snOPY snoRNA Orthological Gene Database

Family: SNORA53

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300438 TACATGCTTCCTTAGATC--CACCTTTGTGGATGCTAGT-CTTGAACTGA D_rerio300294 CACACGTTC-CTTAGATC--CGCCTCTGGGGA-----GCGTCAGTGCTCT D_rerio300295 CACACGTTC-CTTAGATC--CGTCTCTGGGGA-----GCGTCAGTGCTCT E_telfairi300566 ------CTTCCTTAGATC--CACCTTTGTGGATGTTAAT-TTTGAACTGA E_telfairi300744 AACATGCTTCCTTAGATC--CACCTTTGTGGATGTTAAT-TTTGAACTGA E_caballus300268 AACATGCTTCCTTAGATC--CACCTTTGTGGGTGTTAGT-CTTGAACTGT E_europaeus300446 AACATGCTGCCTTAGATC--CACCTTTGTGGATGTCAGT-CTTGAACTGA F_catus300227 AACATGCTTCCTTAGATC--CACCTTTGTGGATGCTAAT-CTTGAACTGA G_gallus300026 CACATGCTC-CTTAGATC--CATCTTTGTGAGT---ATC-TTTGTGCTGA G_gorilla300023 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA H_sapiens300692 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA M_mulatta300626 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA M_murinus300490 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAC-TT-GAACTGA M_domestica300167 AACATGCTTCCTTAGATC--CACCTTTGTGGATGCCAACTCTTGTTCTGA M_musculus300847 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--GGT-CTTGGACTGA M_lucifugus300635 AACATGCTTCCTTAGATC--CACCTTTGTGGATGCCAAT-CTTGAACTGA M_lucifugus300789 AACATGCTTCCTTAGATC--CACCTTTGTGGATGCCAAT-CTTGAACTGA O_anatinus304466 AACATGCTTCCTTAGATC--CACCTTTGTGGTTGCCCAC-CTTGAACTGA O_garnettii300706 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-TTTGAACTGA P_troglodytes300651 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA P_pygmaeus300650 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA R_norvegicus300884 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA S_araneus300159 ----TGTTTGCCTTGCACGTGGGCCTACCTGG-----GT-TTGATTCCTG S_araneus300187 CTTATGCTTCCTTAGATC--CACCTTTGTGGATGTCAAT-CTCAAACTGA S_araneus300447 AACATGCTTCCTTAGATC--CACCTTTGTGGATGTCAAT-CTTGAACTGA S_araneus300593 AACATGCTTCCTTAGATC--CACCTTTGTGGATATCAAT-CTCAAACTGA S_araneus300782 ------------TGGATGGTGGGTTGAATTCTT----GT-TTTGTTTTGA S_araneus300934 AACATACTTTCTTAGATC-TGGTCTTTGTAGGTGAGAAT-CTTGAACCAG S_araneus301014 --AATGCTCCCTTAGATCCTAATTTGTGTTTGT---AAT-CTTGAACTAA S_tridecemlineatus300269 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AGT-CTTGGGCTGA T_nigroviridis300135 CACACGCTC-CTTAGATC--CACCTCTGGAGG-----GCG---------- T_nigroviridis300136 CGCACGCTC-CTTAGATC--CACCTCTGGAGG-----GCG---------- T_belangeri300294 AACATGCTTCCTTAGATC--CACCTTTGTGGATG--AAT-CTTGAACTGA X_tropicalis300073 AACATGCTCCCTTAGATC--CATCTTTGTGGAAGTCCGC--TTATGCTGA * * C_familiaris300438 GTTCTACTTGTAAACATT-TGGTTTCTTGTAG----TTCCAGTC---AG- D_rerio300294 TCTTCTGCTGCTCTCTGT-GTGAGAGCATCAG----GGTCGACC------ D_rerio300295 TCTTCTGCTGCTCTCTGT-GTGAGAGGATCAG----GGTCGACC------ E_telfairi300566 GTTCTACTTGTAAACTCT-GTGTTTCTTGTGG----TTCCAGTC---AAA E_telfairi300744 GTTCTACTTGTAAACTTT-GTGTTTCTTGTAG----TTCCAGTC---AAA E_caballus300268 GTTCTACTTGTAAACTTC-TTGTTTCTTGTAG----TTCCGGT---CAGA E_europaeus300446 GTTCTGCTCGCAAACTTC-CTGTTTCTTGTAG----TTCCAGTC-----A F_catus300227 GTTCTACTTGTAAACTTT-CTGTTTCTTGTAG----TTCCAGTC---AGA G_gallus300026 GTTCTGCTGGATAACT-T-CAGTTTCTAGCAG----TTCCAGTC---AAA G_gorilla300023 GTTCCACTTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGT---CAAA H_sapiens300692 GTTCCACTTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGTAGTCAAA M_mulatta300626 GTTCCACTTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGT---CAAA M_murinus300490 GTTCTGCCCGTAAACTTC-TTGTTTCTTGTAG----TTCCAGT------- M_domestica300167 GTTCTACTTGCTAA--CGTTTGTTTCTTGTAG----TTCCAGTC----AA M_musculus300847 GTTCTACCTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGTC---CAA M_lucifugus300635 GTTCTACTTGTGAACTTTACTGTTTCTTGTAG----TTCCAGTC---AG- M_lucifugus300789 GTTCTACTTGTAAACTTTACTGTTTCTTGTAG----TTCCAGTC---AA- O_anatinus304466 GTTCCGCCAGTTAAACTCTTTGTTTCTGGTAG----TTCCAGTC----AA O_garnettii300706 GTTCCGCTTGTAAACTTC-TTGTTTCTTGTAG----TTCCAGT------- P_troglodytes300651 GTTCCACTTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGT---CAAA P_pygmaeus300650 GTTCCACTTGTAAACTTC-TTGTTTCTTGTGG----TTCCAGT---CAAA R_norvegicus300884 GTTCTACCTGTAAACTTC-TTGTTTCTTGTAG----TTCCAGTC---CAG S_araneus300159 GCATCACATATGGTCC-A-TCGAGCCTGCCAGGAGTTATCCATG---AGC S_araneus300187 GTTCTACTGGTAAACT-T-TGGTTTCCTATAG----TTCCCGTG---AAA S_araneus300447 GTTCTACTCGTAAACT-T-TGGTTTCTTGTAG----TTCCAGTG---AAA S_araneus300593 GTTTTACGGGTAAACT-T-TGGTTTCCTGTAG----TTCCAGTG---AAA S_araneus300782 ATAGGAGGAAAAGCTG-T-TTTTGTGTTTCTC--CTTATAC-TA---TGC S_araneus300934 ATTCTATGTGTAAATT-T-TCATTTCTTCTTG----TTTCAGTG---AAA S_araneus301014 ATTCTACTCATAAATT-T-TAATTTCTTGCAG----TTCTAGTA---AAA S_tridecemlineatus300269 GTTCTACTTGTAAACTTTCTTGTTCCT-GTAG---TTTCCAGTC----AA T_nigroviridis300135 -------CTGTTCTCCG----------AGCAG----AGCT---------- T_nigroviridis300136 -------CTGTTCTCCG----------AGCAG----AGCT---------- T_belangeri300294 GTTCTACTTGTAAAC--C-TTGTTTCTTGTAG----TTCCAGTC----AA X_tropicalis300073 GTCCTGCTAACTGCTCATTTTGGGCTTTAGAAG---TTCCAGCT----AA C_familiaris300438 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T D_rerio300294 GCAGCTCCCGCCAGCTTTACTG-CTGTACCGTCA-GAGGCGCT------T D_rerio300295 GCAGCTCCCGCCAGCTTTACTG-CTGTACCGTCA-GAGGCGCT------T E_telfairi300566 GAAGCATCCGGCAACTTTTT-GGATGTACAGCCA-AAGGTGCT------T E_telfairi300744 GAAACATCCGGCACCTTTTGTGGTTGTACCCTCTTAAGGTGCT------T E_caballus300268 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T E_europaeus300446 GAGACATCCGGCAACTTTTTTGGTTGTACAGTCA-AAGGTGCT------T F_catus300227 GAAACATCCAGCAACTTCTTCGGTTGTATAGTCA-AAGGTGCT------T G_gallus300026 GTTGC--TCGGCAACTTTTTTGGTTGTACGGTCA-AAGATGCT------T G_gorilla300023 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T H_sapiens300692 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T M_mulatta300626 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T M_murinus300490 CAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T M_domestica300167 GAGGCATCCAGCAACTTTACCGGTTGTACTGTCA-AAGGTGCT------T M_musculus300847 GAAACGTCCAGCAACTTTGTTGGTTGTATAGTCG-AAGGTGCT------T M_lucifugus300635 GAAACATCCAGCAACTTTTT-GGTTGTACAGTCG-AAGGTGCT------T M_lucifugus300789 GAAACATCCAGCAACTTTTT-TGTTGTACAGTCA-AAGGTGCT------T O_anatinus304466 GAGGCATCCGGCAACTTCTTTGGTTGTACAGTCA-AAGGTGCT------T O_garnettii300706 CAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T P_troglodytes300651 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T P_pygmaeus300650 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCA------T R_norvegicus300884 GAAACATCCAGCAACTTTGTTGGTTGTACAGTCA-AAGGTGCT------T S_araneus300159 AAAGAAAGAAAGGAAGGAAAAGGTTATATAGTCA-AAGGTGCC------T S_araneus300187 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T S_araneus300447 GAAACATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T S_araneus300593 GAAATATCCAGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------T S_araneus300782 TCAATCAGCTAGTCATTCCATGGCTTTAAGATTACAATGTACT------T S_araneus300934 GAAACATCCAGCCCCCTTTTGGGTTGTATAGTCA-AAGGTGCTAGCACAT S_araneus301014 GAAACATCCAGCACCTCTCTTGTTTGTACCGTCA-AAGGTTCT------T S_tridecemlineatus300269 AGAACATCCGGCAACTTTTTTGGTTGTATAGTCA-AAGGTGCT------- T_nigroviridis300135 -----CCTCAGCAGCTTC-CTG-CTGTACTGTCG-GAGGTGCT------T T_nigroviridis300136 -----CCTCAGCAGCTTC-CTG-CTGTACTGTCG-GAGGTGCT------T T_belangeri300294 AAAACATCCAGCAACTTTTTTGGTTGTACAGTCA-AAGGTGCT------T X_tropicalis300073 GAGACAACCAGCAACTTTTTTGGTTGTACAGTCA-AAGGTGCT------T * ** * * C_familiaris300438 GAGTCATTGGCATGTGAGATAAATA-TACCTGCATGTTAGTCTT--AGGT D_rerio300294 GAGTCATTGGCGTGTGAGATCAGTC-CATCTG--------CTTA----CC D_rerio300295 GAGTCATTGGCGTGTGAGATCAGTC-CACCTG--------CTTA----CC E_telfairi300566 GAGTCATTAA-AGAAAAGAACAAAA-TGAAAGGATGGTAACATCAAAGGT E_telfairi300744 GAGTCATTGGCATGTGAGAGAACTA-TACCTTC-TACTGTTCTT--TGGT E_caballus300268 GAGTCATTGGCATGTGAGATAAATA-TACCTGCATGTTAGTCTT--ATGT E_europaeus300446 GAGTCATTGGCATGTGAGAGAAATA-CACCTGCATGTTAGTCTC--CAGT F_catus300227 GAGTCATTGGCATGTGAGATAAATA-TACCTGCATGTTAGTCCT--AGGT G_gallus300026 GAGTCATTGGCATGTGAGAGTAATA-TAACTGCATGTTAGCTTT--CTGT G_gorilla300023 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCTA--ACGT H_sapiens300692 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCTA--ACGT M_mulatta300626 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCTA--ACGT M_murinus300490 GAGTCATTGGCATGTGAGATAAATA-CACCTGCATGTTAGTCTA--AAGT M_domestica300167 GAGTCATTGGCATGTGAGATGAATA-TACCTGCATATTAGTCAT--GCGT M_musculus300847 GAGTCATTGGCATGTGAGACTAATA-TACCTGCATGCTAGTCTTC-AGGT M_lucifugus300635 GAGTCATTGGCATGTGAGATAAATA-TACCTGCATGTTAGTCTT--AGGT M_lucifugus300789 GAGTCATTAGCATGTGAGATAAATAATACCTGCATGTTAGTCTT--AGGT O_anatinus304466 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCAT--ACGT O_garnettii300706 GAGTCATTGGCATGTGAGATAAACA-TACCTGCATGTTAGTCTA--GGGT P_troglodytes300651 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCTA--ACGT P_pygmaeus300650 GAGTCATTGGCATGTAAGAGAAATA-TACCTGCATGTTAGTCTA--ACGT R_norvegicus300884 GAGTCATTGGCATGTGAGACTAATA-CACCTGCATGTTAGTCCTC-AGGT S_araneus300159 GAGTCATTGGCATGTGAGATCAATA-TACCTGCATGTTAGTCTT--AAAT S_araneus300187 AAGTCATTGGCATGTGAGATCAATA-TATCTGCAAGTTAGTCTT--AGGT S_araneus300447 GAGTCATTGGCATGTGAGATCAATA-TACCTGCATGTTAGTCTT--AAGT S_araneus300593 GAGTCATTGGCATGTGAGGTCAATG-TATCTGCAAGTTAGTCTT--AGGT S_araneus300782 GAGTCATTGACATGTGAGATCAATA-TACCTGCATGTTAGTCTT--AAGT S_araneus300934 GTGTCACTAGTACGTGAGATGAA-G-CAGCTGCATGCTGGCCCT--GGGC S_araneus301014 GAGTCATGGGCATGTGAGATCAACA-TACACGCATGTTCGATCT--ATGT S_tridecemlineatus300269 GAGTCAT-GGCATGTGAGATCA-TA-TACCTGCATGCTAGTCTC--AGGT T_nigroviridis300135 GAGTCATTGGCGTGTTAGATCAGTC-CACCTGTCCTCCAGCCCA----CC T_nigroviridis300136 GAGTCATTGGCGTGTGAGAACAGTC-CACCTGCCCTCCAGCCCT----CA T_belangeri300294 GAGTCATTGGCATGTGAGATAAATA-TACCTGCACATTAGTCTA--AGGT X_tropicalis300073 GAGTCATTGGCATGTGAGACTAATA-TACCTGCACGTTTGTCTTG-GCAT **** ** * C_familiaris300438 TCTGATAG-AAATGACACGCAATTGTGCTGCC--ATTTTTT---GCTGTC D_rerio300294 CAGAATTCTCTCTGCCCTGAACCTT---CACAGGAGTCCAC-----CAGG D_rerio300295 CAGAATTCTCTCTGCCCTGAACCTT---CACAGGACTACAG-----CAGG E_telfairi300566 ATTGAGAA---CTGGTATAAAATGAGAGAAAAA-ATGCA-----ATTATC E_telfairi300744 TCTGATGG-AAATNNNNNNN------------------------------ E_caballus300268 TCTGATAG-AAATGACATGCAGTTGTGCTGTCATTTTTTTT---ACTATC E_europaeus300446 TCTGGTGG--GATGGCA-GCAGCCG-GCTGCC--ATTCGCT----CCGCC F_catus300227 TCTGATAG-AAATGACATGCAATTGTGCTGCC--ATTTTTTTTTGCTATC G_gallus300026 TCTGATAA-AAGTGACTGTAAATATGAGAGTC--ATTTACC---GCTATC G_gorilla300023 TCTGATAG-AAATGACATGCATTTATGCTGCC--ATTTGTT---ACTATC H_sapiens300692 TCTGATAG-AAATGACATGCATTTATGCTGCC--ATTTGTT---ACTATC M_mulatta300626 TCTGATAG-AAATGACATGCATTTTTGCTGCC--ATTTGTT---ACTATC M_murinus300490 TCTGATAG-AAATGACATGCAGTTATGCTGCC--ATTTTAT---ACTATC M_domestica300167 TCTGATAG-AAATGGCAGT--------GTGTC--GTTTCTT---ACTATC M_musculus300847 TCTGATGG-AAGTGACATGCG-TGATGCTGTC--ATGTGTT---ACTGTC M_lucifugus300635 TCTGATAC-AAATGGCATGCCATTGTGCTGCC--ATTTTTG--TACTATC M_lucifugus300789 TCTGATAC-AAATGGCATGCCATTGTGCTGCC--ATTTTTG--TACTATC O_anatinus304466 TCTGATTGCAAGTGACAGCAGCATTGCGTGTC--ATTTCTC---ACGATC O_garnettii300706 TCTGATAG-AAATGGCATGCAGTTATGCTGCC--ATTTTTT---ACTATC P_troglodytes300651 TCTGATAG-AAATGACATGCATTTATGCTGCC--ATTTGTT---ACTATC P_pygmaeus300650 TCTGATAG-AAATGACATGCATTTATGCTGCCC-ATTTGTT---ACTATC R_norvegicus300884 TCTGACGG-CAGTGACACGCG-TTATGCTGTC--ATGTGTT---ACTGTC S_araneus300159 CCTGATAG-AAATGACATGCAATTATGCTGCC--ATTCTTG---ACTATC S_araneus300187 TCTGATAG-AAATGACATGCAATTATGCTGCC--GTTCTTG---ACTATG S_araneus300447 TCTGATAG-AAATGACATGCAATTATGCTGCC--ATACTTG---ACTATC S_araneus300593 TCTGATAG-AAATGACATGCAATTATGCTGCC--ATTCTTG---ACTATC S_araneus300782 TCTGATAG-AAATGACATGCAATTATGCTGCC--AAACTTG---ACTATC S_araneus300934 CCGAGAAG-A-ATGACCTGCAATTATGCTGCA--ATTCTTT---AGCACA S_araneus301014 CCTAACTG-AGATGACATAAAATCATGTGTTC--ATTCCTG---A-TGAA S_tridecemlineatus300269 TCTGATGGGAATTGGCATGCNNNNNNN----------------------- T_nigroviridis300135 TGCAGCACTGACCAGCCTGCGTTCTAAACACAGGAAGCTCT-----CACT T_nigroviridis300136 TGCAGCACTGACAACCCTGGGTTCTGAACACGGGGGTGCAC-----CAGT T_belangeri300294 TCTGATAG-AAATGACATGCAGTTATGCTGCC--ATTTTCC---ACTGTC X_tropicalis300073 TTTGATGG--------CCGTGGTTTCCTAACCACATGCC-----ACCATC C_familiaris300438 AGGACTCGACTGGTGTGCGG-ACACT- D_rerio300294 GCAGAGCTGCTGGGTAGCGG-ACACA- D_rerio300295 GCAGAGCTGCTGGGGAGCGG-ACACA- E_telfairi300566 ACAAT---------------------- E_telfairi300744 --------------------------- E_caballus300268 AGGACTCGACTGGTGTGCGG-ACACT- E_europaeus300446 AGGACTCGACTGGTGTGCGG-ACACG- F_catus300227 AGGACTTGACTGGTGTGCGG-ACACT- G_gallus300026 AGGACATGGCTGGTATGCAG-ACATT- G_gorilla300023 AGGACTTGACTCGTGTGCGG-ACATT- H_sapiens300692 AGGACTCGACTCGTGTGCGG-ACATTT M_mulatta300626 AGGACTCGACTCGTGTGCGG-ACACT- M_murinus300490 AGGACTCGACTGGTGTGCGG-ACACT- M_domestica300167 AGGACTTGATTGGTATGCGG-ACAGA- M_musculus300847 AGGACTCGACTGGTGTGCGG-ACACG- M_lucifugus300635 AGGACTTGACTGGTGTGCGG-ACACT- M_lucifugus300789 AGGACTTGACTGGTGTGCGG-ACACT- O_anatinus304466 AGAGCCTGACTGGTGTGCGG-ACACT- O_garnettii300706 AGGACTTGACTGGTGTGCGG-ACACT- P_troglodytes300651 AGGACTCGACTCGTGTGCGG-ACATT- P_pygmaeus300650 AGGACTCGACTCGTGTGCGGGACAT-- R_norvegicus300884 AGGACTCGACTGGTGTGCGG-ACACT- S_araneus300159 AGGACCTGACTGTTGTGTGG-ACACT- S_araneus300187 AGGACGTGACTGGTGTGCAG-ACACT- S_araneus300447 AGGACGTGACTGGTGTGCGG-ACACT- S_araneus300593 AGGACATGACTGGTGTGCAG-ACACT- S_araneus300782 AGGACGTGACTGGTGTGCAG-ACACT- S_araneus300934 AAGTTTTGACTGGTGTGCAG-ACATT- S_araneus301014 CCGGACTGTCCAGGGTGCAG-ACTTT- S_tridecemlineatus300269 --------------------------- T_nigroviridis300135 GTTGTCACGCTGGGGGACGG-ACACG- T_nigroviridis300136 GCTGCCAGTCTGGGGGGTGG-ACATT- T_belangeri300294 AGGACTTGACTGGTGTGCGG-ACACT- X_tropicalis300073 AGAATTTAGCAAATGTGCGG-ACATA-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved