snOPY snoRNA Orthological Gene Database

Family: SNORA61

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300152 ---CCGGTGATGTAATCAAAATATTTGCTACTCTTGATGAAGAATTTC-----TTCAGTT A_thaliana300153 AGGCCAGTGATGTAATAAAAATATTTGCTACTCTTGATGAAGAACTTTGTTCTTTCAGTT S_cerevisiae300072 --TCAAATGATGTAAT-AACATATTTGCTACTTCAGATG--GAACTTTGAGTTCCGAATG * ********* ** ************ **** *** ** * * A_thaliana300152 GATGAT---ATTTACCACCAAGATCTCTGAGGCC- A_thaliana300153 GATGATTG-GTTTACCACCAAGATCTCTGAGGCCT S_cerevisiae300072 AGACATACCAATTATCACCAAGATCTCTGATGAA- ** *** *************** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved