snOPY snoRNA Orthological Gene Database

Family: SNORA68

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300413 --------CCAGCACCTCAACCC-AAGAACTGCTG----TTTCTCATAGC C_porcellus300822 --------CTTGCACCTCAACCC-AAGAACCGCCA----CTTCCCGTAGT D_rerio300206 ------CGAGCACAC---AAACCCAAAGGTCATCTC---TCCATCAT--G D_rerio300207 ------TCTGCACAC---AAACCCAAAGGTCATCTC---TCCATCAT--G D_novemcinctus300036 --------CTCGCACCCAAACCC-AAGCACTGCAG----TTTCTATTAAC D_novemcinctus300042 --------CTCGCACGTAAACCC-AAGAATTGCTG----TTTCTTATGA- D_novemcinctus300071 --------CCCGCGCCCAAACCC-AAGAGCCGCCG----TTTGCGGTAAC D_novemcinctus300229 -------------------GAGTGAAGAACCTCCACATCACTCTGAGAGG D_novemcinctus300351 ---ATAGCACTGCGGCTCACGCC-AAGAACCGCAG----TTTCTCCTTTC D_novemcinctus300357 --------CTCACATGCAAACCC-AAGAATTGCAG----TTGCTC-TAA- D_novemcinctus300484 ----------------------------------------AATAAATCCA D_novemcinctus300571 --------ATAGCACTTGTGTTGGAAAAACGATTT----TGTAAAA---G D_novemcinctus300611 --------CTCACACCCGAACC--AAGAGCTGCAG----TTTCTTGTAAC D_melanogaster300085 GTCGCACAAATCCCTATTGAGGCAACAGACGGCTAGTTGACCCCAGTAAG E_telfairi300209 --------CTTGCACCCAAACCC-AAGGACTGTGG----CTTCTCGTAGC E_telfairi300636 --------CTTGCACCCAAACCC-AAGGACTGTGG----CTTCTCGTAGC E_caballus300320 --------CAGGCACCTAAACCC-AAGAACTGCTG----TTTCTTGTAGC E_europaeus300014 --------CCAGCACCCAAATCC-AAGGGCTTAGT----ATTAATGTAAT E_europaeus300100 --------TTAGCACCTAAACCC-AACGGCCACTA----TTTATTATAAT E_europaeus300225 --------TCCTCACCTAAACCC-AAGGGCCACTA----TTTATTGTAAT E_europaeus300288 --------AGAACAACAAAATGGAATAAATATTTT----TTAAAAAAGAG E_europaeus300361 --------TTAGCACCTAAACCC-AAGGGCCACTA----TTTATTGTAAT E_europaeus300538 ---------------AGAGGAACTAATTTCCATTG----TTTGAGAGAGA E_europaeus300641 ---------------CCAGCACC-AAGGGCCACTA----TTTACTGTAAT F_catus300261 --------GAAGCACCTCAACCC-AAGAACTGCTG----TTTCTTGTAAT G_gorilla300784 --------GTCGTACCTAAACCC-AAGAATCA--C----TTTCTTATAGT G_gorilla300783 --------GTCGCACTTAAACTT-AAGACTC--TT----TTTCTTGCAAC G_gorilla300052 --------------------------------CAGTCACCATTGTTTGTC G_gorilla300320 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC G_gorilla300321 --------CTCTCACCTAAACCC-AAGAATCACTG----TTTCTTGTAGC G_gorilla300487 --------CTTGCACCTAAACCCAAAGAATCACTG----TTTCTTGAAGT H_sapiens300560 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC H_sapiens300561 --------TTCTCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC L_africana300439 --------CTTGCACCCAAACCC-AAGAACCGCAG----TTTCTCGTAGC M_mulatta300024 --------GTCACACTTAAACTC-AACACTC--TT----TTTCTTGCAGC M_mulatta300230 --------GTTGCACCTAAACCTGAAGAATCACTG----TTTCTTGAAGT M_mulatta300266 ----------ACTGCGCCCGGCC-AAGAAGCA--C----TTTCTTATTGT M_mulatta300539 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC M_mulatta300540 --------CTCTCACCTAAAGCC-AAGAATCATTG----TTTCTTGTAGC M_murinus300223 ------TCGTTTTTGGTCACCCAGATTGATAAATGTGAACAACGTTTGTC M_murinus300230 ---------CATGTCTCTGAAACAAAG----CTCA----TAAAAATTCA- M_murinus300367 --------GTAGCACCTAAACCC-AAGAATCGCTG----TTTCTTATAGC M_musculus300378 --------CTGGCACCCAT-CCC-AAGAACTGGTG----CTGCCTGTAGT M_musculus300413 --------CCCACACCCAA-TCC-AAGAACCTCTG----CTGCCTGTAGC M_musculus300807 --------CTGGCACCCAA-CCC-AAGAACTGTCG----CTGCCTGTAGC M_musculus300869 --------GTGGCACCCAA-CCC-AAGAACTGCCG----CTGCCTGTAGC M_lucifugus300680 --------CAAGCACCTAAACCC-AAGAACTGCTG----TTTGCTGTAGC M_lucifugus300681 --------CAAGCACCTAAACCC-AAGAACTGCTG----TTTGCTGTAGC M_lucifugus300139 -------------------------------ATCT----CGCTCAAAACC M_lucifugus300361 -------------------------------ATGA----CACACTTTAAG O_anatinus304526 --------AGCACCCC-GAGCCCCAAAGATCATCAT---TTTCCT-TTAG O_anatinus304527 ------ACTGCACCCCCAAGCCCCAAAGATCATTGT---TTCCTTCTTCA O_cuniculus300145 -------TGCCCATACTAAACCC-AAGAATCACAG----TTG--TGTAGC O_cuniculus300377 --------CAAGCACCCGAACCC-CAGACCCGCCG----TGCACCGTGGC O_garnettii300499 --------CTAAATCCCAAACCC-AAGAATTGCTG----TTTCTTGTAGC O_garnettii300174 --------CTGGCTCCCAGAAATAAAAGGCACTCT----TAAAACATAAA O_garnettii300301 --------TTTGCACCTAAACTCCAA-AATTGCTG----TTAAT-ATAGC P_troglodytes300020 -----------ATACCTAAACCC-AAGAATCA--C----TTTCTTATAGT P_troglodytes300086 --------GTCGCACTTAAACTT-AAGACTC--TT----TTTCTTGCAGC P_troglodytes300603 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC P_troglodytes300604 --------TTCTCACCTAAACCC-AAGAATTACTG----TTTCTTATAGC P_pygmaeus300026 --------GTCGCACTTAAACTT-AAGGCTA--TT----TTTCTTGCAGC P_pygmaeus300235 -----------ATACCTAAACCC-AAGAATCA--C----TTTCTTATAGT P_pygmaeus300236 --------------------------GTAGCA-TC----TNNNNNNNNNN P_pygmaeus300437 --------GTTGCACCTAAACCCAAAGAATCACTG----TTTCTTGAAGT P_pygmaeus300659 --------ATTGCACCTAAACCC-AAGAATCACTG----TTTCTTATAGC P_pygmaeus300660 --------CTCTCACCTAAACCC-AAGAATCACTG----TTTCTTGTAGC R_norvegicus300473 --------CAGGCACCCAA-CCC-AAGAACTGCCG----CTAC-TGCAGT R_norvegicus300997 --------TTGGCACCCAA-CCC-AAGAACTGCCG----CTAC-TATAGC R_norvegicus300581 --------CCCACACCCAG-TCC-AAGAAC-TCTG----CTGCCTGTAGC S_araneus300104 -------------------------------------------TTGTAGC S_araneus300220 -------ATGGAGATTTTTACGCAGGGGTCACTGA----AAACATTTAGA S_araneus300241 --------AAAGCAAGTAAATCC-AGGAGCTGTTGCTTCTTTGCCAATGC S_araneus300263 --------GTCTGATCTAATTTCTAAAACAAATTG-----ATATTTTAGC S_araneus300323 --------GTCTGATCTAATTTCTAAAACAAATTG-----ATATTTTAGC S_araneus300856 ----------------------------------------ATAGATCAGA S_tridecemlineatus300279 --------CCTGCACCTCAACCC-AAGAATTGCTG----TTTCTCGTAGC S_tridecemlineatus300236 --------CTTGTATCTCAACCT-AAGAATTGCTG----TTTCTTGTAGC T_nigroviridis300145 ------CATGCACCC---AAACCCAAAGCTC--CCA---CCTGCGGT--G T_belangeri300312 --------CTCACACCCCAACCC-AAGAGTCACTG----TTGGTTGTTGC T_belangeri300108 --------TTCTCTCCTCAACCC-AAGAGTCACTG----TTGGTCATTGC T_belangeri300173 ------------ATCCCATTTCC-AAGAATTACTG----TTTCCTATAGC T_belangeri300288 --------CTCGCACCTAAACCC-AAGGGCCGCGG----TTTGCCGTAGC C_familiaris300413 AGCGGTTTAAACA--GAGGTGCTAACAGCAA-AGTGGATCT--CGTCGCC C_porcellus300822 GACGGTTTAAACA--GGGGTGCACATAGTA--AGTGGATCT--CGTCGCC D_rerio300206 TCTTGCCCTTGCTA-TGTGTGCGCAAAGCAA-ACGGAACCT--TGTCGCC D_rerio300207 TCTTGCCCTTGCTA-TGTGTGCGCAAAGAAA-AAGGAACCT--TGTCGCC D_novemcinctus300036 AGTGGCTCAAACA--GCGGTGAGGACAGCA--AGTCAATCT--CGTCACC D_novemcinctus300042 ----------ACA--GCAGTGCGAACAGCA--AGAGAACCT--CGGTGCC D_novemcinctus300071 GGCGGCTCAAGCA--GCGGCGCGGACAGCA--CGCGAGCCT--CGTCGCC D_novemcinctus300229 CACAGCATAGCCCC-CAAAGGTGATGAGGTTCGCTTGATGT--TAGCACT D_novemcinctus300351 TGTGGTTTAAATA--GCGGTGCAAACAGCA--AGGGAATCT--CGTCGCC D_novemcinctus300357 ----------ACA--GTGGTGCTAAGAGGC--GGCGAAGGT--CGTCACC D_novemcinctus300484 ATCT-TTAAAATAG-GA-----AAATAG-GT-GTGAA-TTT--TGTTGCC D_novemcinctus300571 ATGTCCCCAGA------GGTGCCAATGGCAA-GCGA-ATTT--CGTCGCC D_novemcinctus300611 AGCGGCTCAAACA--GCGGTGTGGATAGCA--AGCGAATCT--TGTCGCC D_melanogaster300085 ACCTTTGAACGCGTCTAAGTGCGAGAGAAACCGAAAGACTTGACGTCGCA E_telfairi300209 AGCAGTTTAAAGA--GTGGTGCGCACAGAA--AGTGGGCCT--TGTCGCC E_telfairi300636 AGCTGTTTAAAGA--GTGGTGCGCACAGAA--AGTGGGCCT--TGTCGCC E_caballus300320 AGCGGTTTAAACA--CAGGTGCTAACAGCAA--GCGGATCC--TGTCGCC E_europaeus300014 AGTGGTTCAAACA--CAGGTGCTAACAGCAA-AGGGGGCCC--CATCGCT E_europaeus300100 AGTGGCTCAAACA--CAGGTGCTAACAGCAA-AGGGTACCT--CGTCGCC E_europaeus300225 AGTGGCTCAAACA--CAGGTGCTAACAGCAA-AGGATACCT--CGTCATC E_europaeus300288 GCATCATCAAACA--CAGGTGCTAACAGCAA-AGGGTACCT--CGTTGCC E_europaeus300361 AGTGGTTCAAACA--CAGGTGCTAACAGCAA-AGGGTACCT--CGTCACC E_europaeus300538 AAGTGCTGAAG-G----GATGCTAACAGCAA-GGGGAACCT--CGCCGCC E_europaeus300641 AGTGGTTCAAACA--CAGGTGCTAACAGCAA-AGGGTACCT--C-TCACC F_catus300261 AGCGGTTTAAACA--GAGGTGCTGACAGCAA--GTTGATCT--CGTCGCC G_gorilla300784 GATGATTTAAACA--GA--TGCAAACAGCA--AGCACATCT--TGTCACC G_gorilla300783 AGTGGTTTAAAAA--GAGGAACAAACAGGA--AG---ATCT--TGTCGCC G_gorilla300052 AATTATTTCTTCA---CAATGTCTATTGAA-----GGATCT--CATCACC G_gorilla300320 GGTGGTTTAAACA--GAGGTGCAAACAGCA--GGCGGATCT--CGTCGCC G_gorilla300321 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGAATCT--CGTCGCC G_gorilla300487 GGTGGTTTAAACA--GAGGTGCAAACAGCAA--GCGAATCT--CATTACT H_sapiens300560 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGCGGATCT--TGTCGCC H_sapiens300561 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGAATCT--CGTCGCC L_africana300439 GGCGGTTTAAACA--GTGGTGCACACAGCA--AATGGACCT--TGTCGCC M_mulatta300024 AGTGGTTTAAACA--GAGGAACAAACAGGA--AG---ATCT--TGTCACC M_mulatta300230 GATGGTTTAAATA--GAGCTGCAAACAGCAA--GCGAATCT--CATTATC M_mulatta300266 GATGATTTAAACA--GA--TGCAAACAGCA--AGCACATCT--TGTCACC M_mulatta300539 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGCGGATCT--CGTCGCC M_mulatta300540 GGTGGTTTAAACA--GAGTTATAAACAGCA--AGTGAATCT--CGTCGCC M_murinus300223 AATACTTTCTTCA---AAATGTCTCTTGAA-----GAATCC--CATCACC M_murinus300230 -TCTCTTTAAACA--GAGGTGCAAACAGCAA-GTGGA-TCT--CATCGCC M_murinus300367 AGTGGTTTAAACA--GAGGTGCCAACAGCA------------------CT M_musculus300378 TGCTGTCTTAACA--GTGGTGCACACAGCA--AAGGGGCTT--TGTTGCT M_musculus300413 AGCCA-TTAAACC--GTGGTGTGCACAGCA--AAGGGGCTT--TGCTGCC M_musculus300807 GGCTGTTTAAATA--GTGGTGCACACAGCA--AAGGGGCTT--CGTCGCC M_musculus300869 AGCTGTTTAAATA--GTGGTGCACACAGCA--AAGGGGCTT--TATCGCC M_lucifugus300680 AGCAGTTGAAACA--G--GTGCTAACAGCAA--GTGGATCT--TGTCGCC M_lucifugus300681 TGCAGTTGAAACA--G--GTGCTAACAGCAA--GTGGATCT--TGTCGCC M_lucifugus300139 AAGTGCAGAAACA----GGTGCTAACAGCAA-GTGGA-TCT--TGTTGCC M_lucifugus300361 AATTGTGAACAG------GTGCTAACAGCAA-GTGGA-TCT--TGTCGCC O_anatinus304526 TAATGATCTATCTT-GGGGTGCT--------------------------- O_anatinus304527 CAATGATCTTATCT-GGGGTGCTGACATCAA-TTGTA-CCT--CGTCGCC O_cuniculus300145 AGTGATTTAAACA--CAGGTGTGCACAGCA--AGTGGATCT--CATCGCC O_cuniculus300377 CACGGCTCCAAGC--G-GGTGCAAACAGCAG-CGGGGGCCT--CGTCGCC O_garnettii300499 AGTTGTTTAAACA--GGGGTGCTAACAGCA--AATTCACTT--GGGGAGC O_garnettii300174 ATGTCTTTAAATAA-GAGGTGCAGATAGCAA-GTGGA-TCT--TGTGGCC O_garnettii300301 AGTGATTTAAACA--GATGTGCAGACAA-----GTGGATCT--CATCACC P_troglodytes300020 GATGATTTAAACA--GA--TGCAAACAGCA--AGCACATCT--TGTCACC P_troglodytes300086 AGTGGTTTAAACA--GAGGAACAAACAGGA--AG---ATCT--TGTCGCC P_troglodytes300603 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGGATCT--CGTCGCC P_troglodytes300604 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGAATCT--CGTCGCC P_pygmaeus300026 AGTGGTTTAAACA--GAGGAACAAACAGGA--AG---ATCT--TGTCGCC P_pygmaeus300235 GATGATTTAAACA--GA--TGCAAACAGCA--AGCACATCT--TGTCACC P_pygmaeus300236 GATGATTTAAACA--GA--TGCAAACAGCA--AGCACATCT--TGTCACC P_pygmaeus300437 GGTGGTTTAAACA--GAGGTGCAAACAGCAA--GCGAATCT--CATTACT P_pygmaeus300659 GGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGGATCT--TGTCGCC P_pygmaeus300660 AGTGGTTTAAACA--GAGGTGCAAACAGCA--AGTGAATCT--CGTCGCC R_norvegicus300473 GG-TGTTTAAACA--GTGGTGCACACAGCA--AAGTG-CTT--TGTTGCC R_norvegicus300997 GGCTGTTTAAACA--GTGGTGCACACAGCA--AAGTG-CTT--CGTCGCC R_norvegicus300581 AGGTAATTTAACA--GTGGTGTGCACAACA--AAGGGGCTT--TGTCACC S_araneus300104 CGCAGCTTAA-CA--GCGGTGCCGACAGCA--AGTGCATCT--CGTCGCC S_araneus300220 AACTGCAAACAGA----GGTGCTGACAGCAA-ACAGA-TCT--TATCACA S_araneus300241 AGCGGCTTAGACA--GAAGTTCTGACAGCCA--GCGGCTCT--TGTTGAC S_araneus300263 CTTGGCTTAAACA--GTGGTACCAACAG-A--AACGAATCT--GGTCACC S_araneus300323 CTTGGCTTAAACA--GTGGTACCAACAG-A--AACGAATCT--GGTCACC S_araneus300856 ATGTAATGGGTCA--GTGGTGCCAACAGCAA-GTGC-ATCT--CCTTGCC S_tridecemlineatus300279 AGTGGTTTAAACA--GAGGTGCTCACAGCAA--GTGGATCT--CGTCGCC S_tridecemlineatus300236 AGCTGTTTAAACA--GAGCTGCATACAGCAA--GTGGATCT--TGTCACT T_nigroviridis300145 GTGCGAGCTTGTCT-GGTGTGCTGACAGAAC-CTGGGCCCC--TGTCGCC T_belangeri300312 AGTGGTTTAAACA--GAGGTGCAGATGGCA--AGCAGGCCT--CCTCGCC T_belangeri300108 AGCAGTTTAAACA--GAGGTGCAGACAGCA--AGTGGATTT--CGTCACC T_belangeri300173 AGTGGTTTAAACA--GAAGTGCAAACAATT--AAAGAATCT--CATCCTG T_belangeri300288 TGCGACTTAAACA--GGGGTGCGGACAGCA--AGCGGACCT--CGTCGCC C_familiaris300413 TTTGGGGGG----CTGTGGCTGTGCTCCTC--AAAGTGAATTTGGAGG-- C_porcellus300822 TTTGGAGGG----CTGTGGCTGTGCCCACC--AAAGTGAATTTGGAGG-- D_rerio300206 TTTCATGGGCTGTGTGTTGACGTGCCTCTG--GAAGTGAATTCAAGGAGC D_rerio300207 TTTCATGGGCTGTGTGTTGACGTGCCTCTG--AAAGTGAATTCAAGGAGC D_novemcinctus300036 TTTGGGGGG----CTGTGCC-ATGTCCCTC--AGAGTGAATGTGGAGG-- D_novemcinctus300042 TTCAGGG------CTGTGCG-GTGCCCTC-----AGTGAACGTGGAGG-- D_novemcinctus300071 TTTGGGGGG----CTGTGCC-GTGCCCCCC--GGAGTGAATGTGGAGG-- D_novemcinctus300229 GCTGTTTGG-----AGAAACTGCGGTTCTTG-GGTTTAGATGTGAG---- D_novemcinctus300351 TTTGGGGTG----TAGTGCA-ATGCCCCTC--AGAATGAAGGTGGAGG-- D_novemcinctus300357 TTTTGGGGC----TTGTGCT-GTGCCCTCC--AGAGTGAACGTGGATG-- D_novemcinctus300484 TTTGG-GGGG---CTGT-ACCGTGCCCCTC--AGAGTGAATGTGGAGG-- D_novemcinctus300571 TTTGG--GGG----CTGTGCCGCACCCCTT--CCGGTGAATGTGGAGG-- D_novemcinctus300611 TTTGGGGG-----CTGTGCC-ATGCCTCTC--AGAGTGAATATGGAGG-- D_melanogaster300085 TTTGCCATAA--ACCAACTCAACGGAGTGGC-GAATTGAAACTTCGAG-- E_telfairi300209 TTTGAGGGG----CTGTG-CAGTGCCCCTC--AGAGTGAATGTGAAGG-- E_telfairi300636 TTTGAGGGG----CTGCG-CAGTGCCCCTC--AGAGTGAATGTGAAGG-- E_caballus300320 TTTGAGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGA-- E_europaeus300014 TTTGGAGGA----CTGT--CTGCGCCCTTC--AAAGTGAATTTAGAGG-- E_europaeus300100 TTTGGAGGA----CTTG--CTGTGCCCTTC--AAAGTGAACTTAGAGG-- E_europaeus300225 TTTGGAGGA----CTTC--CTGTGCCCTTC--AAAGTGAATTTAGAGG-- E_europaeus300288 TTTGG--AGG----ACTTGTTGTGCCCATC--AAAGTGAACTTAGAGG-- E_europaeus300361 TTTGGAGGA----CTTG--CTATGCCCTTC--AAAGTGAACTTAGAGG-- E_europaeus300538 TCTGG--AGG---AC-TCTCTGTGCCCTTC--AAAGTGAACTTGGAGG-- E_europaeus300641 TTTGGAGGA----ATTT--CTGTGCCCTTC--AAAGTGAATTTAGAGG-- F_catus300261 TTTGGGGGG----CTGTGGCCGTGCTCCTC--AAAGTGAATTGAGAGG-- G_gorilla300784 TTTGTGGGA----CTGTGGCTGTGCCCCTC--GCAGTAAATTTGGAGG-- G_gorilla300783 TTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACTTTGGAGG-- G_gorilla300052 TTTAGAGAG----CTGTGGTCGTGCCCCTT--AAAGTGAATTTGGAGG-- G_gorilla300320 TTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG-- G_gorilla300321 TTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGTAAATTTGGAGG-- G_gorilla300487 TTTGG-TGG----CTGTGGCCATGCTCCTT--AAAGTGAACTTAGAGG-- H_sapiens300560 TTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG-- H_sapiens300561 TTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGGAAATTTGGAGG-- L_africana300439 TTTGGGGAG----CTGTC-CCATGCCCCCC--AGAGTGAATATGGAGG-- M_mulatta300024 TTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACTTTGGAGG-- M_mulatta300230 TTTGG-TGG----CTGTGGCCATGCTCCTT--AAAGTGAACTTAGAGG-- M_mulatta300266 TTTGCGAGG----CAGTGGCTGTGCCCCTC--ACAGTAAATTTGGAGG-- M_mulatta300539 TTTGGGGGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG-- M_mulatta300540 TTTGTGGGG----CTGTGGCCATGCCCCTC--AAAGTGAATTTAGAGG-- M_murinus300223 TTTGGGGAG----CTGTGG-CAGGCCCCTC--AAAGTGAATTTGGAGG-- M_murinus300230 TTTGG-GAAG---CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGGTT M_murinus300367 TTTGG-GGG----CGGTTGTCATGCCCCTC--CAAGTGAATTTGGAGG-- M_musculus300378 TTTGGGGGGGGGGCTGTG-TAGTGCCCCCCC-AGAGTGAATCAGTAGG-- M_musculus300413 TTTGGGAGG----CTGTG-TGGTGCCCGC---AGAGTGGACTGGGTGG-- M_musculus300807 TTTGGGGGG----CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG-- M_musculus300869 TTTGGGGGGG---CTGTG-CAGTGCCCCCC--AGAGTGAATCAGTAGG-- M_lucifugus300680 TTTGGGG-G----CTGTGACTGTGCCCCTC--AAAGTGAATTGGAAGG-- M_lucifugus300681 TTTGGGG-G----CTGTGACTGTGCCCCTC--AAAGTGAATTGGAAGG-- M_lucifugus300139 TTTGG--GGG---CTGTCACTGTGCCCCTC--AAAGTGAATTGGAAGG-- M_lucifugus300361 TTTGG--GGG---CAGTCACTGTGCCCCCTC-AAAGTGAATTGGAAGG-- O_anatinus304526 -------------------------------------------------- O_anatinus304527 TTTCAAGAGCTGTTCG---AAGTGCTCCTG--AAAGTGAAATGGAAGGTT O_cuniculus300145 TTT--GGGG----CTGAGGCTGTGCCACTG--GAAGTGAATCTGGAAG-- O_cuniculus300377 TCTGAGGGG----CTGTGG--GTGCCCCCG--GGAATGAATGTGGAGG-- O_garnettii300499 T-----GAG----GTCATG--CCCCTNNNN--NNNNNNNNNNNNNNNN-- O_garnettii300174 TTTGGAGGGG---CTGTGACTGTGCCCCTC--GAAGTGAATGTGGGGGGG O_garnettii300301 TTTGGAGGG----CTGTGACTATGCCCCTC--AAAGTGAATGTGGAG--- P_troglodytes300020 TTTGCGGGA----CTGTGGCTGTGCCCCTC--GCAGAAAATTTGGAGG-- P_troglodytes300086 TTTGAGGGG----CTGTGGTTGGGCCCCTC--AAAGTGACTTTGGAGG-- P_troglodytes300603 TTTGGGGGG----CTGTGGCCGTGCCCCTC--AAAGTGAATTTGGAGG-- P_troglodytes300604 TTTGCGGGG----CTGTGGCCATGCCCCTC--AAAGTAAATTTGGAGG-- P_pygmaeus300026 TTTGAGGGG----CTGTGGTTGTGCCCCTC--AAAGTGACCTTGGAGG-- P_pygmaeus300235 TTTGCGGGG----CTGTGGCTGTGCCCCTC--GCAGTAAATTTGGAGG-- P_pygmaeus300236 TTTGCGGGG----CTGTGGCTGTGCCCCTT--GCAGTAAATTTGGAGG-- P_pygmaeus300437 TTTGG-TGG----CTGTGGCTGTGCTCCTT--AAAGTGAACTTAGAGG-- P_pygmaeus300659 TTTGAGGAG----CTGTGTCTGTGCCCCTC--AAAGTGAATTTGGAGG-- P_pygmaeus300660 TTTGCGGGG----CTGTGGCCATGTCCCTC--AAAGTGAATTTGGAGG-- R_norvegicus300473 TTTGGGAGG----CTGGA-CAGTGCCCCCC--AGAGCGAATCAGGAAG-- R_norvegicus300997 TTTGGGGGG----CTGTG-CAGTGCCCTCC--AGAGTGAATCAGGAGG-- R_norvegicus300581 TT-GGGGGG----CTGTG-TGGTGCCCCCCCCAGAGTAGACTGGGAGG-- S_araneus300104 TTTGGGGGG----CTGGG-TGGTGCCCCTC--AGAGTGAATTTGGAGG-- S_araneus300220 TTTGA--GGG---GCTGGGTTGTGCCTCTT--AGAGTGAATTTAGAGG-- S_araneus300241 TTTGGAGAG----CTGTG-CTGTGCCC-TC--ACAGTGAATCTGGAGA-- S_araneus300263 TTTCAGGGG----CTGGG-CAGTGCCCCTC--AGAGTAAATTTGGAGG-- S_araneus300323 TTTCAGGGG----CTGGG-CAGTGCCCCTC--AGAGTAAATTTGGAGG-- S_araneus300856 TTTGG--GGG---GTTGGGCGGTGTCCCTC--TGAGTGAATTTGGGGG-- S_tridecemlineatus300279 TTTGAGAGG----CTGTGGCTGTGCCCCTC--AAAGTGAATTTGGAGG-- S_tridecemlineatus300236 TTTGGGAGG----CTATAGTTTTGCCCCTC--AAAGTGAATTTGGAGC-- T_nigroviridis300145 TTTCTGGGACTCTTC-----TGTGTCTCTG--AAAGTGAATTCAGGGGTC T_belangeri300312 TTTGGGCAG----CCGTGGCCGTGCCTCTC--GAAGTGAATTTGGAGG-- T_belangeri300108 TTTGGGGAG----CTGTCG--GCTCTGGCT--GGAACCCCTGGGCAGC-- T_belangeri300173 CTTAGGGGG----CTGTGGCTGTGCCCCTT--AAAACGAATGTGGAGG-- T_belangeri300288 TTTGGGGAG----CTGTGGCCATGCCCCTC--AAAGTGAATCTGGAGG-- C_familiaris300413 TTCTACACCC- C_porcellus300822 TTCCACACCC- D_rerio300206 CACATCT---- D_rerio300207 CACATCT---- D_novemcinctus300036 TTCTACACCC- D_novemcinctus300042 CTCTTCGTCC- D_novemcinctus300071 TTCGACAGGC- D_novemcinctus300229 ----------- D_novemcinctus300351 TTACACACAC- D_novemcinctus300357 TCCTACACCC- D_novemcinctus300484 TTCTGCAGTC- D_novemcinctus300571 ATCCACACCC- D_novemcinctus300611 TTCTATGCCC- D_melanogaster300085 TTACAAAG--- E_telfairi300209 TTCGACAAGC- E_telfairi300636 TTCGACAAGC- E_caballus300320 TTCTACACCT- E_europaeus300014 TTCTACACAC- E_europaeus300100 TTCTACACAC- E_europaeus300225 TTCTAAACTC- E_europaeus300288 TTCTACACAC- E_europaeus300361 TTCTACACAC- E_europaeus300538 TTCTACACAC- E_europaeus300641 TTCTACATAC- F_catus300261 TTCTACAGCC- G_gorilla300784 TTCTACATCC- G_gorilla300783 TTCTACACCA- G_gorilla300052 TTTTATACCC- G_gorilla300320 TTCCACAACT- G_gorilla300321 CTCTACAGCC- G_gorilla300487 CTCTACATCC- H_sapiens300560 TTCCACAACT- H_sapiens300561 CTCTACAGCC- L_africana300439 TTCTACACCC- M_mulatta300024 TTATACACCA- M_mulatta300230 CT-TACCTCCC M_mulatta300266 TTCTACATCC- M_mulatta300539 TTCTACAACT- M_mulatta300540 CTCTACAGCC- M_murinus300223 TTCTACACCA- M_murinus300230 CCTCGTGG--- M_murinus300367 TCA-------- M_musculus300378 TTCTACAGTC- M_musculus300413 TTCCATTGTC- M_musculus300807 CTCTACAGAA- M_musculus300869 TTCTACAGTC- M_lucifugus300680 TTCTACACTC- M_lucifugus300681 TTCTACACTC- M_lucifugus300139 TTCTACACTC- M_lucifugus300361 TTCTACACTC- O_anatinus304526 ----------- O_anatinus304527 CAACATAT--- O_cuniculus300145 TCTTACACCC- O_cuniculus300377 CCGCACATGC- O_garnettii300499 ----------- O_garnettii300174 TCCTACGTCC- O_garnettii300301 TTCTATATCC- P_troglodytes300020 TTCTACATCC- P_troglodytes300086 TTCTACGCCA- P_troglodytes300603 TTCCACAACT- P_troglodytes300604 CTCTACAGCC- P_pygmaeus300026 TTCTACACCA- P_pygmaeus300235 TTCTACATCC- P_pygmaeus300236 TTCTACATCC- P_pygmaeus300437 CTCTACATCC- P_pygmaeus300659 TTCCACAACT- P_pygmaeus300660 CTCTACAGCC- R_norvegicus300473 TTCTACAGTT- R_norvegicus300997 TTCTACAGTT- R_norvegicus300581 TTGCATAGTC- S_araneus300104 TTCTACACGG- S_araneus300220 TTCTACATTG- S_araneus300241 TTCTACACCC- S_araneus300263 TTCTACAAAG- S_araneus300323 TTCTACAAAG- S_araneus300856 TTCTACACGG- S_tridecemlineatus300279 TTCTACACTC- S_tridecemlineatus300236 TTCTACATTC- T_nigroviridis300145 AACAATG---- T_belangeri300312 TTCCACAGCC- T_belangeri300108 TCCTGGGCC-- T_belangeri300173 TTCTTGCCCC- T_belangeri300288 TCCCACACCT-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved