snOPY snoRNA Orthological Gene Database

Family: SNORA67

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300122 ----------------------ATCCAAAACGATTCCCTTT-TCAAGGA- C_familiaris300137 ---------------------------------------CTCATGCCCCT C_familiaris300340 ----------------------ACCCAAGCTGATTCCCTCT-CCAGGGG- C_porcellus300435 ----------------------ACCCATGGTGATTATCTTT-CCAAAGG- C_porcellus300523 ----------------------ATCCATGGTGATTATCTCT-CCAAAGG- C_porcellus300864 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGAG- D_novemcinctus300217 ----------------------GTCCAAGGTGATTCCCTCG-CCA-AGG- D_novemcinctus300258 --------------------------------------TTCCACAAACTC D_novemcinctus300366 ----------------------GTCCAAGGTGATTCCCTCT-CCA-AGG- D_novemcinctus300414 ----------------------GTCCAAGGTGATTTCCTCT-CCA-AGG- D_novemcinctus300449 ----------------------GTTCAAGGTGGTTCCTTCT-CCA-AGG- D_novemcinctus300462 ----------------------GTCCAAGGTGATTCCCTCT-CCA-AGG- E_telfairi300061 ----------------------GTCCAAGATGATCTCCTCTTCTAAGG-- E_telfairi300343 ----------------------TTCCCA---GAATCCTCATAAGAAGGCC E_telfairi300586 ----------------------ATCCAAGATGAGTCATTGTTCCAAGG-- E_caballus300136 ----------------------TTTCAAGGTGATCCCCTCT-CCA-AGG- E_caballus300345 ----------------------ATCCAAGGTGATTCCCTCTTCCAAGGG- E_europaeus300157 ----------------------ACCCAAGCTGATTCCCTCT-TCCAAGG- E_europaeus300635 ----------------------ACCCAAGCTGATTCCCTCT-TCCAAGG- F_catus300085 ----------------------ATCCAAGGTGATTCCGTCT-ACATGGC- F_catus300129 -------------------------------------------------- H_sapiens300701 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- L_africana300504 ---------------------ATCCAAAGGTGATTCCCTCT-CCAAGGG- M_mulatta300130 ----------------------ATCCAAGGGGACTCCCTCT-CCAAGGG- M_mulatta300275 ----------------------ATCCAAGGTGAGTCCCTCT--CCAAGG- M_mulatta300482 ----------------------ATCCA-GGCGATTCCCTCT-CCAAGGG- M_mulatta300716 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- M_murinus300343 ----------------------ATCCAAGGTGATTCCCTCT--TT--GA- M_murinus300351 -----------------------ATTAAAACTATCCACACT--TCAAGA- M_murinus300486 ----------------------ATCCAAGGTGATTCCCTCT-CCGAGGG- M_musculus300315 ----------------------GTCCAAGGTGATTCCCTCT-CCAATGG- M_musculus300401 ----------------------GTCCAAGGTGATTCCCTCT-CCAAAGG- M_musculus300411 ----------------------GTCCATGGTGATTCCCTCT-CCAAAGG- M_musculus300427 ---------------------------AGTCAATAAATAAATGTAATAG- M_musculus300494 ----------------------GTCCAAGGTGATTCCCTCT-CCAATTG- M_musculus300830 ----------------------GTCCAAGGTGATTCCCTCT-CCAATGG- M_musculus300934 ----------------------GTCCAAGGTGATTCCCTCT-CCAAAGG- M_lucifugus300674 ----------------------GACAAAGGTGATTCCCTCT-CCAAGGG- M_lucifugus300237 ACCCAAGGATCAAATTCCTAATATCAGTTTGAGTAACTGATACCAAAGTC M_lucifugus300669 ----------------------AACCAAGGTGATTCCCTCT-CCAAGGG- O_anatinus303341 ----------------------GGCCAAGGAGATTCCCTCT-CCC-GGG- O_cuniculus300012 ----------------------ATCCAAGTTGATTCCCTTT-CCCAGGG- O_cuniculus300256 -----------------------------------------------GTA O_cuniculus300516 ----------------------ATCCAAGGTGATTCCCTCT-CCCAGGG- O_garnettii300316 ----------------------GTTATAGATGAGTTCCTCT--CCAAGG- O_garnettii300521 ----------------------ATCCAAAGTGATTCGCTCA--CCCAGG- P_troglodytes300063 ----------------------ATCCAAGGCGATTCCCTCT-CCAAGAA- P_troglodytes300076 ----------------------ATCCAAGGTGAGTCTCTCT--CCAAGG- P_troglodytes300139 -------------------------AGGTCTGATATCCAACATCTATA-- P_troglodytes300360 ----------------------ATCCAAGGGGATTCCCTCT-CCAAGGG- P_troglodytes300366 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- P_troglodytes300367 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- P_troglodytes300583 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- P_pygmaeus300006 ----------------------ATCCAAGGTGAGTCTCTCT--CCAAGG- P_pygmaeus300020 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- P_pygmaeus300021 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- P_pygmaeus300140 ----------------------ATCCAAGGGGAGTCCCTCT-CCAAGGG- P_pygmaeus300208 ----------------------ATCCAAGGCGATTCCCTCT-CCAAGGG- P_pygmaeus300770 ----------------------ATCCAAGGTGATTCCCTCT-CCAAGGG- R_norvegicus300443 -------------------------TTGTAAGAGTTATAGG-ATAAAGG- R_norvegicus300523 -------------------------------------------------- R_norvegicus300524 ----------------------GTCCAAGGTGATTCTCTCT-CCAAAGG- R_norvegicus301016 ----------------------GCCGAAGGTGATTCCCTCT-CCAGAG-- R_norvegicus301024 ----------------------GTCCAAGGTGATTCCCTCT-CCAAAGG- R_norvegicus300024 ----------------------GTCCAAGGTGATTCCCTCT-CCAAAGG- R_norvegicus300195 ----------------------GGTCAAGGTGAGTTCCTCT-TCAAGGG- R_norvegicus300200 ----------------------GTCCAAGGTGATTCCCTCT-CCAAAGG- R_norvegicus301046 ----------------------GCCCAAGGTGATTCCCTCT-CCAAAGG- S_araneus300897 ----------------------ATCCAAGGTGATTCCCTCT-CCTAGGG- S_tridecemlineatus300180 ------------------------GTAAGTAAACAAATATTTACAAAACA S_tridecemlineatus300030 ----------------------TTATTAGGTGATTTCCTCT-CCATAGG- S_tridecemlineatus300114 ----------------------ATTCAAGGTGATTTCCTCT-CCAAGGG- T_belangeri300023 ----------------------ACCCCAGGTGACTTCCACT-CCCATAG- T_belangeri300125 ---------------------------------------AT--CCAAGT- C_familiaris300122 --GCCTGCTTG-TGCCCATC----TTCAGAAAAGTAGCAACTTGGAATAA C_familiaris300137 CTTCATGTTACTTTTCCTCTT-----CAGGAAAGTAACAACTTAGAATAA C_familiaris300340 --GCTTGCTTG-TGCCCC-C----CTCAGGAAAGTAGCAACTTGGAATAA C_porcellus300435 --GCCAAAAA-GTGCCCTTTT-----CAGGGAAGTAGCAACGTGGAAGAA C_porcellus300523 --ACCAAAAA-ATGCCCCTTT-----CAGGAAAGTAGCAACGTGGAAGAA C_porcellus300864 --GCCAGTCA-GTGCCCCTTT-----CAGGAAAGTAGCAACTTGGAAGAA D_novemcinctus300217 --GGTCACCTAGTGCCC-TC-----TCAGCAAAGTAGCAACTTGGAATAA D_novemcinctus300258 TAT-GTGAAGGTGATCCCTCT-----CAGGAAAGTGACAACTTGGAGTAA D_novemcinctus300366 --GGCCACCTAATGCCCCTC-----TCAGGAAAGTAGCAATGTGGAATAA D_novemcinctus300414 --GGACAACTAATGCCCCTC-----TCAGGAAAGTAGCAACTTGGAATAA D_novemcinctus300449 --GGC-ACCTAATGCCCCTC-----TCAGAAAACTAGCAACTTGGAATAA D_novemcinctus300462 --GGCCACCTAATGCCCCTC-----TCAAGAAAGTAGCAACTTGGAATAA E_telfairi300061 --GACCAACTAGTGCCCCTCT-----CAGGAAAGTAGCAGCTTGGAATAG E_telfairi300343 ATGCCCAACTAGTGCCCCTCT-----CAGGAAAATAGCAGCT-AGAATAG E_telfairi300586 --GACCATCTAGTGCCCCTCT-----CAGGAAAGTAGCAGCTTGGGATAG E_caballus300136 --GGCCAACTAGTGACCCCCAACCCCCGGAAACATAGCAACTTGGAGTAA E_caballus300345 --GCCTACTAA-TGCCCTTT----TTCAGGAAAGTAGCAACTTGGAATAA E_europaeus300157 --GGCTATTGGGTGCCCCTC----TTCAGGAAAGTAGCAACTTGGAATAA E_europaeus300635 --GGCTATTGG-TGCCCCTC----TTCAGGAAAGTAGCAACTTGGAATAA F_catus300085 --GTCTGCTCA-TGTCCCTC----TTCAGGAAATTAGTAACGTGGAAAAA F_catus300129 -------CTTCATGCCCCTCT----TCAGGAAAGTAGCAACTTGGAATAA H_sapiens300701 --GA-CATC-AGTGCC--TCT-----CAGGAAAGTAGCAGCTTGGAATAG L_africana300504 --GCCCAGCTAGTGCCCCTC-----TCAGGAAAGTAGCAACTTGGAATAA M_mulatta300130 --AA-CATGCAGTACCCCTCT-----CAGGAAAGTACTAACTTAGAATAG M_mulatta300275 --GGCTGACTAGTGCCCCTCT-----TAGGACAGTAGCAAGTTGGAATAA M_mulatta300482 --GA-CATACAGTGCCCCTCT-----CAGGAAAGTAGCAACTTGGAATAT M_mulatta300716 --GA-CATCCAGTGCCCCTCT-----CAGGAAAGTAGCAGCTTGGAATAG M_murinus300343 --GGCCAACTAGTGCCCCTCT-----CAGGAAAGTAGCAAATTAGAATTA M_murinus300351 --GGCCAGCTAGTGCCTTTCT-----TAGGAAAGCAGCAACTTGGACTAA M_murinus300486 --GC-CAGCTAGTGCCCGCCT-----CAGGAAAGTAGCAACTTGGAATAA M_musculus300315 --TCTGAGTATGTGCCTTTTT-----CAGGAATGTAGCAAGTTGGAAGAA M_musculus300401 --GCTGACTGTGTGCCACTTT-----CAGGAAC--AGCAATTTGGAAGAA M_musculus300411 --ACTGATTGTGTGCCCTTTT-----CAGAAACGTAGCAACTTGGAAGAC M_musculus300427 ---ATGGTTTAAAATACTTTT--------TAAGATAGCAACTTGGAAGAA M_musculus300494 --TCTGAGTATGTGCCTTTTT-----CAGGAATGTAGCAAGTTGGAAGAA M_musculus300830 --TCTGAGTATGTGCCTTTTTT----CAGGAATGTAGCAAGTTGGAAGAA M_musculus300934 --GCTGACTGTGTGCCCTTTT-----CAGGAACGTAGCAACTTGGAAGAA M_lucifugus300674 --GCCTAATA-GTCCTCTTCT-----CAGGATAGGGGCAACATGGAATAA M_lucifugus300237 --TTCATATTTATAAAACGCT----TCAGGAAAGTAGCAACTTGGAATAG M_lucifugus300669 --GACTAATAG-TGCCCCTC----TTCCGGAAAGTAGCAACTTGGAATAG O_anatinus303341 --GGCCGCGCCGTGCCCCTT-----CT-GGAACGTAGCTCCTTGG--TAG O_cuniculus300012 --GCCTGACTAGTGCCTCTCT-----CAGGAAAGTAGCAACTTGGAAGAA O_cuniculus300256 CAAGGTGATTGGGGCCTTTTT-----CAGGAAAGTAGCAACTTGGAAGAA O_cuniculus300516 --GCCCGACTAGTGCCTCTCT-----CAGGAAAGTAGCAACTTGGAAGAA O_garnettii300316 --GGCCAACTGGTACCCCTCT-----TAGGAAAGCGGCAGCTTGGAATTC O_garnettii300521 --GGCCAACTGGTGCCACTCC-----CAGGAAAGTAGCAAATCAGAACTA P_troglodytes300063 --GA-CATCTAGTGCCCCTCT-----CCGGAAAGTAGCAACTTGGAATAG P_troglodytes300076 --GGCTGACTAGTGCCTCTCT-----TAGGACAGTAGCAAGTTGGAATAA P_troglodytes300139 ---AGGAACTTAAACAAATTT----ACAAGAGAAAAGCAACCCC-ATTAA P_troglodytes300360 --AA-CATGCAGTGCCCCTCT-----CAGAAAAGTAGCAACCTGGAATAG P_troglodytes300366 --GGACATCCAGTGCCCCTC-----TC-AGGAAGTAGCAACTTGGAATAG P_troglodytes300367 --GAACATCCAGTGCCCCTCT-----CAGGAAAGTAGCAACCCGGAATAG P_troglodytes300583 --GA-CATC-AGTGCC--TCT-----CAGGAAAGTAGCAGCTTGGAATAG P_pygmaeus300006 --GGCTGACTGGTGCCCCTCT-----TAGGACAGTAGCAAGTTGGAATAA P_pygmaeus300020 --GAACATCCAGTGCCCCTCT-----CAGGAAAGTAGCAACCTGGAATAG P_pygmaeus300021 --GGACATCCAGTGCCCCTC-----TC-AGGAAGTAGTAACTTGGAATAG P_pygmaeus300140 --AA-TATGCAGTGCCCCTCT-----CAGGAAAGTAGCAACCTGGAATAG P_pygmaeus300208 --GA-CATCCAGTGCCCCTCT-----CAGGAAAGTAGCAACTTGGAATAG P_pygmaeus300770 --GA-CATC-AGTGCC--TCT-----CAGGAAAGTAGCAGCTTGGAATAG R_norvegicus300443 --GCTGACTGTGTGCCCTTTT-----CAGGGACGTAGCAACTTGGAAGAA R_norvegicus300523 -AATCAGGAAGATGTAGCTAAG----CTAAGAGCAAGCCATCTGGTATAA R_norvegicus300524 --GATGATGGTGTGTCCCTTT-----CAGGATTATAGCAAGTTGGAGAAA R_norvegicus301016 ---CTGACCATGTGCCCTTTT-----CAGGAATGTAGCACCTTGGAAGAA R_norvegicus301024 --GCTGACTGTGTGCCCTTTT-----CAGGGACGTAGCAACTTGGAAGAA R_norvegicus300024 --ACTGACTGTGTGCCCTTCT-----CAGGGACGTAGCAACTTGGAAGAA R_norvegicus300195 --GCTAACTA-CTGCCCTTCT-----CAGGAACACGGCAACTTGGAAGAA R_norvegicus300200 --GCTGACTGTGTGCCCTTTT-----CAGGAATGTAGAAACTTGGAAGAA R_norvegicus301046 --GCTGACTATGTGCCCTTTT-----TAGGAACGTAGCAACTTGGAAGAA S_araneus300897 --GCTTGTTTG-TGCTCCTC----CTTAGGAACGTAGCAACTTGGAATAA S_tridecemlineatus300180 CAA-G-AAAGGTG-TCTCTCT-----CAGGAAAGTAGCAACTCAGAAGAA S_tridecemlineatus300030 --GCCAACTA-GTGCCTCTCT-----TAGGAAAGTAGCAATTTGGAAGAA S_tridecemlineatus300114 --CCAAATGA-GAGCCTCTCT-----CAGGAAAGTAGGAACTTGGAGGAA T_belangeri300023 --GTC-AAGCAGTTCCCCTCT-----CTGGAAAGTAGCAACTTGCAATAA T_belangeri300125 --GGCC--CTCTCGCCCTCTC-----AGGGCAAGTAGCAACTTGGAATAA C_familiaris300122 ---AATCTGGAATGCTTTAGGTTGT-TGGAGGAGAGGAGA---------- C_familiaris300137 ---AATCTGGCATGCCTTCAGTTGC--TGGCGGGGAGGAG---------- C_familiaris300340 ---AATGTGACATGCCTCAGGGTGC-TGG--GAAGAGGGG---------- C_porcellus300435 ---AATCTGGTAT-CCTGAGGTCAC-T-GAGTGAAAGATG---------- C_porcellus300523 ---AATCTGATAT-TCTGAGATCAC-T-GAGTGAAAGAGG---------- C_porcellus300864 ---AATCTGGCATGCCTGAGGTC-----GGGGGACAGGGG---------- D_novemcinctus300217 ---AATCTGACAAGCTCAAGATCTT-TAGG-AGAGAGGGA---------- D_novemcinctus300258 ---AATCTGGCAAGCCCAGAATCTC--CAGGAGAGAGGGG---------- D_novemcinctus300366 ---AATCTGGCAAGCCCAAGGTTTT-CCGATAGAGAGGGC---------- D_novemcinctus300414 ---AATCTGGCAAGCCCAAGGTCTT-CCAGAG-AGAGGGG---------- D_novemcinctus300449 ---AATCTGGCAAGCCCAAGGTTTT-CCGG-AGAGAGGGG---------- D_novemcinctus300462 ---AACCTGGCAAGCCCAGGGTTTT-CCAG-AGAGAGGGG---------- E_telfairi300061 ---AA-ATGGGCTGCCCAAGATGTCTTTGGGTGAAAGGAA---------- E_telfairi300343 ---AATATGGCCTGCCCAAGATGTCCTTGGGTGAAAAGAA---------- E_telfairi300586 ---AATATGGCCTGCCCGTCATGTCCTTGGGTGAAAGGAA---------- E_caballus300136 ---ATC-TGGCATGCCCAAGGTCTG-TGGGGGTAAGGGG----------- E_caballus300345 ---AATCTGGCATGCCTCAGGTTTT-CGGGGGAGAGGGGA---------- E_europaeus300157 TAAAATCTGGCATGCTTCAGGACTC-CGGA-GAAGAGAGG---------- E_europaeus300635 TAAAATCTGGCATGCTTCAGGACTC-CGGA-GAAGAGAGG---------- F_catus300085 ---AATCTGACATGTCTTAGGTTGT-TGGAGGGAAGGGGA---------- F_catus300129 ---AATCTGGCACACCTTAGGTTGC--TGGGTAAGAGGGG---------- H_sapiens300701 ---AATCTGGCATGCCTAAGGCCT--TTGGGGAACTGGGA---------- L_africana300504 ---AATCGGGCATGCCCCAGGGTCT-TCCGGGGAGAAGGG---------- M_mulatta300130 ---AATCTAGCATGTCTAAGGTCT--TTGGGGAACAGGGG---------- M_mulatta300275 ---AGTTGGGCATGCCTAAGGTCTTTAAGGAACAGGGGA----------- M_mulatta300482 ---AATCTGGCATGCCTAAGGTCT--TTGAGGAACAGGGA---------- M_mulatta300716 ---AATCTGGCATGCCTAAGGCCT--TTGGGGAACAGGGA---------- M_murinus300343 ---AATATAGCATGACTAAGGTCTTTGAGGGACAGGGGT----------- M_murinus300351 ---AATTGGGCATGCCTAACGTCTT--TGGAGGACAGGGG---------- M_murinus300486 ---AATCAGGCATGCCTAAGGTCTCTTTGGGGGACAGAGG---------- M_musculus300315 ---AACCAGGCATGTCTGAGGTCTC-T-GCTGATCAAGGA---------- M_musculus300401 ---AGCCAGGCATGCCTGAGGTCTT-T-GATGAACAAGGA---------- M_musculus300411 ---AGCCAGGCATGCCCAAAGTCTC-T-GGTGAACAAGGA---------- M_musculus300427 ---AGCCAGGCATGCCCAGGGTCTC--TGCTGAATAAGGA---------- M_musculus300494 ---AACCAGGCATGTCTGAGGTCTC-T-GCTGATCAAGGA---------- M_musculus300830 ---AACCAGGCATGTCTGAGGTCTC-T-GCTGATCAAGGA---------- M_musculus300934 ---AACCAGGCGTGCCTGAGGTCTC-T-GGTGGACAAGAA---------- M_lucifugus300674 ---AATCTGGCCTGCCTCAGGTCTT-CAGAGAAGAAGGCG---------- M_lucifugus300237 ---AATCTGGCATGCCTCAGGTTTT--CAGGGGA-GGTGA---------- M_lucifugus300669 ---AATCTGGCATGCCTCAGGTTTT-CAGGGGAGGTGATA---------- O_anatinus303341 ---AGC------AGCGAGCGGGCTC-ATGGGGGAAAGGGC---------- O_cuniculus300012 ---AATCCGGCATGCCCAAATGCTC-TAGGAGACAAGGGG---------- O_cuniculus300256 ---AATCCAGCATACCCAAGGGCTC--TAGGGAACAAAGG---------- O_cuniculus300516 ---AATCTGGCATGCCCAAGGGCTC-TCAGAG-CAAGGGG---------- O_garnettii300316 ---AATCTGGCCTGACTAAGGTCTCTTAGGGACAGGGGA----------- O_garnettii300521 ---AAATTGGCATGACTAAGGT-TTTGAGGGACGGGGATGCTTACTGGGG P_troglodytes300063 ---AATCTGGCATGCCTAAGGTCT--TTGAGGAACAGGGA---------- P_troglodytes300076 ---AATCTGGCATGCCTAAGGTCTTTAAGGAACAGGGGA----------- P_troglodytes300139 ---AAAGTGGGCAAAGTAAGGTCTT--TGGGGAACAGGGA---------- P_troglodytes300360 ---AATCTGGCATGCCTAAGGTCT--TTGAGGAATAGAGGAATAGAGG-- P_troglodytes300366 ---AAT------AGTCCAGGAGTTC-CAGGACCAGCCTGG---------- P_troglodytes300367 ---AATCTGGCATGCCTAAGGCAT--TTGGGGAACAGGGC---------- P_troglodytes300583 ---AATCTGGCATGCCTAAGGCCT--TTGGGGAACTGGGA---------- P_pygmaeus300006 ---AATCTGGCATGCCTAAGGTCTTTAAGGAACAGGGGA----------- P_pygmaeus300020 ---AATCTGGCATGCCTAAGGCAT--TTGGGGAACAGGGC---------- P_pygmaeus300021 ---AAT------AGTCCAGGAGTTC-CAGGACCAGCCTGG---------- P_pygmaeus300140 ---AATCTGGCATGCCTGAAGTCT--TTGAGGAGTAGAGG---------- P_pygmaeus300208 ---AATCTGGCATGCCTAAGGTCT--TTGAGGAACAGGGA---------- P_pygmaeus300770 ---AATCTGGCATGCCTAAGGCCT--TTGGGGAACTGGGA---------- R_norvegicus300443 ---AGCCAGGCATGCCCAAGGTCTC-T-GGTGAACAGGGA---------- R_norvegicus300523 ---CACTTTACATGTGTTAAAGAAA-CAGGTTCAAAAGGA---------- R_norvegicus300524 ---G---------GCCTGAGGTCAC-T-GGTGAACGAGGA---------- R_norvegicus301016 ---AGCCAGGCATGCCCAAGGTCTC-T-GTG-AACAAGGA---------- R_norvegicus301024 ---AGCCAGGCATGCCCAAGGTCTC-T-GGTGAACAGGGA---------- R_norvegicus300024 ---AGCCATGCATGCCCAAGGTCTC-T-GGTGGACAAGGA---------- R_norvegicus300195 ---AAGCTG-CATGCCTCAGGTCTT-T-GTGGAGCAAGCG---------- R_norvegicus300200 ---AGCCAGGCATGCCCAAGGTCT-----GGGAACAAGGA---------- R_norvegicus301046 ---AGCCAGGCATGTCCAAGGTCTC-T-GGGGAACAAGGA---------- S_araneus300897 ---AATCTGGCAAGCCTCAGGTCTT-TGTGGGAGAGGGGA---------- S_tridecemlineatus300180 ---AACCTGGCTTACCTAAGGTCTT--TGGGAGACAGAGG---------- S_tridecemlineatus300030 ---AACCTGGCATGCTTAAGATCTT-TGGGA-AACAGAGG---------- S_tridecemlineatus300114 ---AATCTGGCATGCCTAAGGTCTT-TGGGGGAACTGAAG---------- T_belangeri300023 ---AATCTGGCAGGCT-AAAGGTTT-CTAGGGTTCAGGAG---------- T_belangeri300125 ---AATCCAGCTTGCCTGAAGTCTC--TGGGGGCCAGGGG---------- C_familiaris300122 GTGTTTGTTTCCTTTGCC--TTCC-TTTGGCTACCTA-CACAT C_familiaris300137 ATTTCTG-TTTCCTTGGC--CTCCCTTTGGCTGCCGA-AACGC C_familiaris300340 CTGCT-GTTTCCTTTGCC--TTCCCTTTGGCTGCCTA-CACAC C_porcellus300435 ATGTT-G-TTTCATTTAC--CTTTCTTTAGATCCCTA-CAGGT C_porcellus300523 ATGTTTG-TTTCATTTAC--TTTTCTTTGGCTCCCTA-CAGGT C_porcellus300864 ATTCTTG-TTTCCTTTAC--CTTCCTTTGGCTGCCTA-CAGGT D_novemcinctus300217 ATGTT--TTTCCTTTTGC--TTTCCTTTGACTACCCA-CATAA D_novemcinctus300258 GTGCTT--TTCCTTTTTC--CTTCCTTTGGCTGCCTA-TATGC D_novemcinctus300366 ATGTT--TTTCCTTTTGC--CTTCCTTTGGCTGCCTA-CATAC D_novemcinctus300414 ATAAC-ATAGACTAATGT--GACAAATTGC------------- D_novemcinctus300449 ATGAT--TTTCTTTTTGC--CTTCCTTTGGCTGCCTA-CATAC D_novemcinctus300462 ATGAT--TTTCCTTTTGC--CTTCCTTTGGCTGCCTA-CATGC E_telfairi300061 -TGTTCATCTCCTTTGGCAGCCTACATAG-------------- E_telfairi300343 -TGCTCTTCTCCTTTTGC--CCTCCTTTGGCATCCTA-CATAG E_telfairi300586 -TGCTCTTCTCCTTTTG---CCTACATAGATTAAATA-AATAA E_caballus300136 ---AT-GTTTCCTTTGAC--CTTTGACCTCTCCTCTA-C---- E_caballus300345 -TGTTTATTTCCTTTGCC--TTCC-TTTGGCTGCCTA-CATAT E_europaeus300157 CTGCT-----GCTTTTCC--TTCC-TTTGGCTGCCAA-CATGT E_europaeus300635 CTGCT-----GCTTTTCC--TTCC-TTTGGCTGCCAA-CATGT F_catus300085 -TGTTTGTTTCCTTTGCC--TTCC-TTTGGCTGCCTA-CACGT F_catus300129 ATGTTTG-TTTCCTTTGC--CTTCCCGTGGCTGCCTAGCACA- H_sapiens300701 -TGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCCA-CATGG L_africana300504 GATGT-GTTTCCTTTTGC--CTCCATTTGGCTGCCTA-CATAG M_mulatta300130 ATGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG M_mulatta300275 -TGCTTA-CTTCCTTTGC--ATTCCTTTGGCCACTTA-CATAG M_mulatta300482 -TGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG M_mulatta300716 -TGCTTA-TTTCCTCCGC--CTTCC-TTGGCTGCCTA-CATGG M_murinus300343 -TGCTTA-CTTATTTTGC--CTTTCTTTGTTTGCCTG-CATGT M_murinus300351 ATGCTTA-CTTCCTCTGC--CTTCCCTTGGCTGCCTA-CATGT M_murinus300486 ATGCTTG-TTTCCTTTGC--CTTCCCTTGGCTGCCTA-CATGT M_musculus300315 ACACTTG-TTTCCTTAGC--CCTCCTCTGGCTGCCTA-CATGT M_musculus300401 ATACTTG-TTTCCTTTGC--CCTCCTCTGGCTGCCTA-CATGT M_musculus300411 ATTCTTG-TTTC------------CTTTGGCTGCCTA-CATAT M_musculus300427 ATACTTG-TTTCCTTTGT--CTTCCTGAGGCTGCCTA-CATGT M_musculus300494 ACACTTG-TTTCCTTAGC--CCTCCTCTGGCTGCCTA-CATGT M_musculus300830 ACACTTG-TTTCCTTAGC--CCTCCTCTGGCTGCCTA-CATGT M_musculus300934 ACTCTTG-TTTCCTTTGC--CCTCCTCTGGCTGCCTA-CATGT M_lucifugus300674 ATGCATAATTTCCATTGC--CTTTCTTTGGCTGTCTA-CATGT M_lucifugus300237 -TACATCATTTCCTTGGC--CTTCCTTTGGCTGCCTA-CATGT M_lucifugus300669 -CACC-ATTTCCTTGGCC--TGCC-TTTGGCTGCCTA-CATGT O_anatinus303341 CTGAT-GTCGCCCCTCCC--CGTCATTCACGCCCCCA-CATGC O_cuniculus300012 ATGCTTG-CTTCTTTTGC--CTGCTTTGGACTGCCTA-CATGT O_cuniculus300256 AATGTTTGCTTCTTT-GC--CTTCCTTGGGCTGCCTA-CATGT O_cuniculus300516 CCGCTTG-CTTCCTTTGC--CTGCCTTGGGCTGCCTA-CATGC O_garnettii300316 -TGCTGC-TTTATTTTGT--CTTCCTGGGGCTGCCTA-CATGT O_garnettii300521 ATGCTTA-TTCATTTTGT--CTCCCTTTGCCTGTCTG-AGTCT P_troglodytes300063 -TGCTTA-TTTCCTCCGC--CTTCC-TTGGCTGCCTA-CATAG P_troglodytes300076 -TGCTTA-CTTCTTTTGC--GTTCCTTTGGCGGCCTA-CATAG P_troglodytes300139 -TGC-TTATTTCCTCTGC--CTTCCTT-GTCTGCCTA-CACGG P_troglodytes300360 ATGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG P_troglodytes300366 CCAAT-ATGGCGAAACCC--CATCTATACTAGAAATA-CAAAA P_troglodytes300367 -TGGTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG P_troglodytes300583 -TGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCCA-CATGG P_pygmaeus300006 -TGCTTA-CTTCTTTTGC--GTTCCTTTGGCGGCCTA-CATAG P_pygmaeus300020 -TGGTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG P_pygmaeus300021 GCAAT-ATGGCAAAACCC--CATCT------------------ P_pygmaeus300140 ATGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG P_pygmaeus300208 -TGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCTA-CATGG P_pygmaeus300770 -TGCTTA-TTTCCTCTGC--CTTCC-TTGGCTGCCCA-CATGG R_norvegicus300443 ATACTTG-TTTCCTTTGC--CTTCCTTTGGCTGCCCA-CATAT R_norvegicus300523 ATACTTG-TTTCCTTTGC--CCTCCTTTGGCAGCCTA-CATAT R_norvegicus300524 ATACTTG-TTTCCTTTGC--CTTCCTTTGGCTGCCTT-CATGT R_norvegicus301016 ATACTTG-TTTCCTTTGC--CTTCCTTTGGCTGCCTA-CATAA R_norvegicus301024 ATACTTG-TTTCCTTTGC--CTTCCTTTGGCTGCCCA-CATAT R_norvegicus300024 ATACCTG-TTTCCTTTGC--CTTCCTTTGGCTGCCTA-CATAT R_norvegicus300195 ATGCTTA-------------TTTCCTTTGGCTGCCTA-CAGGT R_norvegicus300200 ATACTTC-TTTC------------CTTTGGCTGCCCA-CATAC R_norvegicus301046 ATACTTG-TTTCCTTTGC--CCTCCTTTGGCAGCCTA-CATAT S_araneus300897 -TGTTTATTTCCTCTACC--TGCC-TTTGGCTGCCTA-CATGC S_tridecemlineatus300180 ATACTTAACTTCTTTTGC--TTCCCTTTGGCTGCAAA-CATGC S_tridecemlineatus300030 ATACTTGATTTCTCTTGC--ATTTCTTTGACTGCCTA-CATGT S_tridecemlineatus300114 ACATGTAACTTCTTTTGC--CTTTCTTTGGCTGCTTA-CATAT T_belangeri300023 ACGCTTA-TTTCCATTGC--CT-TCTTGGGTTGCTTA-CATGT T_belangeri300125 ATGCTGA-TTTCCTTTGC--CTTCCTTTGGCTGCCTA-TATGT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved