snOPY snoRNA Orthological Gene Database

Family: SNORA54

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300462 --AGGCACCATTCGT-GGCCTC--TTAGCCTGGC--TGTGGCTGACGGGC C_familiaris300489 --AGGCACTGTTCGT-GGCCTG--CTAGCCTGGC--TGTGGCTGGTGGGC C_porcellus300954 --TGGCACTACTCGT-AACCTT--TTAACTTGGT--TGTAGCTAATGGGT D_rerio300102 --GTGCACTGTTCGT-AACCTGTTTCAGCCTACCAGTCTGAGATTTGGGT D_novemcinctus300211 --CAGCACTGTTCGT-GACCCG--CTAGCCTGTT--TGCTGCTAACGGGT D_melanogaster300247 GCGCGTACCCTCGAT--ATTTGGGCCTTCCGTGCCATGGAGCTCAATCTT E_telfairi300025 --ATGCACTGTTCGT-AACCTG--TTATCAGATT--TACTGCTGACGGGT E_telfairi300264 --ATGCACTGTTTGT-AACCTG--TTATCAGATT--TACTGCTGGCGGAT E_telfairi300771 --CTGCACTGTTCGT-AACCTG--TTATCAGATT--TACTGCTGACGGGT E_caballus300387 --GAGCACTGTTCGT-GACCTG--TTAGTCTGGC--TGTGGCTTACAGGT E_europaeus300683 --GAGCACTGTTCGT-GACCTG--CCGGCCTGGC--CGTGGCTGACGGGT F_catus300228 --AGGCACTGTTCGT-GGCCTG--TCAGTCTGGC--TGTGGCTTACGGGC G_gallus300089 --ATGCACTGTTCGT-AACCTG--TTAGCAGTGTAATTCTGTTAACGGGT G_gallus300090 --TCGCACTGCTCGT-AACCTT--TTGACAGCATATTCCTGTGAATAGGT H_sapiens300731 --GAGCACTGTTCGT-AACCCG--TTAGCCTGGC--TGTAGCTAATGGGT M_mulatta300645 --GAGCACTGTTCGTTAACCTG--TTAGCCTGGC--TGTAGCTAATGGGT M_murinus300466 --GAGCACTGTTCGT-AACCTG--TTGACCTGAC--TGTGGCTGACAGGT M_musculus300769 --CAGCACTGTTCGT-AACCTG--TCAGCCTTGC--TGTGGCTGGTGGGT O_cuniculus300427 --GAGCACTGTTCGT-GACCCG--ATAGCCTGGC--TGTGGCTGACGAGT O_cuniculus300507 --GAGCACTGTTTGT-AAACTG--TTAACCTGGC--TGTAG-TAACAGGT O_garnettii300477 --GGGCACTGTTTGT-AACCTG--TTGATTTGGC--TATAGCTAATGGGC O_garnettii300608 --GAGCACTGTTCGT-AACCTG--TTGACTTGGC--CATAGCTAACGGGT P_troglodytes300657 --GAGCACTGTTCGT-AACCCG--TTAGCCTGGC--TGTAGCTAATGGGT P_pygmaeus300732 --GAGCACTGTTCGT-AACCTG--TTAGCCTGGC--TGTAGCTAATGGGT R_norvegicus301094 --AAGCACTGTTCGT-AACCTG--TCAGTCTTGC--TGTGGCTGACGGGT S_tridecemlineatus300258 --TTGCACTGTTCGT-AACACG--TCGGCCTGGT--TGTAGCTGGCAGAT S_tridecemlineatus300343 --TTGCACTGTTCGT-AACCCT--TCAGCCTGGC--TGTGGCTGGCGGGT T_nigroviridis300033 --CTGCACCGTTCGT-AACCTGGTTCAGGTTCC--GTGTGA-ACTCGGGT * ** * C_familiaris300462 TCCATTCCAGTGTGACAGCA---GTTCCAGCGGCACT----------TGA C_familiaris300489 TCCATTCCGATGCTACAGCA---GCTCCAGCAGCTCCAGCGGCATTGTGA C_porcellus300954 TCCATTCTAGTGCCACAGAA---ATTCCAATGACACG----------TGA D_rerio300102 TCCATTCCAGTGCAAGATTAATAAACTCAGTGAGGCAGGGGA-----GTG D_novemcinctus300211 TCCATTCCAGTGCAACATTAT--GCCCCAGAACCGACAAC-------TGA D_melanogaster300247 CGCCAGGGGACGCAGAACAGTCAGGGCCAATTACTCGTTATTGC--AGGC E_telfairi300025 TCCATTCCAGTGCTACA-GAA--ATTCCCAGAATAATATA-------AGA E_telfairi300264 TCCATTCCAGTGCTACA-GAA--ATTCCCAGAATAATGTA-------AGA E_telfairi300771 TCCATTCCAGTGCTACA-GAA--ATCCCCAGAATAATATA-------AGA E_caballus300387 TCCATTCCAGTGCTACAGGA---GTTCCAACGACACATGAC------TGA E_europaeus300683 TCCATTCCAGTGCCACAGGA---ACTCCGGCACTGCTGTCGC-----TCA F_catus300228 TCCATTCCAGTGCGACAGCA---TTTCCAACGGCACG----------TGA G_gallus300089 TCCATTCCGGTGCTACATGAT--AACCCCAAGATAACAGA-------AGG G_gallus300090 TCCATTCCAGTGCTACA--AC--AAATCCAG--TAATGGA-------AGG H_sapiens300731 TCCATTCCGGTGCAATAGCA---TTTCCAGCGACACA----------TGA M_mulatta300645 TCCATTCCAGTGCAATAGCA---TTTCCAGCGACACA----------TGA M_murinus300466 TCCATTCCAGTGCAACAGCA---TGTCCAGGGACACA----------TGA M_musculus300769 TCCATTCCAGTGCTACAGGA---TTTCCAGTGACACATGAC------TGA O_cuniculus300427 TCCATTCCAGTGCCACAGCAT--TGCCATGGATTGACACA-------CGA O_cuniculus300507 TCCAGTCCAGTGCTACGGCA---TTTCCAAAGGCACA----------TAA O_garnettii300477 TCCATTCCAGTGCAACAGAA---TTTCCAGGGACACA----------TAA O_garnettii300608 CC--ATCCAGTGCAACAGCA---TTTCCAGGGACACA----------TGA P_troglodytes300657 TCCATTCCGGTGCAATAGCA---TTTCCAGCGACACA----------TGA P_pygmaeus300732 TCCATTCCGGTGCAATAGCA---TTTCCAGCGACACA----------TGA R_norvegicus301094 TCCATTCCAGTGCTACAGGA---TTTCCAGTGACACATGAC------TGA S_tridecemlineatus300258 TCCATTTCAGTGCCACAGCA---TCTCCAGCAATACA----------TAA S_tridecemlineatus300343 TCCATTCCAGTGCCACAGCA---TCTCCAGCAACACA----------TGA T_nigroviridis300033 TCCATTCCGGTGCTAGA---GCAGCTCCGGTGAGGCAGGGGG-----GCG * C_familiaris300462 CTGACTGCAT--CGTGGCTCTCAGGTTCAGG-TCCTGGGGACACAG C_familiaris300489 CTGAATGACT--CGTGGCTCTCAGTTTCAGG-TCCTGGGGACATGG C_porcellus300954 CTGGCTGACACTAGTGTCTTTCAGTTTCAGGGAATTGGAGACAAAT D_rerio300102 GTGCCTCATTTGTGCTTTCTCCCTGTTCACT-CTCTGATGACATTC D_novemcinctus300211 CTGACTGGCCG-TGTGGCTCGCAGTTTTGGG-TCCTGGAGACACAG D_melanogaster300247 ATTAGAAGCCATTGCGGTCCTGCATCTCCAAATATTGGCCACAGTT E_telfairi300025 CTGACAAAAC---GTGTCTGTCTGATTTTATATTTGGGAGACAAAG E_telfairi300264 CTGACAAAAC---TTGTCTGTCTGATTTTATATTTGGGAGACAAGG E_telfairi300771 CTGACAAAAC---CCGTCTGTCTGATTTTATATTTGGGAGACAA-- E_caballus300387 CTGACTG------GTGGCTCTCAGCTTCAGG-TCTTGGAGACAAAG E_europaeus300683 CCGACTGCCC--CGAGGCTCTCGGTTTCAGG-TGCCGGAGACACTG F_catus300228 CTGACTGACT--CGTGGCTCTCAGTTTCAGG-TCCTGGGGACACAA G_gallus300089 CTGGCTGTTT---GTTTGCCTGTTCCCTTTATTTTGGGGGACATAA G_gallus300090 CTGACAGACT-------CCATGTCCCTTCCGTATTTGGAGACATTC H_sapiens300731 CTGACTGACT--GGTGGCTTTCAGTTTCAGG-TCTTGGAGACAAAT M_mulatta300645 CTGACTGACT--GGTGGCTTTCAGTTTCAGG-TCTTGGAGACAAAT M_murinus300466 CTGACTGGCT--GATGGCTTTCAGTTTCAGG-TCTTGGAAACAAAT M_musculus300769 CTGGCTGGCT--AGTGGCTTTCAGTTTCAGG-TCTTGGAGACACAC O_cuniculus300427 CTGACTGCCT--GGTGGCTTCCGGTTTCAG--TCCTGGAGACAAAT O_cuniculus300507 CTGACTGACT--AGTGGCTTTCAGTTTCAGG-TCTTGGAGACAAAC O_garnettii300477 CTGACTGATT--GGTGGATTTTGATTTGGGG-TCTTGGAGACATGC O_garnettii300608 CTGACTGACT--GGTGGCTTTCAGTTTCAGG-TCTTGGAGACAAAT P_troglodytes300657 CTGACTGACT--GGTGGCTTTCAGTTTCAGG-TCTTGGAGACAAAT P_pygmaeus300732 CTGACTGACT--GGTGACTTTCAGTTTCAGG-TCTTGGGGACAAAT R_norvegicus301094 CTGGCTGGCT--AGTGGCTTTCAGTTTCAGG-TCTTGGAGACATAT S_tridecemlineatus300258 CTGAC----C--AGTGGCTTTCAGTTTCAGG-TCTTGGAGTCAGTG S_tridecemlineatus300343 CTGACTGACC--AGTGGCTTTCAGTTTCAGG-TCTTGGAGACAGTG T_nigroviridis300033 GCGCCCTCCTGCGCCCTGCTCCCCGTTCACT-CTCCGGGAACACCG * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved