAGACTGACATCGA O_garnettii300335 TTTGATTTT-GCTTTTA-TGAGAATAAGATGATGGACAGATTGGCACAGT O_garnettii300482 TTT-ACTTT-GTCTCTA-TGAGGATAAAATAATG-ACAAAATGACATGGA O_garnettii300585 TCCGGGTTT-GCCTGTA-TGGGGGTAAAATCCTA-ACAGATTGACACGGA P_troglodytes300209 TTTGATTTT-GTCTTTG-TGAGAGTAAAATCACG-ACAGATTGACATGGA P_troglodytes300504 TTTGATTTT-GCCTTTA-TGAGGGTAAAATCATG-ACAGATTGACATGGA P_pygmaeus300213 TTTGATTTT-GTCTTTG-CGAGAGTAAAATCATG-ACAGATTGACATGGA P_pygmaeus300248 TTTGATTTT-GCCTTTG-TGAGGGTAAAATCATG-ACAGATTGACATGGA R_norvegicus300004 TCTGATTTTTGCATTTATTGGAGTAAAAATCATG-ACACTTGCATGGGGA R_norvegicus300369 TCTGATTTTTGCATTTATTGGAGTAAAAATCATG-ACACTTGCATGGGGA S_araneus300400 TTCTTATTTTACTTTTTTTGGAGGTAAAATTATT-GCTGATTAGCACAGA S_tridecemlineatus300022 TTTTATTTT-GCCTTTA-GGAGGTTAAAATCATG-ACAGATTGACAAA-A S_tridecemlineatus300246 TTTGATTTT-GCCT-TC-TGGGGGTAAAATCATG-ACAGATTGACATGGA T_nigroviridis300006 CGGAGAGCTCACACTC---------------------------------- T_nigroviridis300154 CGGAGAGCTCACACTC---------------------------------- T_belangeri300243 ATTGATTTT-GCCCATA-TGGGGGTAAAATCAGG-ACAGATTGGCATGGA X_tropicalis300018 T--GGTTTC-ACCTTAA-CATGGGGGAAATTGTT-GCTTCTTGACATTGA C_familiaris300216 CAATT C_porcellus300471 CAGTT D_rerio300125 T---- E_telfairi300071 ----- E_telfairi300094 CAATT E_telfairi300526 CAATT E_telfairi300560 CAATT E_telfairi300680 CAATT E_telfairi300746 CAATT E_caballus300272 CAATT E_europaeus300292 ----- F_catus300240 CAATT G_gallus300083 CATCA H_sapiens300643 CAATT M_mulatta300071 CAATT M_mulatta300697 CAATT M_murinus300143 CAATT M_murinus300245 CAATT M_murinus300558 CAATT M_musculus300829 CAGTT M_musculus300901 CAGTC O_anatinus304448 CACAT O_cuniculus300182 CAATT O_cuniculus300406 CAATT O_garnettii300335 CAATT O_garnettii300482 CAATT O_garnettii300585 CAATT P_troglodytes300209 CAATT P_troglodytes300504 CAATT P_pygmaeus300213 CAATT P_pygmaeus300248 CAGTT R_norvegicus300004 CAGTT R_norvegicus300369 CAGTT S_araneus300400 CAGTT S_tridecemlineatus300022 CAACA S_tridecemlineatus300246 CAATT T_nigroviridis300006 ----- T_nigroviridis300154 ----- T_belangeri300243 CAATT X_tropicalis300018 CAACT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved