snOPY snoRNA Orthological Gene Database

Family: SNORA61

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300003 AGAAATGATGAGAA--ATCAGATAA-ATCTTAGGACACCTTCTGACACAGATT-CTGTGT A_thaliana300004 AAATATGATGATAATAATCAGTAAATATCTTAGGACACCTTCTGACACAGTTTACTGTGT * * ******* ** ***** ** ************************ ** ****** A_thaliana300003 ATGAGAATGACATCATATTCTGATC A_thaliana300004 ATGAGAATGACTTGTTAATCTGATT *********** * ** ******

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved