snOPY snoRNA Orthological Gene Database

Family: SNORA63L

CLUSTAL W (1.83) multiple sequence alignment H_sapiens300009 GTGCATGTACTGTTACAATCTAACTGAAGTATTTTA----TTGTTACCCCTGCTTAAAGC H_sapiens300073 ATGCAGGTACTGTTA-----TAACTGAAGTGTTTTACGGTTTTTTCTTCCTGCTTAAAGC H_sapiens300105 ATGCAGGTACTGTTACAATATGACTGAAGTGATTTGTTG-TCATTTCCCCTGCTTAAAGC **** ********* * ******** *** * ** ************ H_sapiens300009 AGTATAGATGCATAACTATGTCTGTTTAACTTCATTCCATAGTGAGACAGAGACACTTGG H_sapiens300073 ACT--TGGTACATAAGTATCTC----TAACTCGATTCCATAATAAGACAGAGACGCTTGG H_sapiens300105 CCT--TGATATATAACTATCTCTGTCTAACTC-ATTCTGAAGTAAGACAGAGATGCTTGG * * * **** *** ** ***** **** * * ********* ***** H_sapiens300009 TTTCAAACAT H_sapiens300073 TCTCAAACAT H_sapiens300105 TTTCATTTTT * *** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved