snOPY snoRNA Orthological Gene Database

Family: SNORA64

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300120 ----------------------------TAATTATAGGCCAAGAAATTGT C_familiaris300390 -ACTCTCT-CAGCT-CTGCATG-----GTCATGCTTGCTG---------T C_familiaris300391 -CCTCTCT-CAGCT-CCGCTTA-----ATCACA----CTTA--------T C_porcellus300187 ------------------------GTACACATATTGATACATTTTGGAAA C_porcellus300858 -CCTCTCT-CAGCT-CCGCTGG-----ATCACACAAATGCA--------G C_porcellus300860 -ACTCTCT-CTACT-CTGCACG-----GTTACACTACTTA---------- D_novemcinctus300240 -ATTCTCT-CAGCT-CTGCAAA-----GTTATACCTGCAAGGTTAGACCT E_telfairi300096 -ACCCTCC-CCGCT-CTGCATG-----GTTACACCTGCCA---------C E_telfairi300590 -TCTCTCC-CTGCT-CTGCATG-----GTTGCACCTGCCA---------T E_telfairi300659 -GCTCTCC-CTGTT-CTGCATG-----GTTACACCTGCCA---------T E_caballus300382 -ACTCTCT-CAGCT-CTGCATG-----GTTACACTTGTTTG--------- E_caballus300383 -CCTCTCT-CAGCT-CCACTTA-----GTCACA----CTCA--------G F_catus300017 -CTTCTCT-CAGCT-CCGCTTA-----ATCATA----CTCG--------G F_catus300171 -CCTCTCT-CGACT-CCACTTC-----ATCATA----CTCA--------G H_sapiens300586 -ACTCTCT-CGGCT-CTGCATA-----GTTGCACTTGGCT---------T H_sapiens300605 -AGACTCC-CAGCT-CTGC-CCA----GTTACACTAGG-CT--------T M_mulatta300006 -ACTCTCT-CGGCT-CTGCGTA-----GTTGCACTTGGCT---------T M_mulatta300233 -CTTCCCT-CAGCT-CTGCATAATTAAGTTATACTTGGCT---------T M_mulatta300282 -GGCCTCT-CAGCT-CCGTTTA-----ATCACACAGGTCCA--------G M_mulatta300442 -AGACTCT-TAGCT-ATCCATA-----GTTACGCTTGGCC---------T M_mulatta300464 ACTCT-CT-TGGCT-CTGTATA-----GTTACACCTGGCT---------T M_mulatta300603 -AGACTCA-CAGCT-CTGC-CCA----GTTACACTAG--CT--------T M_mulatta300636 -GGTCTCT-CAGTT-CCGCTTA-----ACCACACGGGTCCG--------G M_murinus300000 -ACTCTCT-TAATT-CTGCATA-----GTCATACTTGGCT---------T M_murinus300026 -ACTCTCC-CAGCT-CTGC-GTG----GTTACACTAGG-CT--------T M_murinus300056 -GCTCTCT-GAGCT-CTGCATC-----GTTACACTTGGCT---------T M_murinus300113 --CTCTTCGCAGCT-CCGCAGTG----GTCACACTAGGGTT--------T M_murinus300163 ----------GAGTCACAAAGAAATGTATACCATTAAGCACACCAATATA M_murinus300467 -CTTCTCT-CAGCT-CCGCTTG-----ATCACACAGGCCTA--------G M_murinus300534 -ACTCTCT-CATTT-CTTCATA-----GTCGCACTTGTCT---------T M_murinus300549 -TCTCTCT-CTACT-CTGCAAA-----GTTACATTCAGCT---------T M_musculus300780 -ACCTCCC-CATGT-TCTGGCA-----ATCACACAGATCCA--------G M_musculus300914 -ACTCTCT-C-ACT-CTGCATG-----GTTACACAAGGTT---------T O_garnettii300048 -ACTCTCC-AAGCT-CTGCATG-----GTAAAACTTGGCT---------T O_garnettii300217 -ACCCTCC-CAGCT-CTGCATG-----GTCACACCTGGCT---------T O_garnettii300263 -ACTCTCT-CAGGT-CTGCAAA-----GTCACACTTGGTT---------T O_garnettii300291 --ATATTC-TACCTACTGCACG-----GTTACACTTGTCC---------T O_garnettii300310 -------------------------AAGTTGTCTTAAGAAATT------A O_garnettii300362 ---------TGATTTTTGACAA-----AGCAGATAAAAGC---------- O_garnettii300536 -GCTTCCC-CAGCT-CTGCATG-----GTTACACTTGTCT---------T O_garnettii300640 -TCTCTCT-CACCT-CTGAGTA-----GTTGCATTTGGCT---------T O_garnettii300733 -ATAATCC-CAGCT-CCGCCTG-----ATCACGTAGCCCCA--------G O_garnettii300752 -TCTCTCC-CAGCT-CCGCTTG-----ATCACACAGATACA--------G P_troglodytes300144 -GGTCTCT-CAGCT-CTGCTTA-----ACCACATGGGTCCA--------G P_troglodytes300197 -CCTCCCT-CAGCT-CTGCATAATTAAATTATACTTGGCT---------T P_troglodytes300276 ACTCT-CT-CAGCT-ATGTATA-----GTTACACCTGGCT---------T P_troglodytes300376 -GGCCTCT-CAGTT-CCGCTTA-----ATCACACAGGTCCA--------G P_troglodytes300623 -AGACTCC-CAGCT-CTGC-CCA----GTTACACTAGG-CT--------T P_troglodytes300684 -GGTCTCT-CAGCT-CCGCTTA-----ACCACACGGGTCCA--------G P_troglodytes300685 -ACTCTCT-CGGCT-CTGCATA-----GTTGCACTTGGCT---------T P_pygmaeus300120 -GGTCTCT-CAGCT-CTGCTTA-----ACCACATGGGTCCA--------G P_pygmaeus300214 -GGCCTCT-CAGCC-TCGCTTA-----ATCACACAGGTCCA--------T P_pygmaeus300361 -CCTCCCT-CAGCT-CTGCATAATTAAATTATACTTGGCT---------T P_pygmaeus300524 ACTCTTCT-TGGCT-GTCTATA-----GTTACACCTGGCT---------T P_pygmaeus300553 -ACTCTCT-CAGCT-CTGCATA-----GTTGCACTTGGCT---------T P_pygmaeus300724 -AGACTCC-CAGCT-CTGC-CCA----GTTACACTAGG-CT--------T P_pygmaeus300746 -GGTCTCT-CAGCT-CCGCTTA-----ACCACACGGGCCTA--------G P_pygmaeus300747 -ACTCTCT-CAGCT-CTGCATA-----GTTGCACTTGGCT---------T R_norvegicus300811 -ACTCTCT-C-ACT-CTGCATG-----GCTACACTACATGCAG------T R_norvegicus301040 -ACTCTCT-C-ACT-CTGCATG-----GTTACACTAGGCT---------T S_tridecemlineatus300316 -CCTCTCT-CAGCT-CCGCTGA-----ATCACACAGGTGCA--------G T_belangeri300042 -ACTCTCT-CAGCT-CTGCACA-----GTCACACTTGGTT---------T T_belangeri300087 -----------------GCACA-----GTCACACTTGGTT---------T T_belangeri300138 -CTCCTCT-CAGCT-CTGCACA-----GTCACACTTGGTT---------T C_familiaris300120 AAGAAAACAATAAAAACAAATGGGG----AGAGAGAAAGATGCT----CC C_familiaris300390 CACACG-CGTGGCTTTCGTAAAGGGGAG-AGAGAGAAAGGATCT----CC C_familiaris300391 TGTGTGCTT-GGCGTA-TTTTCAGAGAG-ATAGAGGAAGGCTCTC---CT C_porcellus300187 ACTGACTTACTGCTGAAGT-TCATAAAA-TGGGTGTGCGGCCCTC---CT C_porcellus300858 TGTGTGTGGTGGCGTA-TTTCAAGGGAG-AGAGAGGAAGGCCCTC---CT C_porcellus300860 ---TAG-TGTGACTTTCGTACCGGG-GAGAGAGAGAAAAGAGCT----CT D_novemcinctus300240 AACATG-TGTGCCTTCCATAATGGGAAA-AGAGAGTAAAGATCT----CC E_telfairi300096 AACATG-TGTGACTTTCGTGAAGAG-GATAGAGAGAAAGGGTGCATGTCC E_telfairi300590 AACATG-TGTGACTTTCGTAAAGAG-GAGAGAGAGAAAGGGCGC----GC E_telfairi300659 AACAGG-TGTGACTTTCATAAAGAG-GAGAGAGAGAAAGGGTGC----CC E_caballus300382 CACGCG-TGTGACTTTCGTAATGGGGAG-AGAGAGAAAGGATCT----CC E_caballus300383 TGTGTGGTT-GGTGTA-TTTTCAGAGAG-AGAGAGGAAGGCCCTC---CT F_catus300017 TGTGTGGTT-GGCGTA-TTTTCAGAGAG-AGAGAGGAAGGCTCTC---CT F_catus300171 TGTGTGGTT-GGTG---TATTTTCAGAG-AGAGAGGCAGGCCCTC---CT H_sapiens300586 CACCCG-TGTGACTTTCGTAACGGG-GAGAGAGAGAAAAGATCT----CC H_sapiens300605 CGCCTG-TGTGGCTTCTGTAATGGGGAG-GGAGAGAAAGGATCTC--CCC M_mulatta300006 CACCCG-TGTGACTTTCGTAATGGG-GAGAGAGAGAAAAGATCT----CC M_mulatta300233 CACCCA-TTTGACTTCTGCAACAGGGAG-AGAGAGAAAAGATGT----CC M_mulatta300282 TGTGTGGTT-GGCCTG-TTTTCTGGGAG-GCAGAGGAAGGCTTTC---CT M_mulatta300442 CACCTG-TGCAACTTTCTTAATGGGGAG-AGAGAGA---GATCT----CT M_mulatta300464 CATTTG-TGTGACTTTTGCAATGGGAAG-AGAGAAAAAAGGTCC----C- M_mulatta300603 CGCCTG-TGTGGCTTTTGTAATGGGGAG-GAAGAGAAAGGATCTC--CCC M_mulatta300636 TGTGTGCTT-GGCGTG-TTTTCACGGAG-GCAGAGAAAGGCTCTC---CT M_murinus300000 TATCTG-TGTGACTTTCATAATGGGGAG-AGAGAAAAATGATCT----CC M_murinus300026 CACTTG-TGTGACTTTTGTAATGTGGAG-AGAAAGAAAAGATCTC--CTT M_murinus300056 CACCTG-TGTGACTTTCCTAATGGG-GAGAGAAAGAAAATAGCA----CC M_murinus300113 CACTTGGTGTGACTTTTGTGATGTGGAG-AGAAAGAAACGATCTC--CCT M_murinus300163 TGTGTAATGGGATTATCAGAAGGAG----AGA-AGATAGAT-CT----CT M_murinus300467 TGTGTGCTT-GGCGTA-TTTCCAGGGAG-AGAGAGGAAGGCTCTC---CT M_murinus300534 CATCAG-TGTGACTT-CATAACAGGGAG-AGAGAGAAATGATCT----C- M_murinus300549 CACCTG-CATGACTTTCATGATAAG----AGACAGAAAAGATCT----CC M_musculus300780 CGTGTGCTT-GGCACACTTTTGTAGCAG-AGAGAAAATGGCCCCC---C- M_musculus300914 TACCCG-TGTGACTTTCGTACGGAGAGAGAGAGAAAACGAGTTC----CT O_garnettii300048 AACTCA-TGTGACTTTTGTAATGTAGAG-AGAGAGGAAAGAGCT----C- O_garnettii300217 TACTCT-TACCACTTTCCTAATGTGGAG-AGGGGGGATAGGTCT----CC O_garnettii300263 CATCTG-TGTGACTTTCATAATACCAAG-AGAGAAGCAAAACTG----CC O_garnettii300291 CACTTG-TGTGACTTTCGTAATGTGGAA-AGAAAGAAAAGTTCT----CC O_garnettii300310 ATGAATTCAAAGGCAAAGTACCAGGGAG-AGAAAAGAAGGCTCTC---TT O_garnettii300362 -GTACACTG-GGCTTTTGTAATGTGGAA-AGAGAAAAAAGTTCT-----C O_garnettii300536 CACTCA-TGTGACTTTTGTAATGTGGGG-AGAGAGAAAAGATTT----CC O_garnettii300640 CACCTA-TGTGACTTTCATAATGAG-GAGAGAGAGAAAAGAGCT----CC O_garnettii300733 TGTGTTCTT-GGTG---TTTCCAGGGAG-AGAGAAGAAGGCTCTT---CT O_garnettii300752 GGTGTGCTT-GGCG---TTTTCAGGGAG-AGAAAGGAAGGCTCTC---CT P_troglodytes300144 TGTGTGCTT-GGCGTG-TTTTCAGGGAG-GCAGAGAAAGGCTCTC---CT P_troglodytes300197 CACCCA-TTTGACTTCTGCAACAGGGAG-AGAGAGATAAGATGT----CC P_troglodytes300276 CACTTG-TGTGACTTTTGCAATGGGAAG-AGAGAGAGAAGGTCC----CC P_troglodytes300376 TGTGTGCTT-GGTGTC-TTTTCTGGGAG-GCAGAGGAAGGCTCTC---CT P_troglodytes300623 CGCCTG-TGTGGCTTTTGTAATGGGGAG-GGAGAGAAAGGATCTC--CCC P_troglodytes300684 TGTGTGCTT-GGCGTG-TTTTCAGGGAG-GCAGAGAAAGGCTCTC---CT P_troglodytes300685 CACCCG-TGTGACTTTCGTAACGGG-GAGAGAGAGAAAAGATCT----CC P_pygmaeus300120 TGTGTGCTTTGGCGTG-TTTTCAGGGAG-ACAGAGAAAGGCTCTC---CT P_pygmaeus300214 TGTGTGCTT-GGTGTG-TTTTCTGGGAG-GCAGAGGAAGGCTCTC---CT P_pygmaeus300361 CACCCA-TTTGACTTCTGCAACGGGGAG-AGAGAGATAAGATGT----CC P_pygmaeus300524 CACTTG-TGTGACTTTTGCAATGGGAAG-AGAGAGAGAAGGTCC----CC P_pygmaeus300553 CACCCG-TGTGACTTTCGTAACCAG-GAGAGAGAGAAAAGATCT----CC P_pygmaeus300724 CGCCTG-TGTGGCTTTTGTAATGGGGAG-GGAGAGAAAGGATCTC--CCC P_pygmaeus300746 TGTGTGCTT-GGCGTG-TTTTCAGGGAG-GCAGAGAAAGGCTCTC---CT P_pygmaeus300747 CACCCG-TGTGACTTTCGTAACCGG-GAGAGAGAGAAAAGATCT----CC R_norvegicus300811 CTCCCG-TGTGACTTTCGTACTGGGAGAGAGAGAAAGCGAGTTC----CT R_norvegicus301040 TACCCG-TGTGACTTTCGTACCGGGAGAGAGAGAAAAGGAGTTC----CT S_tridecemlineatus300316 TGTGTGCTT-GGCGTA-TTTTAAGGGAG-AGAGAGGAAGGCCCTC---CT T_belangeri300042 CATCCA-TTTGACTTTCGTAAAGGGGAA-AAAGAGCAAAGATCC----CC T_belangeri300087 CACCCG-TGTGGCTTTCGTAAAGGGGATTAGAGAGCAAAGATCC----CC T_belangeri300138 CACCCA-TGTGGCTCTTGTAAAGGGGAG-AGAGAGCAAAGATCC----CA C_familiaris300120 TCAGGATTTCAGATTGGTCTCACGGTGGC-CACTCTTTCCT-TGAGG--- C_familiaris300390 TCCGGACCTCAGAGTGGCCTTACTGTGGC-CACTCTTTCCT-GGAGG--- C_familiaris300391 AATGCACGGCAGACTGGCCC-CAACTGGCCTCT---CTGTTCCTAGG--- C_porcellus300187 AATGCTCGACAGACCTGCCC-CAAGTGGC---CTCTCTGTTCCTAGG--- C_porcellus300858 AATGCACGACAGACCTGCCC-CAAGTGGCCTCT---CTGTTCCTAGG--- C_porcellus300860 TCAGGACCTTGGACTGGCCTCATAATGGC-CTTTCTTTCCT-TGAGG--- D_novemcinctus300240 TGGGGACCTCAGATGGGCCTTGCTGTAGC-CTCTCTTACTC-CAACA--- E_telfairi300096 TGAGGACCTCAGGTAGGCCTC-CTGTAGC-CTGTCCCTTCT-GGGGG--- E_telfairi300590 TCAGGACCTTGGGCAGGCCTC-CTGTGGC-CTGTCCCTTCT-GGGGG--- E_telfairi300659 TCAGGACCTCGGGCAGGCCTC-C-GTGGC-CTGTCTCTTCC-AGGGG--- E_caballus300382 TCGGGATCTCAGATTGGCCTTGTGGTGGC-CTCTCTTTCCT-TGAGG--- E_caballus300383 AATGCACGACAGACTGGCCC-ACAGTGGCCTCT---CTGTTCCTAGG--- F_catus300017 AATGCACGGCAGACCGGCCC-CAAGTGGCCTCT---CTGTTCCTAGG--- F_catus300171 AATGCACTTCAGACCAGCCC--GAGTGGCCTC-----TGTTCCTAGG--- H_sapiens300586 TCAGGACCTCGGATGGGCCTTACTGTGGC-CTCTCTTTCCT-TGAGG--- H_sapiens300605 --AGGACCTCAGATTGGCTTTACTGTGGC-ATCTCTTTCCT-TGAGG--- M_mulatta300006 TCAGGACCTCGGATGGGCCTTACTGTGGC-CTCTCTTTCCT-TGAGG--- M_mulatta300233 GTGGCGCATCAGATTAGCCTTATGGTGGT-CTCTCTCTCCT-TGAAG--- M_mulatta300282 AAT-TACAAGAGACCTGCCC-AGAATGGCCTCC---CCATTTCTAGG--- M_mulatta300442 TTGGGAACTCAGATTGGCCTTATGGTGGC-CTCTCTTTCTT-TGAGG--- M_mulatta300464 TTGGTACCTCAGCTCGGCCTTATGGTGGC-CTCTTTC--CT-TGAAG--- M_mulatta300603 --AGGACCTCAGATCATCTTTACTGTGAC-ATCTCTTTCCT-TGAGG--- M_mulatta300636 AATACACGACAGACCCGCTC-AGAATGGCCTCT---CTGTTCCTAGG--- M_murinus300000 TTGGGACCTCAGATTGGCCTTATGGTGGC-CTCTCTTTCCT-GGACAACT M_murinus300026 --GGGACCTCAGATTAGCCTTACAGTGGC-TTCTCTTTTCA-TGAGG--- M_murinus300056 TCAAGACCTCGGATTGGCCTTAGGGTGGC-CTCTCTTTTCT-TGAGG--- M_murinus300113 CCGGGACCTCGGATTAGCTTTACAGTGGC-TTCTCTTTTCCCTGAGG--- M_murinus300163 TTGGGACATTGGATTGGCCTTATGGTGGC-CTCTCTTTCTT-TGAGG--- M_murinus300467 AATGCACGACAGAA-TGCCC-ACAGTGGCTTCT---CTGTTCCTAGG--- M_murinus300534 --AGGACCTCAGACTGGCCTTATGGTGGC-CTCT--TTCCT-TGAAA--- M_murinus300549 TGGGGACCTCAGATTGGCCTTATAGTGGT-TTCTCTTTCCT-TGAGG--- M_musculus300780 AATGCCCAGCAGACCTGCCCCAAAGTGGCTTCTTTGTTGTTCCTAGG--- M_musculus300914 TCAGGACTTTGGATTGGCCTCACAGTGGC-CTCTCTTGCCT-AGAGG--- O_garnettii300048 --AGGATCT-TGGATGGCTTCACAGTGGC-CTCTCTTTCCT-TGAGG--- O_garnettii300217 TCAGGACCT-GGGTTGGCCTTCCAGCGGC-CTCTCTTTCCC-TGAGG--- O_garnettii300263 TAAGGACCCCAGACTGCCCTTATGGTAGC-CTCTCTTTCCT-TGAGT--- O_garnettii300291 TCAGGATATCAGGTTGGCCTAACAGTGGCTCTCTCTTTCCT-TGAGG--- O_garnettii300310 AATGCATGACAGAATTGCCC-ACAGTGGC---CTCTCTGTTCCTGGG--- O_garnettii300362 CTCGGATGTCAGGTTGGCCTTACAGTGGG-CTCTCTTTTCT-TGAGG--- O_garnettii300536 TCAAGATGTCAGGTTGGCCATACAGTGGC-CTCTCTTTCCT-TGAGG--- O_garnettii300640 TCAGGAGCGCAGATTGGCCTTACAGTGGC-TCCTCTTTCCT-TAAGG--- O_garnettii300733 AATGCATGCCAGACTTGCCC-ACCATGGCTCT----CTGTTCCTAGG--- O_garnettii300752 AATGCACGACAGAATTGCCC-ACAGTGGCCTCT---CTGTTCCTGGG--- P_troglodytes300144 AATGCACGACAGACCCGCCC-AGAATGGCCTCT---CTGTTCCTAGG--- P_troglodytes300197 TTGGCATGTCAGATTGGCCTTATGGTGGT-CTCTCTCTCCT-TGAGG--- P_troglodytes300276 TTGGTATCTCAGCTCGGCCTTATGGTGGC-CTCTTTC--CT-TGAAG--- P_troglodytes300376 AAT-CACAACAGACCTGCCC-AGAAGGGCCTCT---CTATTTCTAGG--- P_troglodytes300623 --AGGACCTCAGATTGGCTTTACTGTGGC-ATCTCTTTCCT-TGAGG--- P_troglodytes300684 AATGCACGACAGACCCGCCC-AGAATGGCCTCT---CTGTTCCTAGG--- P_troglodytes300685 TCAGGACCTCGGATGGGCCTTACTGTGGC-CTCTCTTTCCT-TGAGG--- P_pygmaeus300120 AATGCACGACAGACCTGCCC-AGAATGGCCTCT---CTGTTCCTAGG--- P_pygmaeus300214 AAT-CACAACAGACCTGCCC-AGAATGGCCTCT---CCATTTCTAGG--- P_pygmaeus300361 TTGGCATGTCAGATTGGCCTTATGGTGGT-CTCTCTCTCCT-TGAGG--- P_pygmaeus300524 TTGGTACCTCAGCTCGGCCTTATGGTGGC-CTCTTTC--CT-TGAAG--- P_pygmaeus300553 TCAGGACCTCGGATGGGCCTTATCGTGGC-CTCTCTTTCCT-TGAGG--- P_pygmaeus300724 --AGGACCTCAGATTGGCTTTACTGTGGC-ATCTCTTTCCT-TGAGG--- P_pygmaeus300746 AATGCACGACAGACCTGCCC-AGAATGGCCTCT---CTGTTCCTAGG--- P_pygmaeus300747 TCAGGACCTCGGATGGGCCTTATCGTGGC-CTCTCTTTCCT-TGAGG--- R_norvegicus300811 CCAGTACTTTGGATTGGCTTCACAGTAGC-CTTTCTTGCCT-AGAGG--- R_norvegicus301040 CCAGTACTTGGGATTGGCCTCACAGTGGC-CTTTCTTGCTT-AGAGG--- S_tridecemlineatus300316 AATGCACGGCAGATCTGCCCCTAAGTGGCCTCT---CTGTTCCTAGG--- T_belangeri300042 TTGGAACCCAGGAGTGGCCTCATA-TGGC-TTCTCTTCCCT-TGAGG--- T_belangeri300087 TCGGGACCCAGGAGTGGCCTCATG-TGGC-TTCTCTTCCCT-CGAGG--- T_belangeri300138 TCGGGATCCAGGAGTGGCCTCATG-TGGC-TTCTCTTCCCT-CGAGG--- * C_familiaris300120 AGTGCACTAGGT-------- C_familiaris300390 GGTGCCACAGGT-------- C_familiaris300391 AGCGCAACAGCT-------- C_porcellus300187 AGTGCAACATAG-------- C_porcellus300858 AGTGCAACATAG-------- C_porcellus300860 GGCACAACAGGC-------- D_novemcinctus300240 GGCATGTCACGTAG------ E_telfairi300096 GGCACATAGGA--------- E_telfairi300590 GGCACAACAGGC-------- E_telfairi300659 G-CACAACAGGC-------- E_caballus300382 GGCGCGACAGGC-------- E_caballus300383 AGTGCAACAGCT-------- F_catus300017 AGCGCAACAGTG-------- F_catus300171 ATTACAACAGCT-------- H_sapiens300586 GGTGCAACAGGC-------- H_sapiens300605 GACACAATAGGT-------- M_mulatta300006 GGCGCAACAGGC-------- M_mulatta300233 GGCACAACAGAT-------- M_mulatta300282 AGTATGATCGCT-------- M_mulatta300442 GGCACAACAGGT-------- M_mulatta300464 GGTGCAACAAAA-------- M_mulatta300603 GACACAACGGGT-------- M_mulatta300636 AGTGCGACAATT-------- M_murinus300000 GGTCCTGGAGGAAAAAAGAA M_murinus300026 GGCACAACAGAT-------- M_murinus300056 GGTACAATGGGT-------- M_murinus300113 GGTGCAACAGGT-------- M_murinus300163 GGTACAAAAGTT-------- M_murinus300467 AGTGCGACATCT-------- M_murinus300534 GGCTCAATAGGT-------- M_murinus300549 GGTACCACAGGT-------- M_musculus300780 AGTTTCACAGCT-------- M_musculus300914 AGCACCACAGGT-------- O_garnettii300048 AGTCCAACAGAG-------- O_garnettii300217 -GTCCAGCAGAG-------- O_garnettii300263 GGAATAACAGAT-------- O_garnettii300291 GCTCTAACAGGG-------- O_garnettii300310 AGTGCAACATCT-------- O_garnettii300362 AATTCAACAGGG-------- O_garnettii300536 GGTCCAACAGGG-------- O_garnettii300640 GATGGAACAGGT-------- O_garnettii300733 AGTGTGACATCT-------- O_garnettii300752 AGTGCAACATCT-------- P_troglodytes300144 AGTGTGACAATT-------- P_troglodytes300197 GGCACAACAGAT-------- P_troglodytes300276 GGTGCAACAAAA-------- P_troglodytes300376 AGTATGATAGCT-------- P_troglodytes300623 GACACAACAGGT-------- P_troglodytes300684 AGTGCGACAATT-------- P_troglodytes300685 GGCGCAACAGGC-------- P_pygmaeus300120 AGTGTGACAATT-------- P_pygmaeus300214 AGTATGATAGCT-------- P_pygmaeus300361 GGCACAACAGAT-------- P_pygmaeus300524 GGTGCAGCAAAA-------- P_pygmaeus300553 GGCGCAACAGCC-------- P_pygmaeus300724 GACACAACGGGT-------- P_pygmaeus300746 AGTGCGACAATT-------- P_pygmaeus300747 GGCGCAACAGGC-------- R_norvegicus300811 AGCACCACAGGT-------- R_norvegicus301040 AGCACCACAGGT-------- S_tridecemlineatus300316 AGTGCAACAGCT-------- T_belangeri300042 GGTGCAATAGGC-------- T_belangeri300087 GGTGCAACAGGC-------- T_belangeri300138 GGCGCAACAGGC--------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved