snOPY snoRNA Orthological Gene Database

Family: SNORA68

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300413 --------CCAGCACCTCAACCC-AAGAACTGCTG----TTTCTCATAGC C_porcellus300822 --------CTTGCACCTCAACCC-AAGAACCGCCA----CTTCCCGTAGT D_rerio300206 ------CGAGCACAC---AAACCCAAAGGTCATCTC---TCCATCAT--G D_rerio300207 ------TCTGCACAC---AAACCCAAAGGTCATCTC---TCCATCAT--G D_novemcinctus300036 --------CTCGCACCCAAACCC-AAGCACTGCAG----TTTCTATTAAC D_novemcinctus300042 --------CTCGCACGTAAACCC-AAGAATTGCTG----TTTCTTATGA- D_novemcinctus300071 --------CCCGCGCCCAAACCC-AAGAGCCGCCG----TTTGCGGTAAC D_novemcinctus300229 --------------------------GAGTGAAGAA----CCTCCACATC D_novemcinctus300351 ---ATAGCACTGCGGCTCACGCC-AAGAACCGCAG----TTTCTCCTTTC D_novemcinctus300357 --------CTCACATGCAAACCC-AAGAATTGCAG----TTGCTC-TAA- D_novemcinctus300484 ----------------------------------------AATAAATCCA D_novemcinctus300571 --------ATAGCACTTGTGTTGGAAAAACGATTT----TGTAAAA---G D_novemcinctus300611 --------CTCACACCCGAACC--AAGAGCTGCAG----TTTCTTGTAAC D_melanogaster300085 GTCGCACAAATCCCTATTGAGGCAACAGACGGCTAGTTGACCCCAGTAAG E_telfairi300209 --------CTTGCACCCAAACCC-AAGGACTGTGG----CTTCTCGTAGC E_telfairi300636 --------CTTGCACCCAAACCC-AAGGACTGTGG----CTTCTCGTAGC E_caballus300320 --------CAGGCACCTAAACCC-AAGAACTGCTG----TTTCTTGTAGC E_europaeus300014 --------CCAGCACCCAAATCC-AAGGGCTTAGT----ATTAATGTAAT E_europaeus300100 --------TTAGCACCTAAACCC-AACGGCCACTA----TTTATTATAAT E_europaeus300225 --------TCCTCACCTAAACCC-AAGGGCCACTA----TTTATTGTAAT E_europaeus300288 --------AGAACAACAAAATGGAATAAATATTTT----TTAAAAAAGAG E_europaeus300361 --------TTAGCACCTAAACCC-AAGGGCCACTA----TTTATTGTAAT E_europaeus300538 ---------------AGAGGAACTAATTTCCATTG----TTTGAGAGAGA E_europaeus300641 ---------------CCAGCACC-AAGGGCCACTA----TTTACTGTAAT F_catus300261 --------GAAGCACCTCAACCC-AAGAACTGCTG----TTTCTTGTAAT H_sapiens300560 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC H_sapiens300561 --------TTCTCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC L_africana300439 --------CTTGCACCCAAACCC-AAGAACCGCAG----TTTCTCGTAGC M_mulatta300024 --------GTCACACTTAAACTC---AACACTCTT----TTTCTTGCAGC M_mulatta300230 --------GTTGCACCTAAACCTGAAGAATCACTG----TTTCTTGAAGT M_mulatta300266 ----------ACTGCGCCCGGCC-AAGAAGCA--C----TTTCTTATTGT M_mulatta300539 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC M_mulatta300540 --------CTCTCACCTAAAGCC-AAGAATCATTG----TTTCTTGTAGC M_murinus300223 ---------TCGTTTTTGGTCACCCAGATTGATAAA----TGTGAACAAC M_murinus300230 ---------CATGTCTCTGAAACAAAG----CTCA----TAAAAATTCA- M_murinus300367 --------GTAGCACCTAAACCC-AAGAATCGCTG----TTTCTTATAGC M_musculus300378 --------CTGGCACCCAT-CCC-AAGAACTGGTG----CTGCCTGTAGT M_musculus300413 --------CCCACACCCAA-TCC-AAGAACCTCTG----CTGCCTGTAGC M_musculus300807 --------CTGGCACCCAA-CCC-AAGAACTGTCG----CTGCCTGTAGC M_musculus300869 --------GTGGCACCCAA-CCC-AAGAACTGCCG----CTGCCTGTAGC M_lucifugus300139 -------------------------------ATCT----CGCTCAAAACC M_lucifugus300361 -------------------------------ATGA----CACACTTTAAG M_lucifugus300680 --------CAAGCACCTAAACCC-AAGAACTGCTG----TTTGCTGTAGC M_lucifugus300681 --------CAAGCACCTAAACCC-AAGAACTGCTG----TTTGCTGTAGC O_anatinus304526 --------AGCACCCC-GAGCCCCAAAGATCATCAT---TTTCCT-TTAG O_anatinus304527 ------ACTGCACCCCCAAGCCCCAAAGATCATTGT---TTCCTTCTTCA O_cuniculus300145 -------TGCCCATACTAAACCC-AAGAATCACAG----TTG--TGTAGC O_cuniculus300377 --------CAAGCACCCGAACCC-CAGACCCGCCG----TGCACCGTGGC O_garnettii300174 --------CTGGCTCCCAGAAATAAAAGGCACTCT----TAAAACATAAA O_garnettii300301 --------TTTGCACCTAAACTC-CAAAATTGCTG----TTAAT-ATAGC O_garnettii300499 --------CTAAATCCCAAACCC-AAGAATTGCTG----TTTCTTGTAGC P_troglodytes300020 -----------ATACCTAAACCC-AAGAATCA--C----TTTCTTATAGT P_troglodytes300086 --------GTCGCACTTAAACTT---AAGACTCTT----TTTCTTGCAGC P_troglodytes300603 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC P_troglodytes300604 --------TTCTCACCTAAACCC-AAGAATTACTG----TTTCTTATAGC P_pygmaeus300026 --------GTCGCACTTAAACTT---AAGGCTATT----TTTCTTGCAGC P_pygmaeus300235 -----------ATACCTAAACCC-AAGAATCA--C----TTTCTTATAGT P_pygmaeus300236 --------------------------GTAGCAT-C----TNNNNNNNNNN P_pygmaeus300437 --------GTTGCACCTAAACCCAAAGAATCACTG----TTTCTTGAAGT P_pygmaeus300659 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC P_pygmaeus300660 --------CTCTCACCTAAACCC-AAGAATCACTG----TTTCTTGTAGC R_norvegicus300473 --------CAGGCACCCAA-CCC-AAGAACTGCCG----CTAC-TGCAGT R_norvegicus300581 --------CCCACACCCAG-TCC-AAGAAC-TCTG----CTGCCTGTAGC R_norvegicus300997 --------TTGGCACCCAA-CCC-AAGAACTGCCG----CTAC-TATAGC S_araneus300104 -------------------------------------------TTGTAGC S_araneus300220 -------ATGGAGATTTTTACGCAGGGGTCACTGA----AAACATTTAGA S_araneus300241 --------AAAGCAAGTAAATCC-AGGAGCTGTTGCTTCTTTGCCAATGC S_araneus300263 --------GTCTGATCTAATTTCTAAAACAAATTG-----ATATTTTAGC S_araneus300323 --------GTCTGATCTAATTTCTAAAACAAATTG-----ATATTTTAGC S_araneus300856 ----------------------------------------ATAGATCAGA S_tridecemlineatus300236 --------CTTGTATCTCAACCT-AAGAATTGCTG----TTTCTTGTAGC S_tridecemlineatus300279 --------CCTGCACCTCAACCC-AAGAATTGCTG----TTTCTCGTAGC T_nigroviridis300145 ------CATGCACCC---AAACCCAAAGCTC--CCA---CCTGCGGT--G T_belangeri300108 --------TTCTCTCCTCAACCC-AAGAGTCACTG----TTGGTCATTGC T_belangeri300173 ------------ATCCCATTTCC-AAGAATTACTG----TTTCCTATAGC T_belangeri300288 --------CTCGCACCTAAACCC-AAGGGCCGCGG----TTTGCCGTAGC T_belangeri300312 --------CTCACACCCCAACCC-AAGAGTCACTG----TTGGTTGTTGC C_familiaris300413 AGCGGTTTAAACA----GAGGTGCTAACAGCAAAGTGGATCT---CGTCG C_porcellus300822 GACGGTTTAAACA----GGGGTGCACATAGTA-AGTGGATCT---CGTCG D_rerio300206 TCTTGCCCTTGCTA---TGTGTGCGCAAAGCAAACGGAACCT---TGTCG D_rerio300207 TCTTGCCCTTGCTA---TGTGTGCGCAAAGAAAAAGGAACCT---TGTCG D_novemcinctus300036 AGTGGCTCAAACA----GCGGTGAGGACAGCA-AGTCAATCT---CGTCA D_novemcinctus300042 ----------ACA----GCAGTGCGAACAGCA-AGAGAACCT---CGGTG D_novemcinctus300071 GGCGGCTCAAGCA----GCGGCGCGGACAGCA-CGCGAGCCT---CGTCG D_novemcinctus300229 ACTCTGAGAGGCA-----CAGCATAGCCCCCAAAGGTGATGA---GGTTC D_novemcinctus300351 TGTGGTTTAAATA----GCGGTGCAAACAGCA-AGGGAATCT---CGTCG D_novemcinctus300357 ----------ACA----GTGGTGCTAAGAGGC-GGCGAAGGT---CGTCA D_novemcinctus300484 ATCT-TTAAAATAG---GA-----AAATAG-GTGTGAA-TTT---TGTTG D_novemcinctus300571 ATGTCCCCAGA--------GGTGCCAATGGCAAGCGA-ATTT---CGTCG D_novemcinctus300611 AGCGGCTCAAACA----GCGGTGTGGATAGCA-AGCGAATCT---TGTCG D_melanogaster300085 ACC--TTTGAACGCGTCTAAGTGCGAGAGAAACCGAAAGACTTGACGTCG E_telfairi300209 AGCAGTTTAAAGA----GTGGTGCGCACAGAA-AGTGGGCCT---TGTCG E_telfairi300636 AGCTGTTTAAAGA----GTGGTGCGCACAGAA-AGTGGGCCT---TGTCG E_caballus300320 AGCGGTTTAAACA----CAGGTGCTAACAGCAA-GCGGATCC---TGTCG E_europaeus300014 AGTGGTTCAAACA----CAGGTGCTAACAGCAAAGGGGGCCC---CATCG E_europaeus300100 AGTGGCTCAAACA----CAGGTGCTAACAGCAAAGGGTACCT---CGTCG E_europaeus300225 AGTGGCTCAAACA----CAGGTGCTAACAGCAAAGGATACCT---CGTCA E_europaeus300288 GCATCATCAAACA----CAGGTGCTAACAGCAAAGGGTACCT---CGTTG E_europaeus300361 AGTGGTTCAAACA----CAGGTGCTAACAGCAAAGGGTACCT---CGTCA E_europaeus300538 AAGTGCTGAAG-G------GATGCTAACAGCAAGGGGAACCT---CGCCG E_europaeus300641 AGTGGTTCAAACA----CAGGTGCTAACAGCAAAGGGTACCT---C-TCA F_catus300261 AGCGGTTTAAACA----GAGGTGCTGACAGCAA-GTTGATCT---CGTCG H_sapiens300560 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGCGGATCT---TGTCG H_sapiens300561 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGTGAATCT---CGTCG L_africana300439 GGCGGTTTAAACA----GTGGTGCACACAGCA-AATGGACCT---TGTCG M_mulatta300024 AGTGGTTTAAACA----GAGGAACAAACAGGA-AG---ATCT---TGTCA M_mulatta300230 GATGGTTTAAATA----GAGCTGCAAACAGCA-AGCGAATCT---CATTA M_mulatta300266 GATGATTTAAACA----GA--TGCAAACAGCA-AGCACATCT---TGTCA M_mulatta300539 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGCGGATCT---CGTCG M_mulatta300540 GGTGGTTTAAACA----GAGTTATAAACAGCA-AGTGAATCT---CGTCG M_murinus300223 GTTTGTCAATACTTTCTTCAAAATGTCTCTTGAAGA--ATCC---CATCA M_murinus300230 -TCTCTTTAAACA----GAGGTGCAAACAGCAAGTGGA-TCT---CATCG M_murinus300367 AGTGGTTTAAACA----GAGGTGCCAACA----G--------------CA M_musculus300378 TGCTGTCTTAACA----GTGGTGCACACAGCA-AAGGGGCTT---TGTTG M_musculus300413 AGCCA-TTAAACC----GTGGTGTGCACAGCA-AAGGGGCTT---TGCTG M_musculus300807 GGCTGTTTAAATA----GTGGTGCACACAGCA-AAGGGGCTT---CGTCG M_musculus300869 AGCTGTTTAAATA----GTGGTGCACACAGCA-AAGGGGCTT---TATCG M_lucifugus300139 AAGTGCAGAAACA------GGTGCTAACAGCAAGTGGA-TCT---TGTTG M_lucifugus300361 AATTGTGAACAG--------GTGCTAACAGCAAGTGGA-TCT---TGTCG M_lucifugus300680 AGCAGTTGAAACA----G--GTGCTAACAGCAA-GTGGATCT---TGTCG M_lucifugus300681 TGCAGTTGAAACA----G--GTGCTAACAGCAA-GTGGATCT---TGTCG O_anatinus304526 TAATGATCTATCTT---GGGGTGCT------------------------- O_anatinus304527 CAATGATCTTATCT---GGGGTGCTGACATCAATTGTA-CCT---CGTCG O_cuniculus300145 AGTGATTTAAACA----CAGGTGTGCACAGCA-AGTGGATCT---CATCG O_cuniculus300377 CACGGCTCCAAGC----G-GGTGCAAACAGCAGCGGGGGCCT---CGTCG O_garnettii300174 ATGTCTTTAAATAA---GAGGTGCAGATAGCAAGTGGA-TCT---TGTGG O_garnettii300301 AGTGATTTAAACA----GATGTGCAGACA----AGTGGATCT---CATCA O_garnettii300499 AGTTGTTTAAACA----GGGGTGCTAACAGCA-AATTCACTT---GGGGA P_troglodytes300020 GATGATTTAAACA----GA--TGCAAACAGCA-AGCACATCT---TGTCA P_troglodytes300086 AGTGGTTTAAACA----GAGGAACAAACAGGA-AG---ATCT---TGTCG P_troglodytes300603 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGTGGATCT---CGTCG P_troglodytes300604 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGTGAATCT---CGTCG P_pygmaeus300026 AGTGGTTTAAACA----GAGGAACAAACAGGA-AG---ATCT---TGTCG P_pygmaeus300235 GATGATTTAAACA----GA--TGCAAACAGCA-AGCACATCT---TGTCA P_pygmaeus300236 GATGATTTAAACA----GA--TGCAAACAGCA-AGCACATCT---TGTCA P_pygmaeus300437 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGCGAATCT---CATTA P_pygmaeus300659 GGTGGTTTAAACA----GAGGTGCAAACAGCA-AGTGGATCT---TGTCG P_pygmaeus300660 AGTGGTTTAAACA----GAGGTGCAAACAGCA-AGTGAATCT---CGTCG R_norvegicus300473 GG-TGTTTAAACA----GTGGTGCACACAGCA-AAGTG-CTT---TGTTG R_norvegicus300581 AGGTAATTTAACA----GTGGTGTGCACAACA-AAGGGGCTT---TGTCA R_norvegicus300997 GGCTGTTTAAACA----GTGGTGCACACAGCA-AAGTG-CTT---CGTCG S_araneus300104 CGCAGCTTAA-CA----GCGGTGCCGACAGCA-AGTGCATCT---CGTCG S_araneus300220 AACTGCAAACAGA------GGTGCTGACAGCAAACAGA-TCT---TATCA S_araneus300241 AGCGGCTTAGACA----GAAGTTCTGACAGCCA-GCGGCTCT---TGTTG S_araneus300263 CTTGGCTTAAACA----GTGGTACCAACAG-A-AACGAATCT---GGTCA S_araneus300323 CTTGGCTTAAACA----GTGGTACCAACAG-A-AACGAATCT---GGTCA S_araneus300856 ATGTAATGGGTCA----GTGGTGCCAACAGCAAGTGC-ATCT---CCTTG S_tridecemlineatus300236 AGCTGTTTAAACA----GAGCTGCATACAGCAA-GTGGATCT---TGTCA S_tridecemlineatus300279 AGTGGTTTAAACA----GAGGTGCTCACAGCAA-GTGGATCT---CGTCG T_nigroviridis300145 GTGCGAGCTTGTCT---GGTGTGCTGACAGAACCTGGGCCCC---TGTCG T_belangeri300108 AGCAGTTTAAACA----GAGGTGCAGACAGCA-AGTGGATTT---CGTCA T_belangeri300173 AGTGGTTTAAACA----GAAGTGCAAACAATT-AAAGAATCT---CATCC T_belangeri300288 TGCGACTTAAACA----GGGGTGCGGACAGCA-AGCGGACCT---CGTCG T_belangeri300312 AGTGGTTTAAACA----GAGGTGCAGATGGCA-AGCAGGCCT---CCTCG C_familiaris300413 CCTTTGGGGGG----CTGTGGCTGTGCTCCTC--AAAGTGAATTTGGAGG C_porcellus300822 CCTTTGGAGGG----CTGTGGCTGTGCCCACC--AAAGTGAATTTGGAGG D_rerio300206 CCTTTCATGGGCTGTGTGTTGACGTGCCTCTG--GAAGTGAATTCAAGGA D_rerio300207 CCTTTCATGGGCTGTGTGTTGACGTGCCTCTG--AAAGTGAATTCAAGGA D_novemcinctus300036 CCTTTGGGGGG----CTGTGCC-ATGTCCCTC--AGAGTGAATGTGGAGG D_novemcinctus300042 CCTTCAGGG------CTGTGCG-GTGCCCTC-----AGTGAACGTGGAGG D_novemcinctus300071 CCTTTGGGGGG----CTGTGCC-GTGCCCCCC--GGAGTGAATGTGGAGG D_novemcinctus300229 GCTTGATGTTA-------GCACTGCTGTTTGGAGAAACTGCGGTTCTTGG D_novemcinctus300351 CCTTTGGGGTG----TAGTGCA-ATGCCCCTC--AGAATGAAGGTGGAGG D_novemcinctus300357 CCTTTTGGGGC----TTGTGCT-GTGCCCTCC--AGAGTGAACGTGGATG D_novemcinctus300484 CCTTTGG-GGGG---CTGT-ACCGTGCCCCTC--AGAGTGAATGTGGAGG D_novemcinctus300571 CCTTTGG--GGG----CTGTGCCGCACCCCTT--CCGGTGAATGTGGAGG D_novemcinctus300611 CCTTTGGGGG-----CTGTGCC-ATGCCTCTC--AGAGTGAATATGGAGG D_melanogaster300085 CATTTGCCATAAA--CCAACTCAACGGAGTGGC-GAATTGAAACTTCGAG E_telfairi300209 CCTTTGAGGGG----CTGTG-CAGTGCCCCTC--AGAGTGAATGTGAAGG E_telfairi300636 CCTTTGAGGGG----CTGCG-CAGTGCCCCTC--AGAGTGAATGTGAAGG E_caballus300320 CCTTTGAGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGA E_europaeus300014 CTTTTGGAGGA----C--TGTCTGCGCCCTTC--AAAGTGAATTTAGAGG E_europaeus300100 CCTTTGGAGGA----C--TTGCTGTGCCCTTC--AAAGTGAACTTAGAGG E_europaeus300225 TCTTTGGAGGA----C--TTCCTGTGCCCTTC--AAAGTGAATTTAGAGG E_europaeus300288 CCTTTGG--AGG----ACTTGTTGTGCCCATC--AAAGTGAACTTAGAGG E_europaeus300361 CCTTTGGAGGA----C--TTGCTATGCCCTTC--AAAGTGAACTTAGAGG E_europaeus300538 CCTCTGG--AGG---AC-TCTCTGTGCCCTTC--AAAGTGAACTTGGAGG E_europaeus300641 CCTTTGGAGGA----A--TTTCTGTGCCCTTC--AAAGTGAATTTAGAGG F_catus300261 CCTTTGGGGGG----CTGTGGCCGTGCTCCTC--AAAGTGAATTGAGAGG H_sapiens300560 CCTTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG H_sapiens300561 CCTTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGGAAATTTGGAGG L_africana300439 CCTTTGGGGAG----CTGTC-CCATGCCCCCC--AGAGTGAATATGGAGG M_mulatta300024 CCTTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACTTTGGAGG M_mulatta300230 TCTTTG-GTGG----CTGTGGCCATGCTCCTT--AAAGTGAACTTAGAGG M_mulatta300266 CCTTTGCGAGG----CAGTGGCTGTGCCCCTC--ACAGTAAATTTGGAGG M_mulatta300539 CCTTTGGGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG M_mulatta300540 CCTTTGTGGGG----CTGTGGCCATGCCCCTC--AAAGTGAATTTAGAGG M_murinus300223 CCTTTGGGGAG-------CTGTGGCAGGCCCCTCAAAGTGAATTTGGAGG M_murinus300230 CCTTTGG-GAAG---CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG M_murinus300367 CTTTTGG-GGG----CGGTTGTCATGCCCCTC--CAAGTGAATTTGGAG- M_musculus300378 CTTTTGGGGGGGGGGCTGTG-TAGTGCCCCCCC-AGAGTGAATCAGTAGG M_musculus300413 CCTTTGGGAGG----CTGTG-TGGTGCCCGC---AGAGTGGACTGGGTGG M_musculus300807 CCTTTGGGGGG----CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG M_musculus300869 CCTTTGGGGGGG---CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG M_lucifugus300139 CCTTTGG--GGG---CTGTCACTGTGCCCCTC--AAAGTGAATTGGAAGG M_lucifugus300361 CCTTTGG--GGG---CAGTCACTGTGCCCCCTC-AAAGTGAATTGGAAGG M_lucifugus300680 CCTTTGGGG-G----CTGTGACTGTGCCCCTC--AAAGTGAATTGGAAGG M_lucifugus300681 CCTTTGGGG-G----CTGTGACTGTGCCCCTC--AAAGTGAATTGGAAGG O_anatinus304526 -------------------------------------------------- O_anatinus304527 CCTTTCAAGAGCTGTTCG---AAGTGCTCCTG--AAAGTGAAATGGAAGG O_cuniculus300145 CCTTT--GGGG----CTGAGGCTGTGCCACTG--GAAGTGAATCTGGAAG O_cuniculus300377 CCTCTGAGGGG----CTGTGG--GTGCCCCCG--GGAATGAATGTGGAGG O_garnettii300174 CCTTTGGAGGGG---CTGTGACTGTGCCCCTC--GAAGTGAATGTGGGGG O_garnettii300301 CCTTTGGAGGG----CTGTGACTATGCCCCTC--AAAGTGAATGTGGAG- O_garnettii300499 GCT-----GAG----GTCATG--CCCCTNNNN--NNNNNNNNNNNNNNNN P_troglodytes300020 CCTTTGCGGGA----CTGTGGCTGTGCCCCTC--GCAGAAAATTTGGAGG P_troglodytes300086 CCTTTGAGGGG----CTGTGGTTGGGCCCCTC--AAAGTGACTTTGGAGG P_troglodytes300603 CCTTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG P_troglodytes300604 CCTTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGTAAATTTGGAGG P_pygmaeus300026 CCTTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACCTTGGAGG P_pygmaeus300235 CCTTTGCGGGG----CTGTGGCTGTGCCCCTC--GCAGTAAATTTGGAGG P_pygmaeus300236 CCTTTGCGGGG----CTGTGGCTGTGCCCCTT--GCAGTAAATTTGGAGG P_pygmaeus300437 CTTTTG-GTGG----CTGTGGCTGTGCTCCTT--AAAGTGAACTTAGAGG P_pygmaeus300659 CCTTTGAGGAG----CTGTGTCTGTGCCCCTC--AAAGTGAATTTGGAGG P_pygmaeus300660 CCTTTGCGGGG----CTGTGGCCATGTCCCTC--AAAGTGAATTTGGAGG R_norvegicus300473 CCTTTGGGAGG----CTGGA-CAGTGCCCCCC--AGAGCGAATCAGGAAG R_norvegicus300581 CCTT-GGGGGG----CTGTG-TGGTGCCCCCCCCAGAGTAGACTGGGAGG R_norvegicus300997 CCTTTGGGGGG----CTGTG-CAGTGCCCTCC--AGAGTGAATCAGGAGG S_araneus300104 CCTTTGGGGGG----CTG-GGTGGTGCCCCTC--AGAGTGAATTTGGAGG S_araneus300220 CATTTGA--GGG---GCTGGGTTGTGCCTCTT--AGAGTGAATTTAGAGG S_araneus300241 ACTTTGGAGAG----CTGTG-CTGTGCCC-TC--ACAGTGAATCTGGAGA S_araneus300263 CCTTTCAGGGG----CTG-GGCAGTGCCCCTC--AGAGTAAATTTGGAGG S_araneus300323 CCTTTCAGGGG----CTG-GGCAGTGCCCCTC--AGAGTAAATTTGGAGG S_araneus300856 CCTTTGG--GGG---GTTGGGCGGTGTCCCTC--TGAGTGAATTTGGGGG S_tridecemlineatus300236 CTTTTGGGAGG----CTATAGTTTTGCCCCTC--AAAGTGAATTTGGAGC S_tridecemlineatus300279 CCTTTGAGAGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG T_nigroviridis300145 CCTTTCTGGGACTCTTC-----TGTGTCTCTG--AAAGTGAATTCAGGGG T_belangeri300108 CCTTTGGGGAG----CTGTCG--GCTCTGGCT--GGAACCCCTGGGCAGC T_belangeri300173 TGCTTAGGGGG----CTGTGGCTGTGCCCCTT--AAAACGAATGTGGAGG T_belangeri300288 CCTTTGGGGAG----CTGTGGCCATGCCCCTC--AAAGTGAATCTGGAGG T_belangeri300312 CCTTTGGGCAG----CCGTGGCCGTGCCTCTC--GAAGTGAATTTGGAGG C_familiaris300413 --TTCTACACCC--- C_porcellus300822 --TTCCACACCC--- D_rerio300206 GCCACATCT------ D_rerio300207 GCCACATCT------ D_novemcinctus300036 --TTCTACACCC--- D_novemcinctus300042 --CTCTTCGTCC--- D_novemcinctus300071 --TTCGACAGGC--- D_novemcinctus300229 --GTTTAGATGTGAG D_novemcinctus300351 --TTACACACAC--- D_novemcinctus300357 --TCCTACACCC--- D_novemcinctus300484 --TTCTGCAGTC--- D_novemcinctus300571 --ATCCACACCC--- D_novemcinctus300611 --TTCTATGCCC--- D_melanogaster300085 --TTACAAAG----- E_telfairi300209 --TTCGACAAGC--- E_telfairi300636 --TTCGACAAGC--- E_caballus300320 --TTCTACACCT--- E_europaeus300014 --TTCTACACAC--- E_europaeus300100 --TTCTACACAC--- E_europaeus300225 --TTCTAAACTC--- E_europaeus300288 --TTCTACACAC--- E_europaeus300361 --TTCTACACAC--- E_europaeus300538 --TTCTACACAC--- E_europaeus300641 --TTCTACATAC--- F_catus300261 --TTCTACAGCC--- H_sapiens300560 --TTCCACAACT--- H_sapiens300561 --CTCTACAGCC--- L_africana300439 --TTCTACACCC--- M_mulatta300024 --TTATACACCA--- M_mulatta300230 --CT-TACCTCCC-- M_mulatta300266 --TTCTACATCC--- M_mulatta300539 --TTCTACAACT--- M_mulatta300540 --CTCTACAGCC--- M_murinus300223 --TTCTACACCA--- M_murinus300230 TTCCTCGTGG----- M_murinus300367 --GTCA--------- M_musculus300378 --TTCTACAGTC--- M_musculus300413 --TTCCATTGTC--- M_musculus300807 --CTCTACAGAA--- M_musculus300869 --TTCTACAGTC--- M_lucifugus300139 --TTCTACACTC--- M_lucifugus300361 --TTCTACACTC--- M_lucifugus300680 --TTCTACACTC--- M_lucifugus300681 --TTCTACACTC--- O_anatinus304526 --------------- O_anatinus304527 TTCAACATAT----- O_cuniculus300145 --TCTTACACCC--- O_cuniculus300377 --CCGCACATGC--- O_garnettii300174 GGTCCTACGTCC--- O_garnettii300301 --TTCTATATCC--- O_garnettii300499 --------------- P_troglodytes300020 --TTCTACATCC--- P_troglodytes300086 --TTCTACGCCA--- P_troglodytes300603 --TTCCACAACT--- P_troglodytes300604 --CTCTACAGCC--- P_pygmaeus300026 --TTCTACACCA--- P_pygmaeus300235 --TTCTACATCC--- P_pygmaeus300236 --TTCTACATCC--- P_pygmaeus300437 --CTCTACATCC--- P_pygmaeus300659 --TTCCACAACT--- P_pygmaeus300660 --CTCTACAGCC--- R_norvegicus300473 --TTCTACAGTT--- R_norvegicus300581 --TTGCATAGTC--- R_norvegicus300997 --TTCTACAGTT--- S_araneus300104 --TTCTACACGG--- S_araneus300220 --TTCTACATTG--- S_araneus300241 --TTCTACACCC--- S_araneus300263 --TTCTACAAAG--- S_araneus300323 --TTCTACAAAG--- S_araneus300856 --TTCTACACGG--- S_tridecemlineatus300236 --TTCTACATTC--- S_tridecemlineatus300279 --TTCTACACTC--- T_nigroviridis300145 TCAACAATG------ T_belangeri300108 --TCCTGGGCC---- T_belangeri300173 --TTCTTGCCCC--- T_belangeri300288 --TCCCACACCT--- T_belangeri300312 --TTCCACAGCC---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved