snOPY snoRNA Orthological Gene Database

Family: SNORA68

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300413 --------CCAGCACCTCAACCC-AAGAACTGCTGTTTCTC----ATAGC C_porcellus300822 --------CTTGCACCTCAACCC-AAGAACCGCCACTTCCC----GTAGT D_rerio300206 ------CGAGCACAC---AAACCCAAAGGTCATCTCTCCATCA--T--GT D_rerio300207 ------TCTGCACAC---AAACCCAAAGGTCATCTCTCCATCA--T--GT D_novemcinctus300036 --------CTCGCACCCAAACCC-AAGCACTGCAGTTTCTA----TTAAC D_novemcinctus300042 --------CTCGCACGTAAACCC-AAGAATTGCTGTTTCTT----ATGA- D_novemcinctus300071 --------CCCGCGCCCAAACCC-AAGAGCCGCCGTTTGCG----GTAAC D_novemcinctus300229 -------------------GAGTGAAGAACCTCCACATCAC-------TC D_novemcinctus300351 ---ATAGCACTGCGGCTCACGCC-AAGAACCGCAGTTTCTC----CTTTC D_novemcinctus300357 --------CTCACATGCAAACCC-AAGAATTGCAGTTGCTC-----TAA- D_novemcinctus300484 ------------------------------------AATAA---ATCCAA D_novemcinctus300571 --------ATAGCACTTGTGTTGGAAAAACGATTTTGTAAA---A---GA D_novemcinctus300611 --------CTCACACCCGAACC--AAGAGCTGCAGTTTCTT----GTAAC D_melanogaster300085 GTCGCACAAATCCCTATTGAGGCAACAGACGGCTAGTTGACCCCAGTAAG E_telfairi300209 --------CTTGCACCCAAACCC-AAGGACTGTGGCTTCTC----GTAGC E_telfairi300636 --------CTTGCACCCAAACCC-AAGGACTGTGGCTTCTC----GTAGC E_caballus300320 --------CAGGCACCTAAACCC-AAGAACTGCTGTTTCTT----GTAGC E_europaeus300014 --------CCAGCACCCAAATCC-AAGGGCTTAGTATTAAT----GTAAT E_europaeus300100 --------TTAGCACCTAAACCC-AACGGCCACTATTTATT----ATAAT E_europaeus300225 --------TCCTCACCTAAACCC-AAGGGCCACTATTTATT----GTAAT E_europaeus300288 --------AGAACAACAAAATGGAATAAATATTTTTTAAAA---AAGAGG E_europaeus300361 --------TTAGCACCTAAACCC-AAGGGCCACTATTTATT----GTAAT E_europaeus300538 --------AGAGGAACTAATTTCCATTGTT---TGAGAG--------AGA E_europaeus300641 ---------------CCAGCACC-AAGGGCCACTATTTACT----GTAAT F_catus300261 --------GAAGCACCTCAACCC-AAGAACTGCTGTTTCTT----GTAAT H_sapiens300560 --------ATTGCACCTAAACCC-AAGAATCACTGTTTCTT----ATAGC H_sapiens300561 --------TTCTCACCTAAACCC-AAGAATCACTGTTTCTT----ATAGC L_africana300439 --------CTTGCACCCAAACCC-AAGAACCGCAGTTTCTC----GTAGC M_mulatta300024 --------GTCACACTTAAACTC---AACACTCTTTTTCTT----GCAGC M_mulatta300230 --------GTTGCACCTAAACCTGAAGAATCACTGTTTCTT----GAAGT M_mulatta300266 ----------ACTGCGCCCGGCC-AAGAAGCA--CTTTCTT----ATTGT M_mulatta300539 --------ATTGCACCTAAACCC-AAGAATCACTGTTTCTT----ATAGC M_mulatta300540 --------CTCTCACCTAAAGCC-AAGAATCATTGTTTCTT----GTAGC M_murinus300223 --TCGTTTTTGGTCACCCAGATTGATAAATGTGAACAACGT-------TT M_murinus300230 ---------CATGTCTCTGAAACAAAG----CTCATAAAAA---TTCA-- M_murinus300367 --------GTAGCACCTAAACCC-AAGAATCGCTGTTTCTT----ATAGC M_musculus300378 --------CTGGCACCCAT-CCC-AAGAACTGGTGCTGCCT----GTAGT M_musculus300413 --------CCCACACCCAA-TCC-AAGAACCTCTGCTGCCT----GTAGC M_musculus300807 --------CTGGCACCCAA-CCC-AAGAACTGTCGCTGCCT----GTAGC M_musculus300869 --------GTGGCACCCAA-CCC-AAGAACTGCCGCTGCCT----GTAGC O_anatinus304526 --------AGCACCCC-GAGCCCCAAAGATCATCATTTTCCT---TTAGT O_anatinus304527 ------ACTGCACCCCCAAGCCCCAAAGATCATTGTTTCCTTC--TTCAC O_cuniculus300145 -------TGCCCATACTAAACCC-AAGAATCACAGTTG--T----GTAGC O_cuniculus300377 --------CAAGCACCCGAACCC-CAGACCCGCCGTGCACC----GTGGC O_garnettii300174 --------CTGGCTCCCAGAAATAAAAGGCACTCTTAAAAC---ATAAAA O_garnettii300301 --------TTTGCACCTAAACTC-CAAAATTGCTGTTAAT-----ATAGC O_garnettii300499 --------CTAAATCCCAAACCC-AAGAATTGCTGTTTCTT----GTAGC P_troglodytes300020 -----------ATACCTAAACCC-AAGAATCA--CTTTCTT----ATAGT P_troglodytes300086 --------GTCGCACTTAAACTT---AAGACTCTTTTTCTT----GCAGC P_troglodytes300603 --------ATTGCACCTAAACCC-AAGAATCACTGTTTCTT----ATAGC P_troglodytes300604 --------TTCTCACCTAAACCC-AAGAATTACTGTTTCTT----ATAGC P_pygmaeus300026 --------GTCGCACTTAAACTT---AAGGCTATTTTTCTT----GCAGC P_pygmaeus300235 -----------ATACCTAAACCC-AAGAATCA--CTTTCTT----ATAGT P_pygmaeus300236 --------------------------GTAGCAT-CTNNNNN----NNNNN P_pygmaeus300437 --------GTTGCACCTAAACCCAAAGAATCACTGTTTCTT----GAAGT P_pygmaeus300659 --------ATTGCACCTAAACCC-AAGAATCACTGTTTCTT----ATAGC P_pygmaeus300660 --------CTCTCACCTAAACCC-AAGAATCACTGTTTCTT----GTAGC R_norvegicus300473 --------CAGGCACCCAA-CCC-AAGAACTGCCGCTAC-T----GCAGT R_norvegicus300581 --------CCCACACCCAG-TCC-AAGAAC-TCTGCTGCCT----GTAGC R_norvegicus300997 --------TTGGCACCCAA-CCC-AAGAACTGCCGCTAC-T----ATAGC S_araneus300104 --------------------------------------TTG-----TAGC S_araneus300220 --------ATGGAGATTTTTACGCAGGGGTCACTGAAAACA---TTTAGA S_araneus300241 --------AAAGCAAGTAAATCC-AGGAGCTGTTGCTTCTTTGCCAATGC S_araneus300263 --------GTCTGATCTAATTTCTAAAACAAATTGATATTT-----TAGC S_araneus300323 --------GTCTGATCTAATTTCTAAAACAAATTGATATTT-----TAGC S_araneus300856 -----------------------------------ATAG-----ATCAGA S_tridecemlineatus300236 --------CTTGTATCTCAACCT-AAGAATTGCTGTTTCTT----GTAGC S_tridecemlineatus300279 --------CCTGCACCTCAACCC-AAGAATTGCTGTTTCTC----GTAGC T_nigroviridis300145 ------CATGCACCC---AAACCCAAAGCTC--CCACCTGCGG--T--GG T_belangeri300108 --------TTCTCTCCTCAACCC-AAGAGTCACTGTTGGTC----ATTGC T_belangeri300173 ------------ATCCCATTTCC-AAGAATTACTGTTTCCT----ATAGC T_belangeri300288 --------CTCGCACCTAAACCC-AAGGGCCGCGGTTTGCC----GTAGC T_belangeri300312 --------CTCACACCCCAACCC-AAGAGTCACTGTTGGTT----GTTGC C_familiaris300413 AGCGGTTTAAACA--GAGGTGCTAACAGCAAAGTGGATCT---CGTCGCC C_porcellus300822 GACGGTTTAAACA--GGGGTGCACATAGTA-AGTGGATCT---CGTCGCC D_rerio300206 CTTGCCCTTGCTA--TGTGTGCGCAAAGCAAACGGAACCT---TGTCGCC D_rerio300207 CTTGCCCTTGCTA--TGTGTGCGCAAAGAAAAAGGAACCT---TGTCGCC D_novemcinctus300036 AGTGGCTCAAACA--GCGGTGAGGACAGCA-AGTCAATCT---CGTCACC D_novemcinctus300042 ----------ACA--GCAGTGCGAACAGCA-AGAGAACCT---CGGTGCC D_novemcinctus300071 GGCGGCTCAAGCA--GCGGCGCGGACAGCA-CGCGAGCCT---CGTCGCC D_novemcinctus300229 TGAGAGGCA-------CAGCATAGCCCCCAAAGGTGATGA---GGTTCGC D_novemcinctus300351 TGTGGTTTAAATA--GCGGTGCAAACAGCA-AGGGAATCT---CGTCGCC D_novemcinctus300357 ----------ACA--GTGGTGCTAAGAGGC-GGCGAAGGT---CGTCACC D_novemcinctus300484 TCT-TTAAAATAG--GA-----AAATAG-GTGTGAA-TTT---TGTTGCC D_novemcinctus300571 TGTCCCCAGA-------GGTGCCAATGGCAAGCGA-ATTT---CGTCGCC D_novemcinctus300611 AGCGGCTCAAACA--GCGGTGTGGATAGCA-AGCGAATCT---TGTCGCC D_melanogaster300085 ACCTTTGAACGCGTCTAAGTGCGAGAGAAACCGAAAGACTTGACGTCGCA E_telfairi300209 AGCAGTTTAAAGA--GTGGTGCGCACAGAA-AGTGGGCCT---TGTCGCC E_telfairi300636 AGCTGTTTAAAGA--GTGGTGCGCACAGAA-AGTGGGCCT---TGTCGCC E_caballus300320 AGCGGTTTAAACA--CAGGTGCTAACAGCAA-GCGGATCC---TGTCGCC E_europaeus300014 AGTGGTTCAAACA--CAGGTGCTAACAGCAAAGGGGGCCC---CATCGCT E_europaeus300100 AGTGGCTCAAACA--CAGGTGCTAACAGCAAAGGGTACCT---CGTCGCC E_europaeus300225 AGTGGCTCAAACA--CAGGTGCTAACAGCAAAGGATACCT---CGTCATC E_europaeus300288 CATCATCAAAC-A--CAGGTGCTAACAGCAAAGGGTACCT---CGTTGCC E_europaeus300361 AGTGGTTCAAACA--CAGGTGCTAACAGCAAAGGGTACCT---CGTCACC E_europaeus300538 AAGTGCTGA---A--GGGATGCTAACAGCAAGGGGAACCT---CGCCGCC E_europaeus300641 AGTGGTTCAAACA--CAGGTGCTAACAGCAAAGGGTACCT---C-TCACC F_catus300261 AGCGGTTTAAACA--GAGGTGCTGACAGCAA-GTTGATCT---CGTCGCC H_sapiens300560 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGCGGATCT---TGTCGCC H_sapiens300561 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGTGAATCT---CGTCGCC L_africana300439 GGCGGTTTAAACA--GTGGTGCACACAGCA-AATGGACCT---TGTCGCC M_mulatta300024 AGTGGTTTAAACA--GAGGAACAAACAGGA----AGATCT---TGTCACC M_mulatta300230 GATGGTTTAAATA--GAGCTGCAAACAGCA-AGCGAATCT---CATTATC M_mulatta300266 GATGATTTAAACA--GA--TGCAAACAGCA-AGCACATCT---TGTCACC M_mulatta300539 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGCGGATCT---CGTCGCC M_mulatta300540 GGTGGTTTAAACA--GAGTTATAAACAGCA-AGTGAATCT---CGTCGCC M_murinus300223 GTCAATACTTTCT--TCAAAATGTCTCTTGAAGA--ATCC---CATCACC M_murinus300230 TCTCTTTAAACA---GAGGTGCAAACAGCAAGTGGA-TCT---CATCGCC M_murinus300367 AGTGGTTTAAACA--GAGGTGCCAACAG------------------CACT M_musculus300378 TGCTGTCTTAACA--GTGGTGCACACAGCA-AAGGGGCTT---TGTTGCT M_musculus300413 AGCCA-TTAAACC--GTGGTGTGCACAGCA-AAGGGGCTT---TGCTGCC M_musculus300807 GGCTGTTTAAATA--GTGGTGCACACAGCA-AAGGGGCTT---CGTCGCC M_musculus300869 AGCTGTTTAAATA--GTGGTGCACACAGCA-AAGGGGCTT---TATCGCC O_anatinus304526 AATGATCTATCTT--GGGGTGCT--------------------------- O_anatinus304527 AATGATCTTATCT--GGGGTGCTGACATCAATTGTA-CCT---CGTCGCC O_cuniculus300145 AGTGATTTAAACA--CAGGTGTGCACAGCA-AGTGGATCT---CATCGCC O_cuniculus300377 CACGGCTCCAAGC--G-GGTGCAAACAGCAGCGGGGGCCT---CGTCGCC O_garnettii300174 TGTCTTTAAATAA--GAGGTGCAGATAGCAAGTGGA-TCT---TGTGGCC O_garnettii300301 AGTGATTTAAACA--GATGTGCAGACAAGTG----GATCT---CATCACC O_garnettii300499 AGTTGTTTAAACA--GGGGTGCTAACAGCA-AATTCACTT---GGGGAGC P_troglodytes300020 GATGATTTAAACA--GA--TGCAAACAGCA-AGCACATCT---TGTCACC P_troglodytes300086 AGTGGTTTAAACA--GAGGAACAAACAGGA----AGATCT---TGTCGCC P_troglodytes300603 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGTGGATCT---CGTCGCC P_troglodytes300604 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGTGAATCT---CGTCGCC P_pygmaeus300026 AGTGGTTTAAACA--GAGGAACAAACAGGA----AGATCT---TGTCGCC P_pygmaeus300235 GATGATTTAAACA--GA--TGCAAACAGCA-AGCACATCT---TGTCACC P_pygmaeus300236 GATGATTTAAACA--GA--TGCAAACAGCA-AGCACATCT---TGTCACC P_pygmaeus300437 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGCGAATCT---CATTACT P_pygmaeus300659 GGTGGTTTAAACA--GAGGTGCAAACAGCA-AGTGGATCT---TGTCGCC P_pygmaeus300660 AGTGGTTTAAACA--GAGGTGCAAACAGCA-AGTGAATCT---CGTCGCC R_norvegicus300473 GG-TGTTTAAACA--GTGGTGCACACAGCA-AAGTG-CTT---TGTTGCC R_norvegicus300581 AGGTAATTTAACA--GTGGTGTGCACAACA-AAGGGGCTT---TGTCACC R_norvegicus300997 GGCTGTTTAAACA--GTGGTGCACACAGCA-AAGTG-CTT---CGTCGCC S_araneus300104 CGCAGCTTAA-CA--GCGGTGCCGACAGCA-AGTGCATCT---CGTCGCC S_araneus300220 AACTGCAAAC--A--GAGGTGCTGACAGCAAACAGA-TCT---TATCACA S_araneus300241 AGCGGCTTAGACA--GAAGTTCTGACAGCCA-GCGGCTCT---TGTTGAC S_araneus300263 CTTGGCTTAAACA--GTGGTACCAACAG-A-AACGAATCT---GGTCACC S_araneus300323 CTTGGCTTAAACA--GTGGTACCAACAG-A-AACGAATCT---GGTCACC S_araneus300856 ATGTAATGGGTCA--GTGGTGCCAACAGCAAGTGCA-TCT---CCTTGCC S_tridecemlineatus300236 AGCTGTTTAAACA--GAGCTGCATACAGCAA-GTGGATCT---TGTCACT S_tridecemlineatus300279 AGTGGTTTAAACA--GAGGTGCTCACAGCAA-GTGGATCT---CGTCGCC T_nigroviridis300145 TGCGAGCTTGTCT--GGTGTGCTGACAGAACCTGGGCCCC---TGTCGCC T_belangeri300108 AGCAGTTTAAACA--GAGGTGCAGACAGCA-AGTGGATTT---CGTCACC T_belangeri300173 AGTGGTTTAAACA--GAAGTGCAAACAATT-AAAGAATCT---CATCCTG T_belangeri300288 TGCGACTTAAACA--GGGGTGCGGACAGCA-AGCGGACCT---CGTCGCC T_belangeri300312 AGTGGTTTAAACA--GAGGTGCAGATGGCA-AGCAGGCCT---CCTCGCC C_familiaris300413 TTTGGGGGG----CTGTGGCTGTGCTCCTC--AAAGTGAATTTGGAGG-- C_porcellus300822 TTTGGAGGG----CTGTGGCTGTGCCCACC--AAAGTGAATTTGGAGG-- D_rerio300206 TTTCATGGGCTGTGTGTTGACGTGCCTCTG--GAAGTGAATTCAAGGAGC D_rerio300207 TTTCATGGGCTGTGTGTTGACGTGCCTCTG--AAAGTGAATTCAAGGAGC D_novemcinctus300036 TTTGGGGGG----CTGTGCC-ATGTCCCTC--AGAGTGAATGTGGAGG-- D_novemcinctus300042 TTCAGGG------CTGTGCG-GTGCCCTC-----AGTGAACGTGGAGG-- D_novemcinctus300071 TTTGGGGGG----CTGTGCC-GTGCCCCCC--GGAGTGAATGTGGAGG-- D_novemcinctus300229 TTGATG-------TTAGCACTGCTGTTTGGAGAAACTGCGGTTCTTGGGT D_novemcinctus300351 TTTGGGGTG----TAGTGCA-ATGCCCCTC--AGAATGAAGGTGGAGG-- D_novemcinctus300357 TTTTGGGGC----TTGTGCT-GTGCCCTCC--AGAGTGAACGTGGATG-- D_novemcinctus300484 TTTGG-GGGG---CTGT-ACCGTGCCCCTC--AGAGTGAATGTGGAGG-- D_novemcinctus300571 TTTGG--GGG---CTGTG-CCGCACCCCTT--CCGGTGAATGTGGAGG-- D_novemcinctus300611 TTTGGGGG-----CTGTGCC-ATGCCTCTC--AGAGTGAATATGGAGG-- D_melanogaster300085 TTTGCCATAA--ACCAACTCAACGGAGTGGC-GAATTGAAACTTCGAG-- E_telfairi300209 TTTGAGGGG----CTGTG-CAGTGCCCCTC--AGAGTGAATGTGAAGG-- E_telfairi300636 TTTGAGGGG----CTGCG-CAGTGCCCCTC--AGAGTGAATGTGAAGG-- E_caballus300320 TTTGAGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGA-- E_europaeus300014 TTTGGAGGA----CTGT--CTGCGCCCTTC--AAAGTGAATTTAGAGG-- E_europaeus300100 TTTGGAGGA----CTTG--CTGTGCCCTTC--AAAGTGAACTTAGAGG-- E_europaeus300225 TTTGGAGGA----CTTC--CTGTGCCCTTC--AAAGTGAATTTAGAGG-- E_europaeus300288 TTTGG--AGG---ACTTG-TTGTGCCCATC--AAAGTGAACTTAGAGG-- E_europaeus300361 TTTGGAGGA----CTTG--CTATGCCCTTC--AAAGTGAACTTAGAGG-- E_europaeus300538 TCTGG--AGG---ACTCT-CTGTGCCCTTC--AAAGTGAACTTGGAGG-- E_europaeus300641 TTTGGAGGA----ATTT--CTGTGCCCTTC--AAAGTGAATTTAGAGG-- F_catus300261 TTTGGGGGG----CTGTGGCCGTGCTCCTC--AAAGTGAATTGAGAGG-- H_sapiens300560 TTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG-- H_sapiens300561 TTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGGAAATTTGGAGG-- L_africana300439 TTTGGGGAG----CTGTC-CCATGCCCCCC--AGAGTGAATATGGAGG-- M_mulatta300024 TTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACTTTGGAGG-- M_mulatta300230 TTTG-GTGG----CTGTGGCCATGCTCCTT--AAAGTGAACTTAGAGG-- M_mulatta300266 TTTGCGAGG----CAGTGGCTGTGCCCCTC--ACAGTAAATTTGGAGG-- M_mulatta300539 TTTGGGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG-- M_mulatta300540 TTTGTGGGG----CTGTGGCCATGCCCCTC--AAAGTGAATTTAGAGG-- M_murinus300223 TTTGGG-------GAGCTGTGGCAGGCCCCTCAAAGTGAATTTGGAGGTT M_murinus300230 TTTGG-GAAG---CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGGTT M_murinus300367 TTTGG-GGG----CGGTTGTCATGCCCCTC--CAAGTGAATTTGGAG--- M_musculus300378 TTTGGGGGGGGGGCTGTG-TAGTGCCCCCCC-AGAGTGAATCAGTAGG-- M_musculus300413 TTTGGGAGG----CTGTG-TGGTGCCCGC---AGAGTGGACTGGGTGG-- M_musculus300807 TTTGGGGGG----CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG-- M_musculus300869 TTTGGGGGGG---CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG-- O_anatinus304526 -------------------------------------------------- O_anatinus304527 TTTCAAGAGCTGTTCG---AAGTGCTCCTG--AAAGTGAAATGGAAGGTT O_cuniculus300145 TTT--GGGG----CTGAGGCTGTGCCACTG--GAAGTGAATCTGGAAG-- O_cuniculus300377 TCTGAGGGG----CTGTGG--GTGCCCCCG--GGAATGAATGTGGAGG-- O_garnettii300174 TTTGGAGGGG---CTGTGACTGTGCCCCTC--GAAGTGAATGTGGGGGGG O_garnettii300301 TTTGGAGGG----CTGTGACTATGCCCCTC--AAAGTGAATGTGGAG--- O_garnettii300499 T-----GAG----GTCATG--CCCCTNNNN--NNNNNNNNNNNNNNNN-- P_troglodytes300020 TTTGCGGGA----CTGTGGCTGTGCCCCTC--GCAGAAAATTTGGAGG-- P_troglodytes300086 TTTGAGGGG----CTGTGGTTGGGCCCCTC--AAAGTGACTTTGGAGG-- P_troglodytes300603 TTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG-- P_troglodytes300604 TTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGTAAATTTGGAGG-- P_pygmaeus300026 TTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACCTTGGAGG-- P_pygmaeus300235 TTTGCGGGG----CTGTGGCTGTGCCCCTC--GCAGTAAATTTGGAGG-- P_pygmaeus300236 TTTGCGGGG----CTGTGGCTGTGCCCCTT--GCAGTAAATTTGGAGG-- P_pygmaeus300437 TTTG-GTGG----CTGTGGCTGTGCTCCTT--AAAGTGAACTTAGAGG-- P_pygmaeus300659 TTTGAGGAG----CTGTGTCTGTGCCCCTC--AAAGTGAATTTGGAGG-- P_pygmaeus300660 TTTGCGGGG----CTGTGGCCATGTCCCTC--AAAGTGAATTTGGAGG-- R_norvegicus300473 TTTGGGAGG----CTGGA-CAGTGCCCCCC--AGAGCGAATCAGGAAG-- R_norvegicus300581 TT-GGGGGG----CTGTG-TGGTGCCCCCCCCAGAGTAGACTGGGAGG-- R_norvegicus300997 TTTGGGGGG----CTGTG-CAGTGCCCTCC--AGAGTGAATCAGGAGG-- S_araneus300104 TTTGGGGGG----CTGGG-TGGTGCCCCTC--AGAGTGAATTTGGAGG-- S_araneus300220 TTTGA--GGG---GCTGGGTTGTGCCTCTT--AGAGTGAATTTAGAGG-- S_araneus300241 TTTGGAGAG----CTGTG-CTGTGCCC-TC--ACAGTGAATCTGGAGA-- S_araneus300263 TTTCAGGGG----CTGGG-CAGTGCCCCTC--AGAGTAAATTTGGAGG-- S_araneus300323 TTTCAGGGG----CTGGG-CAGTGCCCCTC--AGAGTAAATTTGGAGG-- S_araneus300856 TTTGG--GGG---GTTGGGCGGTGTCCCTC--TGAGTGAATTTGGGGG-- S_tridecemlineatus300236 TTTGGGAGG----CTATAGTTTTGCCCCTC--AAAGTGAATTTGGAGC-- S_tridecemlineatus300279 TTTGAGAGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG-- T_nigroviridis300145 TTTCTGGGACTCTTC-----TGTGTCTCTG--AAAGTGAATTCAGGGGTC T_belangeri300108 TTTGGGGAG----CTGTCG--GCTCTGGCT--GGAACCCCTGGGCAGC-- T_belangeri300173 CTTAGGGGG----CTGTGGCTGTGCCCCTT--AAAACGAATGTGGAGG-- T_belangeri300288 TTTGGGGAG----CTGTGGCCATGCCCCTC--AAAGTGAATCTGGAGG-- T_belangeri300312 TTTGGGCAG----CCGTGGCCGTGCCTCTC--GAAGTGAATTTGGAGG-- C_familiaris300413 TTCTACACCC- C_porcellus300822 TTCCACACCC- D_rerio300206 CACATCT---- D_rerio300207 CACATCT---- D_novemcinctus300036 TTCTACACCC- D_novemcinctus300042 CTCTTCGTCC- D_novemcinctus300071 TTCGACAGGC- D_novemcinctus300229 TTAGATGTGAG D_novemcinctus300351 TTACACACAC- D_novemcinctus300357 TCCTACACCC- D_novemcinctus300484 TTCTGCAGTC- D_novemcinctus300571 ATCCACACCC- D_novemcinctus300611 TTCTATGCCC- D_melanogaster300085 TTACAAAG--- E_telfairi300209 TTCGACAAGC- E_telfairi300636 TTCGACAAGC- E_caballus300320 TTCTACACCT- E_europaeus300014 TTCTACACAC- E_europaeus300100 TTCTACACAC- E_europaeus300225 TTCTAAACTC- E_europaeus300288 TTCTACACAC- E_europaeus300361 TTCTACACAC- E_europaeus300538 TTCTACACAC- E_europaeus300641 TTCTACATAC- F_catus300261 TTCTACAGCC- H_sapiens300560 TTCCACAACT- H_sapiens300561 CTCTACAGCC- L_africana300439 TTCTACACCC- M_mulatta300024 TTATACACCA- M_mulatta300230 CT-TACCTCCC M_mulatta300266 TTCTACATCC- M_mulatta300539 TTCTACAACT- M_mulatta300540 CTCTACAGCC- M_murinus300223 CTACACCA--- M_murinus300230 CCTCGTGG--- M_murinus300367 GTCA------- M_musculus300378 TTCTACAGTC- M_musculus300413 TTCCATTGTC- M_musculus300807 CTCTACAGAA- M_musculus300869 TTCTACAGTC- O_anatinus304526 ----------- O_anatinus304527 CAACATAT--- O_cuniculus300145 TCTTACACCC- O_cuniculus300377 CCGCACATGC- O_garnettii300174 TCCTACGTCC- O_garnettii300301 TTCTATATCC- O_garnettii300499 ----------- P_troglodytes300020 TTCTACATCC- P_troglodytes300086 TTCTACGCCA- P_troglodytes300603 TTCCACAACT- P_troglodytes300604 CTCTACAGCC- P_pygmaeus300026 TTCTACACCA- P_pygmaeus300235 TTCTACATCC- P_pygmaeus300236 TTCTACATCC- P_pygmaeus300437 CTCTACATCC- P_pygmaeus300659 TTCCACAACT- P_pygmaeus300660 CTCTACAGCC- R_norvegicus300473 TTCTACAGTT- R_norvegicus300581 TTGCATAGTC- R_norvegicus300997 TTCTACAGTT- S_araneus300104 TTCTACACGG- S_araneus300220 TTCTACATTG- S_araneus300241 TTCTACACCC- S_araneus300263 TTCTACAAAG- S_araneus300323 TTCTACAAAG- S_araneus300856 TTCTACACGG- S_tridecemlineatus300236 TTCTACATTC- S_tridecemlineatus300279 TTCTACACTC- T_nigroviridis300145 AACAATG---- T_belangeri300108 TCCTGGGCC-- T_belangeri300173 TTCTTGCCCC- T_belangeri300288 TCCCACACCT- T_belangeri300312 TTCCACAGCC- AC----AATACAAAG----ACA--ATTTAATCTA----GTGTG----- M_murinus300043 GGCT---GGCCGATGAA-CTTACA--AGTATAG-----ATTAT------- M_murinus300308 GACT---GGCTGATGAG-CTCACA--AGGGTAGATAGTGTGCT------- M_murinus300433 CTTGGCCAG----TGAACTTCT-G--AGTGTCGGAA----GTGTG----- M_murinus300434 GACT---GGCCGATGAA-CTCACA--AGTGTAGGTA----GTGTG----- M_murinus300451 GGCT---GGCCAGTGAG-CTCATG--GGTGTAG-TG----GTGCA----- M_domestica300168 TTTGGGCCA---ATGAACTTCT-G--AGTGTCGGAA----GTGTG----- M_domestica300169 TACT---GGCTGATGAA-CTCACA--AGTGTAGGTT----GTGTG----- M_musculus300694 C---T----CTGAGAGAGTG---G--AGGATCGGAA----GTGTG----- M_musculus300898 CTTGGCCAG----TGAACTTCT-G--AGTGTCGGAA----GTGTG----- M_musculus300900 CGCT---GGTCGATGAA-CTCACA--AGTGTAGGTA----GTGTG----- O_anatinus303007 CTCC---GGCCGATGAA-CTACCG--AGTGTAGGTC----GTGTG----- O_anatinus304340 CTCC---GGCCGATGAA-CTACCG--AGTGTAGGTC----GTGTG----- O_anatinus304341 TCCGGGCCT---ATGAACTCCT-G--AGTGTCGGAA----GTGTG----- O_cuniculus300174 TTTT---TTTTTAAAAA----AAG--AGTGTAGATA----GTGTG----- O_cuniculus300209 AATT---GGCTAGTCAACTCA-CA--AGTGTAGGTA----GTGTA----- O_cuniculus300214 GTTT---GGCCAGTGAA-CTCAGA--AGTGTAGGTA----GTATG----- O_cuniculus300229 AACT---CGCC---------------AGTGTAGGGA----GTGTG----- O_cuniculus300378 GATT---GGCC-ATGAA-TTCACA--AGTGTAGGTA----GTGTG----- O_cuniculus300473 TATG---TTTTAATGAA-CTCACA--AGTGTAGGAA----GTATG----- O_garnettii300022 -AAT---GGCCAATGAA-CTCACA--AGTGTAGGTAGTGTGCT------- O_garnettii300024 GATT---GGCCAATGAACTCA-GA--AATGTAGGCA----GTGTG----- O_garnettii300028 --TT---GGCCG-TGAA-CTCACA--AGGGTAGGTGGTGTGCT------- O_garnettii300184 GACT---GGCCGATGAA-CTCACA--AGGGTAGATTGTGAGCT------- O_garnettii300203 GATT---GGCCGGTGAA-CTCACA--AGTATAAGTAGTGTGCT------- O_garnettii300244 GATT---GGCTGGTGAA-CTCACA--AGTGTAGGCAAGTTTTTCACTAAC O_garnettii300284 CTTGGCCAA----TGAACTTCT-G--AGTGTCGGAA----GTACG----- O_garnettii300508 AAAG---GTGCGGTGAA-CTCACA--AGCGTA--------ATGTG----- O_garnettii300525 GAT----GGCTGATGCA-CTCACT--AGTGTAGGTAGTCTGCT------- O_garnettii300568 GAT----GGCTGATGCA-CTCACT--AGTGTAGGTAGTCTGCT------- O_garnettii300741 CTCGGCCAG----TGAACCTCTTG--AGTGTCGGAA----GTGTG----- P_troglodytes300157 GACT---GGCCAATGAA-CTCACA--AGTGTAGACA----GGGTG----- P_troglodytes300478 AACT---GGCTGATAAA-CTTGCA--AGTGTAGGTA----GTATG----- P_troglodytes300518 TTTA---AAAGGTATAAGCTCACA--AGTGTAGGTA----GTGTG----- P_troglodytes300621 CTTGGCTTA----TGAACTTCT-G--AGTGTCGGAA----GTGTG----- P_troglodytes300622 GACT---GGCCGATGAA-CTCGCA--AGTGTAGGTA----GTGTG----- P_pygmaeus300104 GACT---GGCTGATGAAATCA-CA--AGCGTAGGTA----GTATG----- P_pygmaeus300258 GACT---GGCCAATGAA-CTCACA--AGTGTAGACA----GGGTG----- P_pygmaeus300550 AACT---GGCTGATAAA-CTTGCA--AGTGTAGGTA----GTATG----- P_pygmaeus300600 TTAA---AAAGGTATAAGCTCACA--AGTGTAGGTA----GTGTG----- P_pygmaeus300725 GACT---GGCCGATGAA-CTCGCA--AGTGTAG-TA----GTGTG----- P_pygmaeus300726 CGTGGCTCA----TGAACT-CT-G--AGTGTCGGAA----GTGTG----- R_norvegicus300435 GA-C---ACTCCGTGAC-CTCCTA--AGGATAGGTA----GTGTG----- R_norvegicus300501 CTTGGCCAG----TGAACTTCT-G--CATGTCAGAA----GTGTG----- R_norvegicus300781 CATAT----CCAGTGAACTTCT-G--AGTGTCGGAA----GTGTG----- R_norvegicus300825 CTTGGCCAG----TGAACTTCT-G--AATGTCGGAA----GTATG----- R_norvegicus300878 TTTGGCCAG----TGAACTTCT-G--AGTGTCGGAA----GTGTG----- R_norvegicus300880 CGCT---GGTCGATGAA-CTCCTA--AGTGTAGGTA----GTGTG----- R_norvegicus300955 CACCTTGG-CCAGTGAACTTCT-G--AGTGTTGGAA----GTGTG----- S_araneus300062 --AA---GAGAATTAAA-CTCTCA--GGTATAGATA----GTGAG----- S_araneus300156 GGCT---GGTCCATAAA-CTCTCA--AGTGTAGGGA----GTGTG----- S_araneus300442 GGCT---TGTTGATGCA-CTCTCA--AGTGTAGGTA----GTGTG----- S_araneus300705 TCAG---CAGTTAG---------A--AGAGTAGGTA----GCGTC----- S_araneus300954 GGCT---GGTTAACGAA-CTCTCA--AGTGTAGGTG----GTATG----- S_araneus300996 GAGT---GGCCGGTGAA-CTCTCA--GGTGTAGGTA----GTGTG----- S_tridecemlineatus300006 AACT---AG-------G-CTCACA--AATGTAGGTA----CAGTG----- S_tridecemlineatus300139 AAAC---ATAAAATGTA-CTTGCA--AGTATAGGTA----GTATG----- S_tridecemlineatus300213 TG---------AACTTG-TTCACA--AGTGTAGGTA----ACATG----- S_tridecemlineatus300229 ATTCTTGGTACATTAAAAAAAT----AGGGTTGGAA----ATGTG----- S_tridecemlineatus300308 AACT---GGCTGATGAA-CTCGCA--AGTGTAGGTA----GTGTG----- T_belangeri300001 GACT---GGCTGATGAG-CTCTCA--AGTGTAGGTA----GAGTG----- T_belangeri300053 TTAT---TTTTATTCTT-TCCTTA--AGTGTAGGTA----GTGTG----- T_belangeri300105 GACTT--GGCCGATGAA-CTCTCAA-AGTGTTGGTA----GTATG----- T_belangeri300112 GACT---GGCAGATGAA-TGCTCA--AATGTAGGTA----GTATG----- T_belangeri300230 GCCT---GGCCAATGAA-CTCTCA--AGTGTAGGTA----GTGTG----- T_belangeri300327 CTTGG-----------ACTCCT-G--GGTGTCGGAA----GTGTG----- T_belangeri300333 GACT---GGCTAATGAACTCTCAA---GTACAGGTA----GTGTG----- T_belangeri300358 CTTGGCCAG----TGAACTCCT-G--GGTGTCGGAA----GTGTG----- T_belangeri300359 GCCT---GGCCGATGAA-CTCTCA--AGTGTAGGTA----GTGTG----- X_tropicalis300082 TC-----GGCCAATGAA-CTCT-G--AGTGTAGGAT----GTGTG----- X_tropicalis300083 -GCT---GGCTAATGAA-CTCTTG--AGTGTCGGAA----GTGTG----- C_familiaris300002 --CTACCTGAGC------G-------------------------ACAATG C_familiaris300003 --CCACAGG-AGG-----GGCAAG---TCT--TCCGCTAACATCACAAGA C_familiaris300024 --CTACAGGAGGG------GCAAG---TCT--ACTCCTAACA---CACGA C_familiaris300034 --CTACATGAGAG------GCAAG---TTT--TTTGCTAACACCACAAGG C_familiaris300039 --CTATGACA-GG-----GGCAAG---TCT--TACACTAACACCTCAAGG C_familiaris300049 --CTACATGAGGG------GCAAG--TCTT--TTCGCTAACACCACAAGG C_familiaris300057 --CT-CATGAGGG------ACAAGT-CT----TGCACTAAAACCACAAGG C_familiaris300062 --CTACATGAGGG------GCAAGT-CTTT---TCGCTAACACCACAAGG C_familiaris300081 --CTACGTGAGGG------TTAAGT-CC----TTTGCTAACACCATAAAG C_familiaris300123 --ATACATGACAG------GCAAGT-C-----TTTGCTAATACCACAAGG C_familiaris300140 --CTACATGAGGG------GCGAAT-CTTTCTTTCACTAACACCACAAGG C_familiaris300170 --CCACTTGAGGG------GCAAGT-CT----TTCCTTAA--CCACAAAG C_familiaris300172 --CTACATGAGGG------GCAAG---TTT--TTCACTAACAAAAGCAGC C_familiaris300277 --CTACATGA-GG-----GGCAAA---TCT--TTCACTAACACCACAAGG C_familiaris300280 --CTACACG-AGT-----GGCAAG---TCT--TTC-AAATCACCAT--GG C_familiaris300281 --CTACCTGAGGG------GCAGGT-CTTC---T-GTTAACATGACAAGG C_familiaris300290 --CTACGTGA-GG-----GGCAGG---TCT--TTCATTAACACCACAAGG C_familiaris300293 --CTACATGAGGG------GCAAG---TCT--TTTGCCAACATCACAAGG C_familiaris300294 --TTACATGAGGG------GCAAGT-CT----GG--CTAACACCACAAGG C_familiaris300357 --CTACTAGAGGG------GCAAGT-CT----TTCAGTAACACCACAGGG C_familiaris300374 --C-ACACGAGGG------CCACGT-TTTC---T-GCTAACACCACAAGT C_familiaris300407 --CTACATGAGGG------GCAGG--TCTT--TT-GCTAACACCACAAGG C_familiaris300412 --CTATACGAGAG------GCAAG--TCTT--TT-ATTAACACCACAAAG C_familiaris300425 --CTATATAAAC------AGCAGGG--TTT---TCGCTAACACCAGTAGA C_familiaris300426 --CTACATGAGGG------GCAAGT-CTTT---TCGCTAACACCACAAGG C_familiaris300427 --CTACATGAGAG------ACAAGA-CT----T----TAATACCACAGGA C_familiaris300441 --GAGCTACACAA------GGGGC---ATG--TCTTCTGCTAACACCACA C_familiaris300454 --CTATATGAGTG------GCACG---CCT--TTCACTAACA---CAAGA C_porcellus300672 ----ACAAAAGGC------CAGTTT-AAGC----CTCTAACACCCCAAGG C_porcellus300900 --CTACATTAAT------GGCAGGA--TTC---TCGCTAACACCAGTAGA C_porcellus300901 --CTACACGAGG------GGCAAGG-----TTTTCGCTAACACTCCATTC D_rerio300116 --CTAAATAAAC----ATGGCTAGGTATTC-----GCTAACACCAGTAGG D_rerio300205 --CTAAAACACTG-------CAGGG--------TCTCTGATCTCTTC--- D_rerio300216 --CTATAGTAAC----TCGGCCGGGATTTC-----GCTAACACCATGAGG D_rerio300217 --CTAGAGTGAT----TCAGCCGGGATTTC-----GCTAACACCAGTAGG D_novemcinctus300008 --CTACATGATG------GGCAAGT-----TTTTCACTAACACCACAAGG D_novemcinctus300041 --CTACATGATG------GACAAGT-----TTTTCACTAATACCACAAGG D_novemcinctus300374 --CTAGATCAA------TGGCAGGA--TTT---TCGCTGATGCCAGTAGA D_novemcinctus300384 --CTACATGTGG------GCAACT------TTTTCCTTAACACCACAAGG D_novemcinctus300448 --CTACATGA-TG-----GGCAAG---CTT--TTCAGTAACACCGCAAGG D_novemcinctus300479 --CTCTATCAAT------GGCAGGA--TTT---TCGCTGACGCCAGCAGA D_novemcinctus300590 --CTACATCAAC------GGCAGGA--TTT---TCGCTGACGCCAGTAGA D_novemcinctus300591 --CTACACGATG------GGCAAGT-----TTTT-GCTAACACCACAAGG E_telfairi300150 --CTACATGATGG------GCAAGA-TTTT---T-GCTAACACCGCAAGG E_telfairi300220 --CTACATTAAC-----AGGCAGGA--TTT---TTGCTAACACCAGTAGA E_telfairi300507 --CTACTTGATAT------GAAAG---GTT--TTCACTAACACCACAAGG E_telfairi300674 ----ACATGATAG------GCAAGG-TTTT----CGCTAACACCACAAGG E_telfairi300675 --CTACATTAACA-----GGCAGGA--TTT---TCGCTAGCACCAGGAGA E_telfairi300796 --CTACATGATGG------GCAAA---GTT--TTTGCTTACACCACACGG E_caballus300104 --CTACATGAGG------GGCTG-------------------------GG E_caballus300371 --CTACATGAGGG------GCAAGT-TTTT---C-GCTAACACCACAAGG E_caballus300372 --CTATATTAAG------GGCAGGA--TTT---TCGCTAACACCAGTAGA E_europaeus300016 --TTAGATGAACT------GCAGTA--ATT---T-GCTAGCACCAGTAGA E_europaeus300134 --CTACAGCAAC------GGCAGGG--T-T---TCGCTAACACCAGGAGA E_europaeus300238 --CTATACTAACT------GCAGGA--TTT---C-GCCAACACCAATAGA E_europaeus300267 --CTACATG-AGG-----GCCAAG---TTT--TTCGCTAACACCATGAGG E_europaeus300358 ----ACACCAGG---------GGCA-AGGT----CTTGG-----CTAACA E_europaeus300649 --CTACACGAGGG------GCAAGT-TTTT----CGCTAACACCACGAGG E_europaeus300697 --CTGCATG-AGG-----GGCAAG---TTT--TTCACCAACACCACGATG E_europaeus300707 --TACTACACAGA-----GACAAG---TTT--TTCACTAATACCACAGGG F_catus300009 --CTACATAAGGG------TCAAG--TCTT--TT-CCTAACACCATGAGG F_catus300010 --CCACATGAGGG------GCAAGT-CT----TTCGCTACCACCACAAGG F_catus300016 --CTACATGAGGG------ACATGT-CT----TTCAGTAACATCACAGGG F_catus300019 --CTAAGTGAGGGAG--GGGCAAG---TCT--TGCACTAACACCATAAAG F_catus300043 --CTGCCTGAGGG------GCACG--TCTT--CT-GCTACCACCACACGG F_catus300055 --GTGTATGCGGT-----GTGCAA---GTC--TTTTGTAATACCACAAGG F_catus300059 --CTACATTGGGG------GCAAGT-CT----TTTACTAACCCCACAAGG F_catus300071 --CTACATGATGG------GCAAG---GCT--TTTGGTAACACCACAAGG F_catus300077 --CTCCATGAGGG------GCAAG---TCT--TTCACTGACAACACTAGG F_catus300107 --CTACATGAGG------G-------------------------ACAACA F_catus300108 --CTATTAGGCAG-----GACAAG---TCT--ATCACTAACACCACGAGG F_catus300110 --CTATAAGAGGG------TCAAGT-CT----TCCGCTAACACCGCAAGG F_catus300113 --CTACATTAGGG------GCAAG---TCT--TTCGCTAACACCACAAGG F_catus300145 --CTACATGAGGG------GTGGG--TCTG--CG-GCTAAGACCATACGA F_catus300153 --TTACATGAGGG------GCATGT-CC----TGTGCTAACACCATAAGT F_catus300164 --CTATGTGAGGG------GCAAGT-CT----------AACACCACAAGG F_catus300201 --CTGCGTGAGGG-------CAAGT-CTT------GCCAACACCACAAGG F_catus300206 --CTACATG-AGG-----GGCAAG---TCT--TTC-CTAACACCACAAGG F_catus300207 --CTACATG-AGG-----GGCAAG---TCT--TTC-CTAACACCACAAGG F_catus300210 --CTACGTGATGG-----GG-GAG---TCA--TTCGCTAACACCACAAGG F_catus300211 --CTACACGAGGG------TCAAGT-CTTT---C-GCTAACACCGCAAGG F_catus300234 --CTAGATAAAT------TGCAGGA--TTT---TCGCTAACACCAGTAGA F_catus300328 --TTACATGAAGG------GCAAAT-CTTT---T-GCTAACACCACAAGG G_gallus300060 --CTACAGTAACA----TGGCAGGACTT-------ACTGACAGCCTGAGG G_gallus300061 --CTACAACAAAGCTGTTGGCAGGGTGCTT-----GCTAATGCCAGGAGA H_sapiens300604 --CTACATGAGGG------GCAAGT-TTT-----CGCTAACACCACAAGG H_sapiens300658 --CTACATG-AGG-----GGCAAG---TTT--TTCACTAATATTACAAGG L_africana300404 --CTATATCAAT------GGCAGGG--TGT---TCGCTAACACCAGTAGA M_mulatta300058 --CTATGTG-AGG-----GGCAAG---TTT--TTCACTAACATCACAAGG M_mulatta300067 --CTACATGAGAA------GCAAG--TTTT--TC-GCTAGCACCACAAAG M_mulatta300132 --CTATGTGAGG------GGCAAAT-----TTTTCACTAACACGACAAAG M_mulatta300604 --CTACATGAGGG------GCAAGT-TTTT----CGCTAACACCACAAGG M_mulatta300605 --CTACATTAAT------GGCAGGA--TTT---TCGCTAACACCAGTAGA M_mulatta300640 --CTACGCAAGGG------ACAAA---TTA--TTCACTAACACCACAAGA M_murinus300003 --TTACATG-AGA-----GGCAAG---TTT--TTTGCCAATATCATGAGG M_murinus300043 ----GTGCAGGGG------CAAGTT-TT-T----CGCTAACATTGTAAGT M_murinus300308 ----ACATGAGCC------TCAATG-TTTT----TGCTAACACCATAAGG M_murinus300433 --CTACATTAAA------GGCAGGA--CAT---TCGCTAACACCAGTAGA M_murinus300434 --CTACACGAGGG------GCAAGT-TTTT----CGCTAACACCACAAGG M_murinus300451 --CTGTGCGAGGG------GCAGG--TCTT--TC-GCTAGCAC-ACAGGG M_domestica300168 --CTACAGTATGTTG---GGCAGGA--TTT---TCGCTAACACCAGTAGA M_domestica300169 --CTATATTAATG------GCAGGT--TTT---TCGCTAACACCACAAGG M_musculus300694 --CTACATTGAATTT-ATGGCAGGA--TTT---TCGCTAACACCAGTAGA M_musculus300898 --CTACATTGAATTT-ATGGCAGGA--TTT---TCGCTAACACCAGTAGA M_musculus300900 --CTAAAAGAGTG------GCAAGG--TTT---TCGCTAACACCCCA--- O_anatinus303007 --CCACAGCGAAGGA--CGGCGGGT--TTT--TTCGCTAACGCCACGAGG O_anatinus304340 --CCACAGCGAAGGA--CGGCGGGT--TTT--TTCGCTAACGCCACGAGG O_anatinus304341 --CCACAGTAAAGCG---GGCAGGA--TTT---TCGCTAACACCAGGAGA O_cuniculus300174 --CTACATGAGAA-----GAAAGT---TTT--TCTGCTAACACCACAAGG O_cuniculus300209 --CTACATGAGAG------GCAAA--TTTC--TT-GCTAACACAACAAGG O_cuniculus300214 --GGGCTGGCGAT------GTGGT---ATG--GCAGGTAAATCCACCACC O_cuniculus300229 --CTAAT-AAGG------AGCAAGC-----TTTT-GCCAACCCCACAGAG O_cuniculus300378 --CCACATGAGA------GGCAAGT-----TTTTCACTAACACCACAAGG O_cuniculus300473 --CTGCATG-AGA-----GGCAAG---TTT--TTCGCTAACACCA---GG O_garnettii300022 ----ACATGAGAG------GCAAGT-TTTT----CGCTAACACCACAAGG O_garnettii300024 --TAATATGAGAG------GCAAG--TTTT--TCCGCTAACACCACAAGA O_garnettii300028 ----ACATG---------------------------CTAACCCCACAAGG O_garnettii300184 ----ATGTGAGTG------GCAAAT-TTTT----CGCTAACATCACAAGG O_garnettii300203 ----ATGTGACAG------GCAAGT-TTTT----CACTAACACCACA-GG O_garnettii300244 TTGAAAGTGAGAG------GCAAGT-TTTT----CACTAACAGCACAAGG O_garnettii300284 --CTACCTTAAA------GGCAGGA--TTT---TCACTAACACCAGTAGA O_garnettii300508 --CTACATGAGAG------GCAAG---TTT--TTCGCTAGCAGCACAAGG O_garnettii300525 ----GCATGAGAG------GCAAGT-TTTC----C-CTAATATCACAAGG O_garnettii300568 ----GCATGAGAG------GCAAGT-TTTC----C-CTAATATCACAAGG O_garnettii300741 --CTACATTAAA------GGCAGGA--TTT---TCGCTAACACCAGTAGA P_troglodytes300157 --TTACGTAAGGG------ACAAG---TTT--TTCACTAACACCACAAGA P_troglodytes300478 --CTACGTGAGG------GGCAAAT-----TTTTCAGTAACATGACAAAG P_troglodytes300518 --CAACATG-AGG-----GGCAAG---TTT--TTCACTAATATTACAAGG P_troglodytes300621 --CTATATCAAT------GGCAGGA--TTT---TCGCTAACACCAGTAGA P_troglodytes300622 --CTACATGAGGG------GCAAGT-TTTT----CGCTAACACCACAAGG P_pygmaeus300104 --CTACATGAGGG------GCAAG--TTTT--TT-GCTAACACCACAAAG P_pygmaeus300258 --CTACGCAAGGG------ACAAG---TTT--TTCACTAACACCACAAGC P_pygmaeus300550 --CTATGTGAGG------GGCAAAT-----TTTTCAGTAACATGACAAAG P_pygmaeus300600 --CTACATG-AGG-----GGCAAG---TTT--TTCACCAATATTACAAGG P_pygmaeus300725 --CTACATGAAGG-------CAAGT-TTT-----CGCTA-CACCACA-GG P_pygmaeus300726 --CTACATCAAT------GGCAGGA--TTT---TCGCTAACACCAGTAGA R_norvegicus300435 --CTAAACGAGCG------GCAAG---GTT--TTTACTAACATCCCA--- R_norvegicus300501 --CTACATTGAACCT-ATGGCAGGA--TTT---TCGCTAACACTAGTAGA R_norvegicus300781 --CTACGTTGAACCT-ATGGCAGGA--TTT---TCGCTAACACCAGTAGA R_norvegicus300825 --CTACATTGACCCT-ACGGCAGGA--TTT---TCGCTAACACCAGTAGA R_norvegicus300878 --CTACATTGAACAT-ACGGCAGGA--TTT---TCGCTAACACCAGTAGA R_norvegicus300880 --CTAAACGAGCG------GCAAGG--TTT---TCGCTAACACCCCA--- R_norvegicus300955 --CTACATTGAAACT-AAAGCAGGA--TTT----CGCTAACACCAGTAGA S_araneus300062 --CTATACA-AGG-----GACAAGG-TTTT--TT-GCTAACAGCAC-AAG S_araneus300156 --CTACACAAGAG------GCAAA---TAT--TTTATTAACACCAAAAGG S_araneus300442 --CTAAATGGGGT-----GGCAAGT-----TTTTCACTAATACCACAGGG S_araneus300705 --CTGCAGG-AAG-----GGCAAG---TTT--TTCGAAAACACCATAAGG S_araneus300954 --CTACATGAAGG------TCAAG---TTT--TTCGATAACATCACAGGG S_araneus300996 --CTACACGAGGG------GCAAGT-CTTT----CGCTAGCACCACGAGG S_tridecemlineatus300006 --CTACATGAAGA-----GTCAA-------TTTTTGCTGAT----TAAGG S_tridecemlineatus300139 --CTACATGAGGG------GTA-----TTT--TTTGCTAATACTCCA--- S_tridecemlineatus300213 --CTACATGAGGG------GCAAG---TTT--TTTGCTAACA----CTCC S_tridecemlineatus300229 --CTAAACTCA------TAGCAGTA--TTT---TCACTAATACCACTAGA S_tridecemlineatus300308 --CTACATGAGG------GGCAAGT-----TTTTCGCTAACACTCCA--- T_belangeri300001 --CTACATGAGG------AGTGGAGCAAGATTTTTGCTACCACCACAAGG T_belangeri300053 --CTACATG-AGG-----GGCAAGA-TTTT--TTTGCTAATACCAC-AAG T_belangeri300105 --CTACACGATG------AGTAACT-----TTTTCACTAA---CACAAGG T_belangeri300112 --CTACCCAAGG------GACAAGT-----TTTTCACCAACACCACAAAG T_belangeri300230 --CTACACGAGGG------GCAAGT-TTTT----CACTAACACCACAAGG T_belangeri300327 --CTACATCAAT------GGCAGGA--TGT---TCGCTAACACCAGTAGG T_belangeri300333 --TTATACGA-GG-----GGCAAG---TTT--TTCACTAATATCACAAGG T_belangeri300358 --CTACATTAAT------GGCAGGA--TGT---TCGCTAACACCAGTAGG T_belangeri300359 --CTACACGAGGG------GCAAGT-TTTT----CGCTAACACCACAAGG X_tropicalis300082 --CTACAGTAACA----TGGCAGACTTTTC-----GCTAATGCCACAAGG X_tropicalis300083 --CCATAGCATTATT-GTGGCAAGA--TTT---TCGCTAACACCGTCAGA C_familiaris300002 GTCTCTG--GCTCAG-TGAATGCA-GTTGGA--TAGTAATCCTAGTGATA C_familiaris300003 -TCACTG--GCCCAA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACT C_familiaris300024 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TAGT-----TTGAAAAA C_familiaris300034 GTCTCT---GGTCCAATGAGTAG--AGTTAA--TGGCAAGTCTTGCTACA C_familiaris300039 GTGTCTG--GTTCAA-TGACCAG-AGTTTGA--TAGTAACTTTTGCTACA C_familiaris300049 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA C_familiaris300057 GTCTCTA--GCCCAA-TGAGTGG-AGTTTGA--TAACAATTCTTGCTACA C_familiaris300062 GTCTCTG--GCCCAAT-GAGTGG-AGTTTGA--TAGTAATTCTTGCTACA C_familiaris300081 GTCTCTG--GCTCAA-TGAGTGG-AGTTTGA--TGGTAATTCTTGCTACA C_familiaris300123 GTCTC-A--GTCCAA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA C_familiaris300140 GTCTCTG--GCTCGA-TGAGTGG-AGTTAGA--TAGTAATTCTCATTATA C_familiaris300170 GTCTCTG--GCCGAG-TGAT--G-AGTTTGA--TAGTGATTCTTGCTATA C_familiaris300172 ATCTCTA--GCCCAA-TGAGTGG-ACTCTGA--TAGTAATTCTTGCTTCA C_familiaris300277 GTCTCTG--GCCCAAATGAATAC-AATTTGA--TAGTAATTCTTGCTACA C_familiaris300280 GTCTCTG--GCCTGA-TAAGTAG-AGTTTGA--CAGTAGTACTTGCTACA C_familiaris300281 GGCTCTG--ACCCAATCAAGTAG-ACTTTGA--TAGTAATTCTCACTATA C_familiaris300290 GTCTCTG--GCCTAAATGAGTGA-AGTTTGG--TAGTAATTTTTGCTACA C_familiaris300293 GTCTCTG--GTTCAA-TGAGTGG-TGTTTGA--CACTAATTCTTGCTATA C_familiaris300294 GTCTCTG--GCCCAG-TGAATG--AGTTTGA--TAGTAATTCTTGCTGCA C_familiaris300357 GTCTCTG--ATCCAA-TGAGTAG-AGTTTGA--TTGTAATTCTTGCTACA C_familiaris300374 GTCTCTG--GGCCAAC-GAGTGG-AGTGTAA--TAGTAATTTTTTTTTTA C_familiaris300407 -TCTTTG--GCCCAA-CAAGTGG-AGTTTGA--TAGTAATTCTTGCTGCA C_familiaris300412 ATCTCTG--GCCCAA-TGAGTGG-AATTCGA--GAGTAAATCTTGCTGCA C_familiaris300425 G--CTTG---TCTCTATGACTGG-AGTTTGA--TAGTACTCACTGCTACA C_familiaris300426 GTCTCTG--GCCCAAT-GAGTGG-AGTTTGA--TAGTAATTCTTGCTACA C_familiaris300427 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TGGTAATTCTTGCTACA C_familiaris300441 AGGGGC---ATGTCTTCTGCTAA--TACATG--TCTCTGGC--------- C_familiaris300454 ATCTCTG--ATCCAA-TGAGTGG-AGTTTGA--TAGTAGTTCTTGCTACA C_porcellus300672 GTCTTTG--GGCCAA-TGACAAGAA-TGTGA--TATTAATCCTTGCTACA C_porcellus300900 G--TCCA---CCTCTGTGACTGG-AGTTTGCTCTGGTACTCACTGCCACA C_porcellus300901 CA-------GCCCCG-TGGGTGGA-GCTTGA--TAGTAGTCCTTGCTACA D_rerio300116 GCTGAAGT-GCCTCA-TGACTGG-AGTTTGA--TAGCAACCTTTGCTACA D_rerio300205 -TTTCTG--TTCTTCATGAGAGC---TGAGAAAATGAAGATCCTGCCACA D_rerio300216 GCTTT----GCCCCA-TGACTGG-GGTTTGA--TAGTAACCTGAGCCACA D_rerio300217 GCTGTTAC-GCCCCT-TGACTGG-AGTTTGA--TAGCAACCTGAGCTACA D_novemcinctus300008 GTCTCTG--ATCCAA-TGAGTAGA-GTTTGA--TAGTAATCCTTGCCACA D_novemcinctus300041 GTCTCTG--ACCCAA-TGAGTGGAAGGTTGA--TAGTAGTCCTTGTTACA D_novemcinctus300374 G--CTTG---CCTCCATGACTGG-AGTTGGG--TAGTACTCACTGTCACA D_novemcinctus300384 GTCTCTG--ACCCAG-TGAGTGGA-ATTTGA--TAGTGATCCTTGCTGCA D_novemcinctus300448 GTCTCTG--ACACAA-TGAGTAG-AGTTTGA--TAGTAATCCTTGCCACG D_novemcinctus300479 G--CTTG---CCTCTATGACTGG-AGTTTGA--TAGTACTCGCTGCCACC D_novemcinctus300590 G--CTTG---CCTCCATGACTGG-AGTTTGA--TAGTACTCGCTGCCACA D_novemcinctus300591 GTCTCTG--GCCCAA-TGAGTGGA-GTTTGA--CAGTAATCCTTGCCACA E_telfairi300150 GTCTCTG--ACCCAAT-GAGTAG-AGTGTGA--TAATAATCCTTGCTACA E_telfairi300220 G--CTTG---CCTTGATGACTGG-AGTTTGA--TAATACTCAGTGCCACA E_telfairi300507 GTCTCT---GACCCAATGAGTGG--AGTATG--ATGCGCGTGCGCACACA E_telfairi300674 GTCTCTG--GCCCAA-TGAGTGGAG-TTTGA--TAGTAATCCTTGCTACA E_telfairi300675 G--CTTG---CCTCGATGACTGG-AGTTTGA--TAGTACTCTCTGCCACA E_telfairi300796 GTGGTTA--GTCCAATGGGGTGG-AATTTGA--TCATAATCTTTTCTATG E_caballus300104 GTCTCTG--GCCTGG-TGAGTGGA-GTTTGC--TAGTAATACTTGCTACA E_caballus300371 GTCTCTG--GCCCAAT-GAGTGG-AGTTTGA--TAGTAATTCTTGCTACA E_caballus300372 G--CTTG---CCTCTATGACTGG-AGTTTGA--TAGTACTTGCTGCCACA E_europaeus300016 G--CTTG---TCTCTATGACTAG-AGTTTGA--TAGTA-CCACTCCCACA E_europaeus300134 G--CTCG---GCTCTATGACTGG-AGTTTGC--TAGTGCTCTCTGCCACA E_europaeus300238 G--TTTG---CCTCTATGATTAG-AATCTGG--TGTAC-TCACTGCTATA E_europaeus300267 GTCTCTG--GCCGAA-TGAGTGG-AGTTGGA--TAGTAATTCTTGCTACA E_europaeus300358 CTGTATG--TTTCAA-TGAATTGAG-TTTGA--TAATACTCCTTGCTACA E_europaeus300649 GTCTCTG--GCCCAA-TGAGTGG-AGTTGGA--TAGTAATTCTTGCTACA E_europaeus300697 GTCTCTG--GCCCAA-TGAGTGG-AGTTGGA--TAGTAATTCTTGCTA-C E_europaeus300707 ATCTCTG--GTCCAA-TGAGTGG-AGTTTGA--TAGTAATTCTGACTA-C F_catus300009 GTCTCTG--GTCCAG-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA F_catus300010 GTCCGTG--GCCCAG-TGAATGG-AGTTTGA--TAGTAATTCTTGCTACA F_catus300016 GACTCTG--GTCCAA-TGGGTGG-AGTTTGA--TA---GTTCTTGCTACG F_catus300019 GCCTGTG--ACCCAA-TGAGTTG-AGTTTGA--CAGT---TCTTGCTACA F_catus300043 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--CAGTAATTCTGGCTACA F_catus300055 GTCTCTG--GCCCAA-TGAGTGG-AGTGTGT--TAGTAATTCTTGCTATA F_catus300059 GCTTCTG--GCCCAA-CGAGTGG-AGTTTGA--TAGTAATTCTTGGCATA F_catus300071 GTCTCTG--GCCCAA-TGAATTG-AGATTGA--TAGTAATTCTTGCTACA F_catus300077 GTCTCTG--AACCAA-TGAGTGG-AATTTGA--TAGTAATCCCTGTTATA F_catus300107 GTCTCTG--GCTCAG-TGAATGGA-GTTTGA--TTGTAACCCTTGTGACA F_catus300108 TTCTCTG--GCCCCAATGAGTGG-AGTTTGA--CAGTAATTTTTGCTACA F_catus300110 GTCTCTG--GCCCAG-TAAGTAG-AGTTTGA--TAGTAATTCTTGCTACA F_catus300113 GTCCC-G--GCTTAA-CGACTGG-AGTTTGA--TAGTAATTCTTGCTGCA F_catus300145 GTCTCTG--GTCCAA-TGAATGG-AGTTTGA--TAGTAACTCTTGCTAAA F_catus300153 GTCTCTG--GTCCAA-TGAGTGG-AGTTTGA--TAGTAATTATTGCTACA F_catus300164 GTCTCTG--GCCCAG-TGAGTGG-AGTTTGA--TAGTAATTCTTACTACA F_catus300201 GTCTCTA--GCCCAGT-GAGTAG-ACTTTGG--TAGTAATTCCTGTTGCA F_catus300206 GTCTCTG--TCCCAA-TTAATGG-AGTTTGA--TAGTAATTCTGGCTACG F_catus300207 GTCTCTG--TCCCAA-TTAATGG-AGTTTGA--TAGTAATTCTGGCTACG F_catus300210 GTCTCTG--GCCCCA-TGGGTGG-GGTTTGA--GAGTAGTTCTTGCCACA F_catus300211 GTCTCTG--GCCCAAC-GAGTGG-AGTTTGG--TAGTAATTCTTGCTACA F_catus300234 G--CCTG---CCTCTGTGACTGG-AGATTGA--TAGTACTCGCTGCCACA F_catus300328 CTCTCTG--GCCCAAT-GAGTGG-AGTTTGA--TAGTAATTCTTTCTACA G_gallus300060 GCCTTTGTGGC-CCAATGAAAGG-AGTTTGG--TAGTCAATCTTGCCACA G_gallus300061 GGAGCTG--CCTCTA-TGATTGG-AGTTTGA--TAGCAGCCCT-GCCACA H_sapiens300604 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA H_sapiens300658 GTCTCTG--ATCCAG-TGAGTGG-AGTTTGA--TAGTAATTTTTGATACA L_africana300404 G--CTCG---CCTCTGTGACTGG-AGTTTGA--TAGTACTCGCTGCCACA M_mulatta300058 GGCTCTG--ATCCAG-TGAGTGG-AGTTTGA--TAGTA---TTTGATACA M_mulatta300067 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--CAGTAGTTCTTGTCACA M_mulatta300132 GTCTTTG--GCCTAG-TGAGCAGA-GTTTGA--CAATAATCCTTGCTACA M_mulatta300604 GTCTTTG--GCCCAA-TGAGTGG-AATTTGA--TAGTAATTCTTGCTACA M_mulatta300605 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTACTCGCTGCCACA M_mulatta300640 GTCTCTG--ACCCAA-TGAATGG-AGTTTAA--TAGAAATTCTTGCTACA M_murinus300003 GTCTCTG--GCCCAA-TGAATAG-AGTTTGA--TAGTAATCCTTGCTATC M_murinus300043 GTCTCTG--G-CCAA-TGAGTGGAG-TTTGA--CAGTAATCCTTGTTACA M_murinus300308 GTTTCTG--GCGCAA-TGAGTGGAC-TTTGA--CAGTAATCCTTGCTACA M_murinus300433 G--CTTG---CCTCTATGACTGG-AGTTTGA--TAGTACTCTCTGCCACA M_murinus300434 GTCTCTG---CCCGA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA M_murinus300451 GTCTCTG--GCCCAG-TGAGTGG-AGTTCGA--CAGTCATGCTTGCTACA M_domestica300168 G--CTTG---TCTCTGTGACTGG-AGTTTGA--TAGTAGTCACTGCCACA M_domestica300169 GCCTTTGTGGTCCAA-TGAGTGG-AGTTTGA--TAGTATTCCATGCAACA M_musculus300694 G--CTTG---CCT--GTGACTGA-AGTTTGG--TAGTGGTCACTGCCACA M_musculus300898 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTGGTCACTGCCACA M_musculus300900 --CTCTG--GTCCAG-TGAGTGG-GGTTTGA--TAGTAACCTTTGCTACA O_anatinus303007 CCCTCGGTGGGCCGA-CGAGTGG-AGTTTGA--TAGTGACATCTGCCACA O_anatinus304340 CCCTCGGTGGGCCGA-CGAGTGG-AGTTTGA--TAGTGACATCTGCCACA O_anatinus304341 G--CTCG---CCTCCGTGACTGG-GGTTTGA--TAGTACTCGCTGCCACA O_cuniculus300174 GTCCATG--GCCTGA-TGAAGGG-AGTTGGC--TAGTGATTCTTGCTACA O_cuniculus300209 GTCCCTG--GCCTTA-TGAGTGG-AGTTGGA--TAGTAATCCTTCCCACA O_cuniculus300214 TGTA-----ATGCCAGCAACCCA--T------------------------ O_cuniculus300229 ATCTTTG--GCACAG-TGAGTGGA-GTTCAG--TGGCAGTCCTTGCCACA O_cuniculus300378 GTCCCTG--GCCTGA-TGAGTGGA-GTTGGA--TAGTGACACTTGCTACA O_cuniculus300473 GTCCCTT--GCCCAA-TGTGTGG-AGTTAGA--TAGTGACCCTTGCTGCA O_garnettii300022 GTCTCTG--GCCCAA-TGAGTGGAG-TTTGA--TAGTAATCCTTGCTACA O_garnettii300024 GTCTCTG--GCCCAA-TGAATGGGAGTTTGA--TAATAATCCTTGCTACA O_garnettii300028 GTCTCTG--GCCCAG-TGA-TGGAG-TTTGA--CAGTAATCCTTGCTACA O_garnettii300184 GTATCTG--GCCCAA-TGAGTGGAG-TTTGA--TAATACTCCTTGCTACA O_garnettii300203 GTCTCTG--GGCCAA-CTAGTAGAGGTTTGA--TAGTAATCCTTGCTACA O_garnettii300244 GTCTCTG--GTCCAA-TGAGTGGAG-TTTGA--TAGTAATCCCTGCTACA O_garnettii300284 GAGCTTC---CCTCTATGACTGG-CGTTTGA--TAGTTCTCACTGCCAAA O_garnettii300508 GTCTCTG--GCCCAA-TGAGCAG-AGTTC------------CTTGCTACA O_garnettii300525 GTCTCTG--GCCCAA-TGAGTGGAG-TTTTA--TAGTAATCCTTGATACA O_garnettii300568 GTCTCTG--GCCCAA-TGAGTGGAG-TTTTA--TAGTAATCCTTGATACA O_garnettii300741 G--CTTG---CCTCTATGACTGG-AGTTTGA--TAGTACTCTCTGCCACA P_troglodytes300157 GTCTCTG--GCCCAA-TGAGAGG-AGTTTAA--TAGAAATTCTTGCTACA P_troglodytes300478 GTCTTTG--GCCTAG-TGAGTAGA-GTTTGA--CAATAATCCTCGCTGCA P_troglodytes300518 GTCTCTG--ATCCAG-TGAATGG-AGTTTGA--TAGTAATTTTTGATACA P_troglodytes300621 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTACTCGCTGCCACA P_troglodytes300622 GTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TAGTAATACTTGCTACA P_pygmaeus300104 GTCTCTG--GCTCAA-TGAGTGG-AGTTTGA--TAGTAGTTCTTGTGACA P_pygmaeus300258 GTCTCTG--GCCCAA-TGAGTGG-AGTTTAA--TAGAAATTCTTGCTACA P_pygmaeus300550 GTCTTTG--GCCTAA-TGAGTAGA-GTTTGA--CAATAATCCTCGCTGCA P_pygmaeus300600 GTCTCTG--ATCCAG-TGAGTGG-AGTTTGA--TAGTAATTTTTGATACA P_pygmaeus300725 GTCTCTG----CCCA-TGAGTGA-G--TTGA--TAGTAATTCT-GCTACA P_pygmaeus300726 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTACTCGCTGCCACA R_norvegicus300435 --CTCTG--GCCCAG-TGAGTGG-GGTTTGA--TAGTAACCTTTGCTACA R_norvegicus300501 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTGGTCACTGACACA R_norvegicus300781 G--CTGG---CCTCTATGACTGG-AGTTTAG--TAGTGGTCACTGCCACA R_norvegicus300825 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTGGTCACTGCCACA R_norvegicus300878 G--CTTG---CCTCTATGACTGG-AGTTTGG--TAGTGGTCACTGCCACA R_norvegicus300880 --CTCTG--GTCCAG-TGAGTGG-GGTCTGA--TAGTAACCTTTGCTACA R_norvegicus300955 G--CTTG---CCTCAATGTCTGG-AGTTCGG--TAGTGATCACTGCCACA S_araneus300062 GGCCTCT--GGCCAA-TAAGTGA-AGTTTGG--TAGTCATTCTTGCTATT S_araneus300156 GTCTCTG--GCCCTATCAATTGA--TTTTTA--TGGTAATTTTGTTAAAA S_araneus300442 ATCTCT---GCCCAA-TAAATGGA-GTTTGC--TAGTAATTCTTGCTACA S_araneus300705 TTCTCTG--GCCCAA-TGAGTGG-AGTTTGA--TATTAATTCTTGCTACA S_araneus300954 GTCTCTG--GACCAA-TGAGTGG-AGTTTGA--TCATAATTTTTGCTACC S_araneus300996 GTCTCTG--GCCCGA-TGAGTGG-GCTTTGA--TAGTAATTCTTGCTACA S_tridecemlineatus300006 G--------ACCCAA-TGGATGAA-GTTTGA--TAGTAATCCTTGCTACA S_tridecemlineatus300139 --TTCTG--ACCCAA-TGAGTGG-AGTTTGA--TAGTAATCCTTGCTACA S_tridecemlineatus300213 AT-TCTG--GCACAA-TGAGTAA-AGTTTGA--TAGTACTCCTTGCTACA S_tridecemlineatus300229 G--CTTG---CCTCTATAACTGA-AGTTTGA--TAGTATTCCCTGCCACA S_tridecemlineatus300308 --TTCTG--ACCTAG-TGAGTGGA-GTTTGA--TAGTAATCCTTGCTACA T_belangeri300001 ATCTCTG--GCCTGA-TGAGTGGA-GTTTGA--TAGTAATCCTTGCTACA T_belangeri300053 GTCTCTA--GCCCAG-TTAGTAG-AGTTTGA--TAGTAATCCTTGCTACA T_belangeri300105 GTTTCTG--GCCCGA-TGAGTGGA-GTTTAA--TAGTAATCATTGCTACA T_belangeri300112 GTCTCTG--GC---T-TGAGTGGG-GTTGGA--TGGTAGTCCTTGCTACG T_belangeri300230 GTCTCTG--GCCCGA-TGAGTGG-AGTTTGA--TAGTAATTCTTGTTACA T_belangeri300327 G--CTCA---CCTCTGTGACTGG-AGATTGA--TAGTACTTGCTCCCACA T_belangeri300333 GTCTCTG--GCCCGA-TGAGTGG-CATTTGA--TAGTAATCCTTGCCACA T_belangeri300358 G--CTCG---CCTCTATGACTGG-AGTTTGA--TAGTACTTGCTGCCACA T_belangeri300359 GTCTCTG--ACCCGA-TGAGTGG-AGTTTGA--TAGTAATTCTTGCTACA X_tropicalis300082 TGCTTTAAAGCTCCAGTGACTGG----TTGT--AAGTAATTCCTGCCACA X_tropicalis300083 GTCCTTG--GCTCAA-TGATCGG-CGTTTGA--TAGTGATCTCTGCTACA C_familiaris300002 AGT- C_familiaris300003 AAT- C_familiaris300024 AAA- C_familiaris300034 GTT- C_familiaris300039 AGT- C_familiaris300049 AGT- C_familiaris300057 AGT- C_familiaris300062 AGT- C_familiaris300081 AGT- C_familiaris300123 AGT- C_familiaris300140 AGA- C_familiaris300170 AGT- C_familiaris300172 AGT- C_familiaris300277 AAT- C_familiaris300280 AGT- C_familiaris300281 AGT- C_familiaris300290 AGT- C_familiaris300293 ACA- C_familiaris300294 GGT- C_familiaris300357 AGT- C_familiaris300374 AGA- C_familiaris300407 AGT- C_familiaris300412 AGT- C_familiaris300425 TTG- C_familiaris300426 AGT- C_familiaris300427 AGT- C_familiaris300441 ---- C_familiaris300454 ATT- C_porcellus300672 GGG- C_porcellus300900 CAC- C_porcellus300901 GAT- D_rerio300116 TTT- D_rerio300205 AAT- D_rerio300216 ATG- D_rerio300217 TTT- D_novemcinctus300008 AGT- D_novemcinctus300041 AAT- D_novemcinctus300374 AAC- D_novemcinctus300384 AGT- D_novemcinctus300448 AGT- D_novemcinctus300479 GAT- D_novemcinctus300590 TAC- D_novemcinctus300591 GGT- E_telfairi300150 AGT- E_telfairi300220 TGT- E_telfairi300507 C--- E_telfairi300674 AGT- E_telfairi300675 TGC- E_telfairi300796 AAA- E_caballus300104 GGT- E_caballus300371 AGT- E_caballus300372 TAC- E_europaeus300016 TTC- E_europaeus300134 TTC- E_europaeus300238 TTC- E_europaeus300267 ATA- E_europaeus300358 ATA- E_europaeus300649 ATA- E_europaeus300697 AATA E_europaeus300707 AGTA F_catus300009 TGT- F_catus300010 AAT- F_catus300016 AGG- F_catus300019 AGT- F_catus300043 AGT- F_catus300055 ATT- F_catus300059 ACT- F_catus300071 AGT- F_catus300077 AGT- F_catus300107 AGT- F_catus300108 AGT- F_catus300110 AGT- F_catus300113 AGC- F_catus300145 ATT- F_catus300153 AGT- F_catus300164 GGT- F_catus300201 AGT- F_catus300206 AGT- F_catus300207 AGT- F_catus300210 AGT- F_catus300211 AGT- F_catus300234 TTC- F_catus300328 AGT- G_gallus300060 GTT- G_gallus300061 TGC- H_sapiens300604 AGTA H_sapiens300658 AGT- L_africana300404 TCC- M_mulatta300058 AGT- M_mulatta300067 AGT- M_mulatta300132 AGT- M_mulatta300604 AGT- M_mulatta300605 TAC- M_mulatta300640 ACT- M_murinus300003 AGT- M_murinus300043 AGT- M_murinus300308 AAT- M_murinus300433 TAC- M_murinus300434 AGT- M_murinus300451 AGT- M_domestica300168 TTT- M_domestica300169 TGT- M_musculus300694 TAC- M_musculus300898 TGC- M_musculus300900 AAA- O_anatinus303007 GGT- O_anatinus304340 GGT- O_anatinus304341 CGC- O_cuniculus300174 AGT- O_cuniculus300209 AAT- O_cuniculus300214 ---- O_cuniculus300229 AGC- O_cuniculus300378 AGC- O_cuniculus300473 AGT- O_garnettii300022 AGT- O_garnettii300024 AGT- O_garnettii300028 AGT- O_garnettii300184 AGT- O_garnettii300203 AGT- O_garnettii300244 AGT- O_garnettii300284 TAC- O_garnettii300508 AGT- O_garnettii300525 AGT- O_garnettii300568 AGT- O_garnettii300741 TAT- P_troglodytes300157 ACT- P_troglodytes300478 AGT- P_troglodytes300518 AGT- P_troglodytes300621 TAG- P_troglodytes300622 AGT- P_pygmaeus300104 AAT- P_pygmaeus300258 ACT- P_pygmaeus300550 AGT- P_pygmaeus300600 AGT- P_pygmaeus300725 -GTG P_pygmaeus300726 TAG- R_norvegicus300435 AGT- R_norvegicus300501 CAC- R_norvegicus300781 TAT- R_norvegicus300825 TAC- R_norvegicus300878 TAC- R_norvegicus300880 AGT- R_norvegicus300955 TAC- S_araneus300062 GGA- S_araneus300156 TG-- S_araneus300442 GAA- S_araneus300705 AAT- S_araneus300954 CCG- S_araneus300996 AAT- S_tridecemlineatus300006 CAT- S_tridecemlineatus300139 AGT- S_tridecemlineatus300213 AGT- S_tridecemlineatus300229 TAC- S_tridecemlineatus300308 AGT- T_belangeri300001 AGT- T_belangeri300053 ATT- T_belangeri300105 AAT- T_belangeri300112 AGT- T_belangeri300230 AGT- T_belangeri300327 TAT- T_belangeri300333 AGT- T_belangeri300358 TTG- T_belangeri300359 AGT- X_tropicalis300082 GCT- X_tropicalis300083 GTT-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved