snOPY snoRNA Orthological Gene Database

Family: SNORA65

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300185 -----------------------------------------------TGTCCGATGCCAC A_thaliana300186 -----------------------------------------------TGTCCGATGCCAC A_thaliana300187 ----------------------------------------------TTGTCTGATGCCAC C_elegans300109 --------------------------------------------TTATGGCGGATAGGAA C_familiaris300272 -------------------------------------CCCGCCACTGCACCTGATCAGT- C_familiaris300328 -------------------------------------CCCGCCACTGCACCTGATCAGT- D_rerio300169 -------------------------------------CCCGCCACTGTGCTAGTCT---- D_rerio300210 -------------------------------------CCCGCCACTGTGCTTGTCT---- D_rerio300211 -------------------------------------CCCGCCACTGTGCTTGTCT---- D_novemcinctus300179 -------------------------------------CCCACCACCGCCCCCGACCAGT- D_novemcinctus300202 -------------------------------------CCTGCCACTGCACCTGACCAGT- D_novemcinctus300446 -------------------------------------CCTGCCACTGCACCTGAAAAGT- D_novemcinctus300483 -------------------------------------CCTGCCACTGCACCTGACCAGT- D_novemcinctus300552 -------------------------------------CCCGCCACTGCACCTGACCAGT- D_melanogaster300023 ---------------------------------ATTCCCCTTCATTTTCCGCCACGCGTT E_telfairi300010 -------------------------------------TCCACCACTGCACCTGACC-AT- E_telfairi300174 -------------------------------------CCCACCACTGCACCTGACC-AT- E_telfairi300216 ------------------------------------------------------CC-AT- E_telfairi300357 -------------------------------------CCCGCCACTTCACCTGACC-CT- E_telfairi300454 -------------------------------------CCCGCCACTGCACCTGACC-CT- E_telfairi300520 -------------------------------------ACCGCCACGGCCCCTGGCCATT- E_telfairi300534 -------------------------------------CCCGTCATTGAACCTGACC-AT- E_telfairi300562 ---------------------------------------------AGTTTCTGACAGCA- E_telfairi300706 -------------------------------------CCCGCCACTGCACCCGACC-AT- E_caballus300261 -------------------------------------CCCGCCACTGCACCTGACCAGT- E_europaeus300175 ------------------------------------------AAATATATTTTGCTAGT- F_catus300200 -------------------------------------CCCGCCACTGCACCTGATCAGT- H_sapiens300577 ------------------------------TCAGCCACCCGCCACTGCACCTGACCAGG- L_africana300053 -------------------------------------CCCGCCACTGCACCTGATCAGT- L_africana300517 -------------------------------------CCCGCCACTGCACCTGATCAGT- M_mulatta300679 -------------------------------------CCCGCCACTGCACCTGACCAGG- M_murinus300484 -------------------------------------CCCGCCACTGCACCT-ACCAGT- M_domestica300121 -------------------------------------CCCGCCACTGCACCTGTATCCAG M_musculus300001 -------------------------------------CCCGCCACTGCACCTGACCAGT- M_musculus300294 -------------------------------------AAAGCCACTGCACCTGACCAGT- M_musculus300367 ------------------------------------------------------------ M_musculus300408 -------------------------------------CCCACCACTG-ACCTGACCAGT- M_musculus300557 -------------------------------------CCCGCCACTGCACCTGACCAGT- M_musculus300973 -------------------------------------CCCGCCACTGCACCTGACCAGT- O_anatinus303135 -------------------------------------CCCGCCACTGTGCCTAATCACT- O_anatinus303528 -------------------------------------ACCGCCACTATACCTGTCTTAA- O_anatinus303529 -------------------------------------CCCGCCACTGTGCCTAATCACT- O_cuniculus300260 -------------------------------------CCCACCACTGCGCCTGTCC---- O_cuniculus300458 -------------------------------------CCCGCCACTGCGCCTGCCC---- O_latipes300066 -------------------------------------CCCGCCACTGTACCAGTCT---- O_garnettii300634 -------------------------------------CCCGCCACTGCACCT-ACCAGT- P_troglodytes300574 -------------------------------------CCCGCCACTGCACCTGACCACG- R_norvegicus300940 -------------------------------------CCCGCCACTGCACCTGACCAGT- S_cerevisiae300041 GAATCAAAAATTTATTTTTTACACGGAAACGATGCCACAGTTGACTGAACCTGTCTTCTA S_araneus300748 ------------------------------------------------------------ S_araneus300942 -------------------------------------TCCGCCACTGCGCCTGCCACT-- T_nigroviridis300046 -------------------------------------CCCGCCACTACACCAGTCT---- T_nigroviridis300047 -------------------------------------CCCGCCACTACACCAGTCT---- T_belangeri300161 -------------------------------------CTCGCCACTGCACCTGACCAGC- T_belangeri300245 -------------------------------------CCCGCCACTGCACCTG-CCAGC- T_belangeri300317 -------------------------------------CCCGCCACTGCACCTG-CCAGC- A_thaliana300185 GTCGACGGTAGCT---------TTAGGGC-AAT---------GATCCT----CGATGCTA A_thaliana300186 GTCGACGGTAGCT---------TTAGGGC-AAT---------GATCCT----CGATGCTA A_thaliana300187 GTCGAAGGTAGCTC--TTTTTTTTGGGGC-AAT---------GATCCTAACTCGACGCTA C_elegans300109 CCAGGTCATGTTTGT-ACGTGATTTGGGCCGAC---------ATCCCCGCCGAAATAGTC C_familiaris300272 -TTTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA C_familiaris300328 -TTTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA D_rerio300169 -TTTAAAGTGACTCT-GTACAATCCAGT--GG----------AGGCT------CAGAGTG D_rerio300210 -GTAAGAGTGACTGT-GTACTGTCCAGA--GG----------AGGCT------CAGAGTG D_rerio300211 -GTAAGAGTGACCGT-GTACTGTCCAGA--GG----------AGGCT------CAGAGTG D_novemcinctus300179 -TCTCTGTTGGCTG--GAGCAGTCCAGC--TGT---------GAGCT------GAGAGTA D_novemcinctus300202 -TCTTTGTTGGCTG--GTGAAATCCAGT--GGT---------GAGAT------GATACTA D_novemcinctus300446 -TCTCTGTTGGCTG--TTGCAATCCAAT--GGT---------GAGCT------GATACTA D_novemcinctus300483 -TCTTTGTTGGCTG--GTGAAATCCAGT--GGT---------GAGAT------GATACTA D_novemcinctus300552 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATATTA D_melanogaster300023 GTTGTCCAAAATAATATGACAAATCATACGTGCCCATGTTCAAGGGGAACATTAAACAAA E_telfairi300010 -TCTCTGTTG-CTG--GTGCAATCCAGT--GGT---------GAGCT------GAGAGTA E_telfairi300174 -TCTCTGTTG-CTG--GTGCAATCCAAT--GGT---------GAGCT------GAGAGTA E_telfairi300216 -CCTCTGTTG-CTG--GTGCACTCCAGT--GGT---------GACCT------GAGAGTA E_telfairi300357 -TCTCTGTTGGCTG--GTGCAATCCAGT--GTT---------GAGCT------GAGAGTA E_telfairi300454 -TCTCTGTTGCCTG--GTGCACTCCAGT--GGG---------GAGCT------GAGAGTA E_telfairi300520 -TCTCTGTTGGCTG--CTGCAATCCAGT--GGT---------GAGTG------GAGAGTA E_telfairi300534 -TCTCTGTTGGCTG--GTGCAGCCCAGT--GGT---------GAGCT------GAGAATA E_telfairi300562 --TAGAGTTCTTTAT-AAATCTACTGTCA-GGT---------GAGCT------GAGAGTA E_telfairi300706 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GAGAGTA E_caballus300261 -TCTC--TTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA E_europaeus300175 ---TTTGTTGGCTG--GTGCGGTCAAGT--GGT---------GAGCT------GAGATCA F_catus300200 -TCTC--GTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA H_sapiens300577 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA L_africana300053 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA L_africana300517 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA M_mulatta300679 -TCTCTGTTGGCTG--GTGCAGTCCAGT--GGT---------GAGCT------GATAGTA M_murinus300484 -TC--TGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATACTA M_domestica300121 TATTATGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GAGAGAA M_musculus300001 -ATT--GTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GACAGTA M_musculus300294 -ATT--GTTGGCTG--GTGCAACACAGT--GGT---------GAGCT------GACAATA M_musculus300367 ----CTGAATACTGTAACGGTCCCCTTTA-AAA---------GAACGA-----GGACTCA M_musculus300408 -ATG--GTTGGCTG--GTACAATATAGT--AGT---------GAACT------GACAGTG M_musculus300557 -ATT--GTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GACAGTG M_musculus300973 -ATT--GTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GACAGTG O_anatinus303135 -AATAACGTTGGTGG-GCACAATCCAGT--GGT---------GAGCT------GATATAA O_anatinus303528 -ATCCAAGTGACTG--GTATTTACCAGT--GGT---------AGGCT------TAGAAGA O_anatinus303529 -AATAACGTTGGTGG-GCACAATCCAGT--GGT---------GAGCT------GATATAA O_cuniculus300260 -ATGCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCC------GAGAGGA O_cuniculus300458 -ATGCTGCTGGCTG--GCGCAATCCAGT--GGT---------GAGCT------GAGAGGA O_latipes300066 -GCCCC-GTGACACG-GTTCAGTCCAGT--GG----------AGGCT------AAGAGTA O_garnettii300634 -TT--TGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAATA P_troglodytes300574 -TCTCTGTTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GATAGTA R_norvegicus300940 -ATT--ATTGGCTG--GTGCAATCCAGT--GGT---------GAGCT------GACAGTA S_cerevisiae300041 ACAGTAGTTAATTGCCAGTATTTCAAACAAGATTTGAAATACGAGTTTCCCAGAATAATT S_araneus300748 ----CCTGCCACTA--GTGCAATCCAGT--GGT---------GAGTT------GAGACTA S_araneus300942 -GCTCTGTTGGCTG--GTGCATTCCAGT--GGT---------GAGCT------GAGACTA T_nigroviridis300046 -GCCAGGGTGACTGG-GTGTGCTCCAGT--GG----------AGGCT------CAGATTA T_nigroviridis300047 -GCCAGGGTGACTGG-GGGTGCTCCAGT--GG----------AGGCC------GAGACTG T_belangeri300161 -CCT--GTTGGCTG--ATGCAATTCAGT--GGT---------GCACTT-----GATAGCA T_belangeri300245 -TGT--GTTGGCTG--GTGCAATCCAGT--GGT---------GCGCT------GATAGTA T_belangeri300317 -TGT--GTTGGCTG--GTGCAATCCAGT--GGT---------GCGCT------GATAGTA A_thaliana300185 CATTGGACATA---AACAAATG--TACGTGTTTCGCTTACTGATAGGAACCTGTGGATCT A_thaliana300186 CATTGGACATA---AACAAATG--TACGTGTTTCGCTTACTGATAGGAACCTGTGGATCT A_thaliana300187 TATTAGACATA---AACAAATG--TACGTGTTTCGCTTACTGATAGGAACCTGTGGATCT C_elegans300109 CTGCGAAGATCT-AAGGTCGCT--TCTGGATGGATTTGCCACCGGGTGCACACCAT-CTT C_familiaris300272 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG C_familiaris300328 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG D_rerio300169 ACCC--AGCTC--TAGGAAG-----CAGGGCGGCCCAAACTAATGGGCAGCTCTGTGCCG D_rerio300210 ACCC--AGCTC--TAGGAAG-----CAGAACTGCCCAGTTTCATGGGTAACTCTGTGCCG D_rerio300211 ACCC--AGCTC--TAGGAAG-----CAGGACTGGTCAATTCAGTGACTAGCCCTGTGCCA D_novemcinctus300179 AAGCCAGGTT----AGGAAA-----CAGGGCTGTTCG-TCATGTGGGTGACTCTGTGCCG D_novemcinctus300202 AGCCCCAGCTT---AGGAAA-----CAGGCTTGTTCT-TCATGCAGATGATTCTGTGCTG D_novemcinctus300446 AACCCCAGCTT---AGGAAA-----GAAGGTTGTT---------GGGTGACTCTGTGCCA D_novemcinctus300483 AGCCCCAGCTT---AGGAAA-----CAGGCTTGTTCT-TCATGCAGATGATTCTGTGCTG D_novemcinctus300552 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATATGGATGACTCTGTGCCG D_melanogaster300023 ATTCTCTGATAAATAGGAAACTGATAAAAGTCGATTGAATTAATTCTAGACATCAGTGCC E_telfairi300010 AGCCCCTGCTC---AGGAAA-----CAGTGTTGTTCT-TCATGTGGATGACTCTG--CCG E_telfairi300174 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCTG E_telfairi300216 AACCCCCGCTT---AGGAAA-----TAGGGTTGTTCT-TCATGTGGATGACGCTGTGCCG E_telfairi300357 AACCCCAAATT---AGGAAA-----CAGGATTGTTCT-TCATGTGCATGACTCCATGCCA E_telfairi300454 AACCCCA-CTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGATTCTGTGCTG E_telfairi300520 AACCCCAGCTT---AGGAAA-----CAGAGCTGCTCT-TCATGTGGATGGCTCTGTGCTG E_telfairi300534 AAGTCAAGCTT---AGGAAA-----CGTGGTTGTTCT-TCACGTGGATGGCTCTGTGCTG E_telfairi300562 AACCCCAGCTT---AGGAAA-----CAGGGGTGTTCT-TCATGTGGATGACTCTGTGCCG E_telfairi300706 AACCCCAGCTT---AGGAAAA----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG E_caballus300261 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG E_europaeus300175 AAGCCCAGTTT---AGGAAA-----CAGGGTTGTTCT-CCATGTGGATAACTCTGTGCTG F_catus300200 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG H_sapiens300577 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG L_africana300053 AACCCCAGCTT---AGGAAA-----CAGAGTTGTTCT-TCATGTGGATGACTCTGTGCCG L_africana300517 AACCCCAGCTT---AGGAAA-----CAGAGTTGTTCT-TCATGTGGATGACTCTGTGCCG M_mulatta300679 AACCCCAGCTT---AGGAAA-----CAGGGTGGTTCT-TCATGTGGATGACTCTGTGCCG M_murinus300484 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG M_domestica300121 AAACCCAGCT---TAGGAAA-----CAGGGTTATTCTGCTT-GTGGATGACTCTGTGCCG M_musculus300001 AGCCCCAGCTTT-TAGGAAA-----CAGGGCTGTCCT-ACATGTGGATGGCTCTGTGCCG M_musculus300294 AGCCC-AGCTTT-TAGGAAA-----CAGGGCTGTCCT-ACATGTGGATGGCTCTGTGCCG M_musculus300367 GTGCTGAGCTGA-CAGGAAGCC--CCAGGGTTGTCCT-ACATGTGGGTGACTCTGTGCTG M_musculus300408 AGCCCCAGCTTT-CAGGGAA-----TGGGGCTGTCCT-ACATATGAATG--------TTG M_musculus300557 AGCCC-AGCTTT-TAGGAAA-----CAGGGCTGTCCT-ACATGTGGATGGCTCTGTGCCG M_musculus300973 AGCCCCAGCTTT-TAGGAAA-----CAGGGCTGTCCT-ACATGTGGATGGCTCTGTGCCG O_anatinus303135 AACCCCAGCT---TAGGAAA-----CAGGGTTATTCTGCTT-GTGGATGACTCTGTGCCG O_anatinus303528 ATCTCCAGCTG--TAGGAAG-----CAGGCCTCTCCTGGCTCATGGAGAGCTCTGTGCCG O_anatinus303529 AACCCCAGCT---TAGGAAA-----CAGGGTTATTCTGCTT-GTGGATGACTCTGTGCCG O_cuniculus300260 AGCCCCGGCT---TAGGAAA-----CAGGGTTGTTCT-CCACGTGGATGACTCTGTGCCG O_cuniculus300458 AGCCCCGGCT---TAGGAAA-----CAGGGTTGTCCT-CCACGTGGATGACTCTGTGCCG O_latipes300066 ACCCC-AGCTT--TAGGAAA-----CAGGGCTGCCCACATGGATGGGTGACTCTGTGCCG O_garnettii300634 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG P_troglodytes300574 AACCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGACGACTCTGTGCCG R_norvegicus300940 AGCCCCAGCTTT-TAGGAAA-----CAGGGTTGTCCT-ACATGTGGGTGACTCTGTGCCG S_cerevisiae300041 TATTTGGACAGGATAGGAAGTC--CGATTTCTGTGTTGTCTCAAACGAGGCGATAGAATT S_araneus300748 AACCCCAGTTT---AGGAAA-----CAGGGCTGTTCT-TCATA-GGATGGCTCTGTGCTG S_araneus300942 AACCCCAGCT---TAGGAAA-----CAGGGTTGTTCT-CCATGTGGATGACTCTGTGCCG T_nigroviridis300046 ACCC--GGCTT--TAGGAAA-----CAGGGCTGCCCGACCCGGTGGGCATCTCTGTGCCG T_nigroviridis300047 ACCC--GGCTT--TAGGAAA-----CAGGGCTGCCCGACCCGGTGGGCATCTCTGTGCCG T_belangeri300161 AACCCCAGTTT---ATAAAA-----CAGGGTTGTCCT-TCAAAGGGATGACTCTATGCCA T_belangeri300245 A-CCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG T_belangeri300317 A-CCCCAGCTT---AGGAAA-----CAGGGTTGTTCT-TCATGTGGATGACTCTGTGCCG * A_thaliana300185 TGAAT-TGATTTACGATCTACGGAGCCATTTCGGCGATTACATTT A_thaliana300186 TGAAT-TGATTTACGATCTACGGAGCCATTTCGGCGATTACATTT A_thaliana300187 T------GTTTTACGATCTACGGAGCCAT---AGCGATTACAATT C_elegans300109 CGTGCACAATT---------------------------------- C_familiaris300272 AAAGCATGGGA-ACAGCC--------------------------- C_familiaris300328 AAAGCATGGGA-ACAGCC--------------------------- D_rerio300169 AAAGACCTGGA-ACAAAC--------------------------- D_rerio300210 AAAGGTCTGGG-ACATGT--------------------------- D_rerio300211 AAAGGCCTGGA-ACATGG--------------------------- D_novemcinctus300179 AAAGCATGGGA-AGAGCC--------------------------- D_novemcinctus300202 AAAGCATGACA-ACAGCC--------------------------- D_novemcinctus300446 AAAGCAAAGGA-ACAGCC--------------------------- D_novemcinctus300483 AAAGCATGACA-ACAGCC--------------------------- D_novemcinctus300552 AAAGCATGGGA-ACAGCC--------------------------- D_melanogaster300023 AAGG-ACGAGAAACAATT--------------------------- E_telfairi300010 AAAGCATGGGG-ACAGTC--------------------------- E_telfairi300174 AAAGCATGGGG-ACAGTC--------------------------- E_telfairi300216 AAAGCATGGGG-ACAGTC--------------------------- E_telfairi300357 AAAGCATGGGG-ACAGTC--------------------------- E_telfairi300454 AAAAAAAAAAG--TT------------------------------ E_telfairi300520 AAACACGGGGC--CAGTC--------------------------- E_telfairi300534 AAAGCATGGGG-ACAGTC--------------------------- E_telfairi300562 AAAGCATGGGGGACAGTA--------------------------- E_telfairi300706 AAAGCATGGGGGACAGTC--------------------------- E_caballus300261 AAAGCATGGGA-ACAGCC--------------------------- E_europaeus300175 AAAACATGGAG-GCAATC--------------------------- F_catus300200 AAAGCATGGGA-ACAGCC--------------------------- H_sapiens300577 AAAGCATGGGA-ACAGCC--------------------------- L_africana300053 AAAGCATGGGA-ACAGCC--------------------------- L_africana300517 AAAGCATGGGA-ACAGCC--------------------------- M_mulatta300679 AAAGCATGGGA-ACAGCC--------------------------- M_murinus300484 AAAGCATGGGA-ACAGCC--------------------------- M_domestica300121 AAAGCTTGGGA-ACAAGG--------------------------- M_musculus300001 AAAGCATGGGA-ACAACC--------------------------- M_musculus300294 AAAGCATGGAA-ACAGCC--------------------------- M_musculus300367 AAAGCATGGGA-ACAGCC--------------------------- M_musculus300408 AAAGCATGGGA-ACACCC--------------------------- M_musculus300557 AAAGCGTGGGA-ACAGCC--------------------------- M_musculus300973 AAAGCATGGGA-ACAGCC--------------------------- O_anatinus303135 AAAGCATGGGA-ACAACC--------------------------- O_anatinus303528 AAAGGCTGGTA-ACACGA--------------------------- O_anatinus303529 AAAGCATGGGA-ACAACC--------------------------- O_cuniculus300260 AAAGCTCGGGA-ACAGCC--------------------------- O_cuniculus300458 AAAGCACGGGA-ACAGCC--------------------------- O_latipes300066 AAAAGTCTGGA-ACACGC--------------------------- O_garnettii300634 AAAGCATGGGA-ACAGCC--------------------------- P_troglodytes300574 AAAGCATGGGA-ACAGCC--------------------------- R_norvegicus300940 AAAGCGTGGGG-ACAGCC--------------------------- S_cerevisiae300041 GGGATGTCGAAGAAAGTCTACATTA-------------------- S_araneus300748 AAACCATGGGA-ATAGCC--------------------------- S_araneus300942 AGAGCATGGGA-ACAGCC--------------------------- T_nigroviridis300046 AAAAGTCTGGA-ACAGAC--------------------------- T_nigroviridis300047 AAAAGTCTGGA-ACATTT--------------------------- T_belangeri300161 AACACATGGGA-ACAGCA--------------------------- T_belangeri300245 AAAGCGTGGGA-ACAGCC--------------------------- T_belangeri300317 AAAGCGTGGGA-ACAGCC---------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved