snOPY snoRNA Orthological Gene Database

Family: SNORA55

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300432 --GCACCTGAATCTTTCCCATTCTTTGCTGCTCTGTGCTGGTGTGGGGAC C_porcellus300953 --GCACCC-AATCTTTCCCATTCC-TGCTGCTTTGTGCTGGCCTGGGGAC D_rerio300236 --GCACTTCTGCAAACCCTGTCCTTCTGTGTCAGTGCTGGGCACGGGTTT D_rerio300237 --GCACTACAGCAAACCATTTCCTGCTTCTTCACAGCTGGATATGGGTTA D_novemcinctus300268 --GCACCTGAATCTTTCCCATTCCCTGCTGCTTTGTGCTGGTGTGGGGAC E_telfairi300737 --GCACCTGAATCTTTCCCATTCCGGACTGCCTCGTGCTGGTGTGGGGAC E_caballus300289 --GCACCTGAATCTTTCCCATTCTTTGCTGCTTTGTGCTGGTGTGGGGAC E_europaeus300208 ---TGCATGAATCTTTTCCACTCCTTGCTGTTTTGTGCAGGTGTGAGGAC E_europaeus300223 --GCACCTGAATCTTTCCCATTCCTTGCTGCTTCATGCAGGTGTGGGGAC E_europaeus300424 --GCACCTGAATCTTTCCCATTCCTTGCTGCTTCATGCAGGTGTGGGGAC E_europaeus300484 --GCACTTGAATCTTTCCTATTCCTTGCTGCTCAGTGCAGGTATGAGGAC E_europaeus300561 --GCACCTGAATCTTTCCCACTCCTTGCTCCTGCATGTAGGAGTGGGGAC E_europaeus300608 --GCACCTGAATCTTTCCCATTCCTTGCTGTTTCGTGCAGGCATGGGGAC F_catus300300 --GCACCTGAATCTTTCCCATTCTTTGCTGCTTTGTGCTGGTGTGGGGAC G_gallus300065 -------------------------------------------------- G_gallus300067 -------------------------------------------------- G_gorilla300438 --GCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCTGGTGTGGGGAC H_sapiens300660 GAGCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCCGGTGTGGGGAC L_africana300470 --GCACCTGAATCTTTCCCATTCTCTGCTGCCTCGTGCTGGTGTGGGGAC M_mulatta300577 --GCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCCGGTGTGGGGAC M_murinus300385 --GTACCTAAATCTTACCCATTTCTTGCTGCTTCGTGCTGCTGTGGAGAC M_domestica300161 --GCACCTGCATCTTTCCCATTCTTGGCTGCTTTGTGCCTGTCTGGGGAC M_musculus300428 ---GCACTAAATCTTTCCCAGGCCTGCT-GCTTGGTGCCGGTCTGGGGAC M_musculus300490 --------------TTCCCAGGCCTGCT-GCTTGGTGCCAGTCTGGGGAC M_musculus300629 -------ACATTAAACTAACAAAACCTGAAAGATGGAT-GTAATGGGGAC M_musculus300862 ---GCACTAAATCTTTCCCAGGCCTGCT-GCTTGGTGCCGGTCTGGGGAC M_musculus300959 ---GCACTAAATCTTTCCCAGGCCTGCT-GCTTGGTGCCGGTCTGGGGAC M_musculus300960 ---GCACTAAATCTTTCCCAGGCCTGCT-GCCCGGTGCCGGTCTGGGGAC M_lucifugus300773 --GCACCTGAATCTTTCCCATTCTTTGCTGCTTCGTGCTAGTGTGGGGAC M_lucifugus300710 --GCACCTGAATCTTTCCCATTCTTTGCTGCTTCGTGCTAGTGTGGGGAC O_anatinus304010 --GCACCTAAATCTTTCCCACTCCT-GTGACCCCGTGCGGGAGTGGTGAC O_anatinus304011 --GCACCTGAATCTTTCCCATGCCTTGCTGGGCAGTGTGGGTTTGGGGAC O_anatinus304012 --GCG-TTGGATTGTTTCCGCCCTCTACCGTGACGTGAGAGTCTGAGGAT O_anatinus303753 --GCG-TTGGATTGTTTCCGCCCTCTACCGTGACGTGAGAGTCTTAGGAT O_cuniculus300405 --GCACCTGAGTCTTTCCCATTCCCTGCTGCTCTGTGCTGGTGTGGGGAC O_garnettii300623 --GCACCTATATCTTTCCCATTCCTTGCTGATTCGTGCTGGTGTGGGGAC P_troglodytes300520 --GCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCCGGTGTGGGGAC P_pygmaeus300598 --GCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCCGGTGTGGGGAC R_norvegicus300179 ---------CCACACTCCCAGGCCTGCTTGCTTGGTGCTGGTCTGGGGAC R_norvegicus300180 -------GAAGCTTCCTAGCCTGGTTAAGATTTTAACCAGCTCTGGGGAC R_norvegicus300272 ---------------GTATAAAGAAATCCATTTTCTGCCGGTCTGGGGAC R_norvegicus300914 --GCACTCAAATCTTTCCCAGGCCTGCT-GCTTGGTGCCGGTCTGGGGAC R_norvegicus300915 --GCACTCAAATCTTTCCCAGGCCTGCTTGCTTGGTGCTGGTCTGGGGAC R_norvegicus300944 --GCACTCAAATCTTTCCCAGGCCTGCT-GCTTGGTGCCAGTCTGGGGAC S_araneus300136 --GCACCTAAATCTTTCCCATTCCTTGCTGCTTCGTGCTGGCATGGGGAC S_araneus300327 --GCACCTGAATCTTTCCCATTCCT-GCTGCTTCATGCTGGTGTGGGGAC S_araneus300367 --GCATTTAGATCTTTCCCATTCCTTTCTGTTTCATGCTGGTGTGGGGAC S_araneus300678 --ACACCCAAATCCTGACCATTCCTTGATGCTTTGTGCTGGTGTGGGGAC S_araneus300702 --GCACCTAAATCTTTCCCATTCCTTGCTGCTTCGTGCTGGCATGGGGAC S_araneus300918 --GCACCTGAATCTTTCCCATTCCT-GCTGCTTCATGCTGGCGTGGGGAC S_araneus301018 --GCACCTAAATCTTTCCCATCCCTTGCTGCTTCGTGCTGGTGTGGGGAC S_araneus300896 --GCACCTGAATCTTTCCCATTCCTTGCTGCTTTGTGCTGGCATGGGGAC S_tridecemlineatus300301 --GCACCC-GATCTTTCCCATTCC-TGCTGCTTCGTGCTGGTCTGGGGAC T_nigroviridis300017 GCACCTCTCAGCAACCCAGTGGACTCTGCTGAGTGGTCAGATTGGGTATC T_belangeri300342 --GCACCGGAATCTTTCCCGCTCCTTGCTGCCTCGTGCTGGTGTGGGGAC C_familiaris300432 AGACGGTGCAACAGTACAA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA C_porcellus300953 AGTGGGTGCTACAACATGA-GCAGAGGATATCCAGACGGGTTGCTTTCCA D_rerio300236 AAAA-GTGCTAAAGTACCT--CAGAGTGCATCCAGACAAGTC----TCCT D_rerio300237 AAACTGTGCAATAGTAACT--CATAGTGTATCCAGATGAGTC----TCCT D_novemcinctus300268 AGATGGTGCTACAGTATGA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA E_telfairi300737 AGATGGTGCTACAGCATGA-GCAGAGGGAATCCAGACGGGTGG-TTTCCA E_caballus300289 AGATGGTGCTACAGTATGA-GCAGAGGAAATCCAGACGGGTTGTTTTCCA E_europaeus300208 AGAT-----------ATGA-GCAGAAGAAATCCAGACAGGTTGTTTTCCA E_europaeus300223 AGATGGTGCTACAGTATGA-GCAGAGTACATCCAGACAGGTTGTTTTCCA E_europaeus300424 AGATGGTGCTACAGTATGA-GCAGAGTACATCCAGACAGGTTGTTTTCCA E_europaeus300484 ACATGGTGGTACAACTGGA-GCAGAGGAAATACAGACAGGTGCTTGTCCA E_europaeus300561 AGATGGTGCTATAACATAG--CAGAGGAAATCCAGATGGG---TT-TCCA E_europaeus300608 AGATGGTGCTACAGTATGA-GCAGAGGAAATCCAGACAGGTTCTTTTCCA F_catus300300 AGATGGTGCAACAGTATGA-GCAGAGGAAATCCAGACGGGTTGTTTTCCA G_gallus300065 -------------------------------------------------- G_gallus300067 -------------------------------------------------- G_gorilla300438 AGATGGTGCTACAGAATGA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA H_sapiens300660 AGATGGTGCTACAGAATGA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA L_africana300470 AGACGGTGCTACAACACGA-GCAGAGGAAATCCAGACGGGTTG-TTCGCA M_mulatta300577 AGATGGTGCTACAGAATGA-GCAGAGGAAATCCAGACAGGTTATTTTCCA M_murinus300385 AGATGGTTCTACGGTATGA-GCAGAGGAAATCCAGAAAGGTTGCTTTTCA M_domestica300161 AGGTGGTGCTACAGTACAA-GCAGAGGAAATCCAGACAGGTTATCTTCTG M_musculus300428 AGACAGTGCTATACTA-GC-GCAGAGGAAATCCAGGCAAGCCAT-TTCCA M_musculus300490 AG----------------------AGGAAATCCAGACGGGTTGT-TTCCA M_musculus300629 AGACAGTGCTATACTAGAG--CAGAGGAAATCCAGATGGGTCGT-TTCCA M_musculus300862 AGACAGTGCTATACTA-GA-GCAGAGGAAATCCAGACAGGTCGT-TTCCA M_musculus300959 AGACAGTGCTATACTA-CA-GCAGAGGAAATCCAGACGGGTCGT-TTCCA M_musculus300960 AGACAGTGCTATACTA-CA-GCAGAGGAAATCCAGACGGGTCGT-TTCCA M_lucifugus300773 AGATGGTGCCACAGTA-AA-GCAGAGGAAATCCAGACGGGTTGTTTTTCA M_lucifugus300710 AGATGGTGCCACAGTA-AA-GCAGAGGAAATCCAGACGGGTTGTTTTTCG O_anatinus304010 AAATGGTGCTACAGAATGG--CAGAGGAAATCCAGACAGGTCGC--TACA O_anatinus304011 AGATGGTGCTACACTAGCT-GCAGAGGAAATCCAGGCAGGTTACTTTCCA O_anatinus304012 GGGAGATGTTACAGAACCA-GCAGGGGAAATCCAGATGGGTGATCTTCCA O_anatinus303753 GGGAGATGTTACAGAACCA-GCAGGGGAAATCCAGATGGGTGATCTTCCA O_cuniculus300405 GGATGGTGCCACAGCGTGG-GCAGAGGAAATCCAGACGGGCTGTTTTCCA O_garnettii300623 AGATGGTGCTATAGCATCA-GCAGAGGAAATCCAGACAGGT---TTTCCA P_troglodytes300520 AGATGGTGCTACAGAATGA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA P_pygmaeus300598 AGATGGTGCTACAGAATGA-GCAGAGGAAATCCAGACAGGTTGTTTTCCA R_norvegicus300179 AGGCAGTGCTATAGTA-GA-GCAGAGGAAATCCAGACGGGTCGT-TTCCA R_norvegicus300180 AGACGGTGCTACAGTAGAG--AAGAGGAAATTCAGACGGGTCGT-TTCCA R_norvegicus300272 AGGCAGTGCTACAGTAGAG--CAGAGGAAATCCAGACGGGTTGT-TTCCA R_norvegicus300914 AGGCAGTGCAATAGTA-GA-GCAGAGGAAATCCAGACGGGTTGT-TTCCA R_norvegicus300915 AGGCAGTGCTATAGTA-GA-GCAGAGGAAATCCAGACGGGTCGT-TTCCA R_norvegicus300944 AGGCAGTGCAATAGTA-GA-GCAGAGGAAATCCAGACGGGTCGT-TTCCA S_araneus300136 AGATGGTGCTATAGTACAA-GCAGAGGAAATCCAGATGGGTTGTT-TCCA S_araneus300327 AGATGGTGCAACAGTACAA-GCAGAGTAATTCCAGATGGGTCCTT-TCCG S_araneus300367 AGATGGTGCTACAGTACCA-GCAGAGAAAATCCAGACAGATCA-TACCCA S_araneus300678 AGATGGTGCGACAGTACCA-GCAGTGGATAACCAGACGGGACA-TTTCCA S_araneus300702 AGATGGTGCTATAGTACAA-GCAGAGGAAATCCAGATGGGTTGTT-TCCA S_araneus300918 AGATGGTGCAACAGTACAA-GCAGAGTAAATCCAGACGGGTCGTT-TCCA S_araneus301018 AGATGGTGCTACAATACCA-GCAGAGGAAATCCAGATGGGTCA-TTTCCA S_araneus300896 AGATGGTGCTACAGTACAAAGCAGAGGAAATCCAGATGGGCCATT-TCCA S_tridecemlineatus300301 AGATGGTGCTACACTATGA-GCAGAGGATATCCAGACGGGTTGTTTTCCA T_nigroviridis300017 AGATGGTGCTAGAACGACT--CACTGTGTATCCAGATGGACC----TCCC T_belangeri300342 AGGTGGTGCCACAGTGTGA-GCAGAGGATATCCAGACGGGCCGT---CCA C_familiaris300432 TTTGTCTT---GGGG---CCTGTCTCTACGACTCT-GCCACACCT C_porcellus300953 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACATTG D_rerio300236 CTTCTATT---GGCG---CTTGTCTCTACAAACTTTGAAACAAGC D_rerio300237 CTTCTGTT---GGAA---CTTGTCTCTACAAACTATGATACATGA D_novemcinctus300268 TTTGCCTT---GAGG---CCTGTCTCTACAACTCT-GCCACAGTT E_telfairi300737 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACACTC E_caballus300289 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACACTC E_europaeus300208 TTTGTCTT---GGGA---CCTGTCTCTGTAATTCT-GCCACACTA E_europaeus300223 TTTGTCTT---GGGA---CCTGTCCCTACAACTCT-GCCACAGTT E_europaeus300424 TTTGTCTT---GGGA---CCTGTCCCTACAACTCT-GCCACAGTT E_europaeus300484 TTTGTCTT---GGTA---CTTGTCTTTACCACTCC-GCCACACTT E_europaeus300561 -TTGTCTT---GAAA---CCTGTCTCTACAACTCTCGCCACACTT E_europaeus300608 TTTGTCTT---GGGA---CCTGTCTCTACAACTCT-GCCACATTA F_catus300300 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACACAC G_gallus300065 --------------------------------------------- G_gallus300067 --------------------------------------------- G_gorilla300438 TTTGTCTT---GGGG---CCTGTCTCTACAGCTCT-GCCACATTT H_sapiens300660 TTTGTCTT---GGGG---CCTGTCTCTACAGCTCT-GCCACATTT L_africana300470 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACACTC M_mulatta300577 TTTGTCTT---GGGA---CCTGTCTCTACAGCTCT-GCCACATTT M_murinus300385 TTTATCTT---GGAG---CCTGTCTCTACAGCTCT-GCCACATTT M_domestica300161 TTTACTTT---GGGG---CTTGTCTCTACAACTCT-GCCACACTT M_musculus300428 TCTGCCCT---GGGG---CCTGTCTCTACAACTCT-GACACACTC M_musculus300490 TCTGTCCT---GAGG---TGTGTCTCTACAACTCT-GCCACACTT M_musculus300629 TCTGCCCT---GGGG---CCTGTCTCTACAACGCT-GCCACACTC M_musculus300862 TCTGCC-T---GGGG---CCTGTCTCTACAACTCT-GCCACACTC M_musculus300959 TCTGCCCT---GGGG---CCTGTCTCTACAACTCT-GCCACACTC M_musculus300960 TCCGCCCT---GGGG---CCTGTCTCTACAACTCT-GCCACACTT M_lucifugus300773 TTTGTCTT---GCGG---CCTGTCTCTACAGCTCT-GCCACACTT M_lucifugus300710 TTTGTCTT---GCGG---CCTGTCTCTACAGCTCT-GCCACACTT O_anatinus304010 CCAATCATCCAGGCA---CCTGTCCCTACAACTCT-GCAACATGT O_anatinus304011 TTTACATT---GCAA---CTTGCCTCTACAACTCT-GCCACATTT O_anatinus304012 CCAGAGATAGAGATAGCCCTCATCTCTACACCTCT-GCCATAACT O_anatinus303753 CCAGAGATAGAGATAGCCCTCATCTCTACACCTCT-GCCATAACT O_cuniculus300405 TTCACCTT---GGAG---CCTGTCTCTACAGCTCT-GCTACATTT O_garnettii300623 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACATTT P_troglodytes300520 TTTGTCTT---GGGG---CCTGTCTCTAGAGCTCT-GCCACATTT P_pygmaeus300598 TTTGTCTT---GGGG---CCTGTCTCTACAGCTCT-GCCACATTT R_norvegicus300179 TCTGTCCT---GGGG---GCTATCTCTACAACTCT-GCCACACTT R_norvegicus300180 TCTGTTCT---GGGG---CCTGTCTCTACAACTCT-GCTACGCTC R_norvegicus300272 TCTGTCCT---GGGG---CCTGTCTCTATAACTCC-GCCACACAT R_norvegicus300914 TCTGTCCT---GGGG---CCTGTCTCTACAACTCT-GCCACACTC R_norvegicus300915 TCTGTCCT---GGGG---CCTGTCCCTACAACTCT-GCCACACTT R_norvegicus300944 TCTGTCCT---GGGG---CCTGTCTCTACAACTCT-GCCACACAT S_araneus300136 CTTGTCTT---GGGA---CCTGTCTCTACAACTCT-GCCACACTT S_araneus300327 TTTGTCTT---GGGG---CTTGTCTCTACAGCTCT-GCCATACTT S_araneus300367 TTTGTCTT---CAGG---CCTATCTTTAC--TTCT-GCCACATTT S_araneus300678 TTTGTTTTGCTTGAG---GCTGTCTCTACAACTCT-GCCACATTA S_araneus300702 CTTGTCTT---GGGA---CCTGTCTCTACAACTCT-GCCACACTT S_araneus300918 TTTTTCTT---GGGG---CTTGTCTCTACAGCTCT-GCCATACTT S_araneus301018 TTTGTCTT---GGGG---CCTGTCTCTACAACTCT-GCCACATTT S_araneus300896 TTTGTTTT---GGAA---CCTGTCCCTACAACTCT-GCCACACTT S_tridecemlineatus300301 TTTGTCTT---GGGA---CCTGTCTCTACAACTCT-GCCACATTT T_nigroviridis300017 CCCTCTGT---GGAG---CCTGTCTCTACAA-CTTTGAAACATTA T_belangeri300342 TTTGCCTT---GGGG---CCTGTCCCTACAACTCT-GCCACATTT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved