snOPY snoRNA Orthological Gene Database

Family: SNORA50

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300417 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA C_porcellus300920 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGAGCCAAGCAA D_rerio300204 ----AAGCACTGTCTTTGAACCTGTGTAG---CCCATCCATGGCTCAGCGGGCCAAGCAA D_novemcinctus300525 ----AAGCACTGCCTTTGAATCTAATATG--TCTTGTTTGTAGCTTC-TCAGCCAAGCAA E_telfairi300021 ----AAGCACTGCCTTTGAACCTGATGTG--TCTAGTTTGTAGCTTTACAGGCCGAGCAA E_telfairi300745 -------GCCCACTCCTGTAA-AGATTTG--CACTCTTTGTAGCTGCA-GGGCCGAGCAG E_caballus300249 ----AAGCACTGCCTTTGAACCTGATATG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA E_europaeus300688 ----TAGCACTGCCTTTGAACCTGATATG--TCTTGTTTGTAGCTTCTCGGGCCAAGCAA G_gallus300045 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCATGGGCCAAGCAG H_sapiens300590 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA L_africana300484 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCAAAGCAG M_mulatta300614 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA M_domestica300138 ----AAGCACTGCCTTTGAACCTGATATG--TCTTGTTTGTAGCTTCTCAGGCCAAGCAA M_musculus300810 ----AAGCACTGCCTTTGAATCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA O_anatinus303641 ----GTGCACTGTCTTTGAACGCATGGAATGCCTTGTTCGTGACTCTTTGGGGTTCGCAG O_anatinus304513 ----AAGCACTGCCTTTGAACCTGATATG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA O_cuniculus300299 GTAGAAAGCTTGGTTATCTGACAGGTAAA--AACACTATCT--CCAC--GAGCCATGCAA O_cuniculus300485 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCATGCAA O_garnettii300378 ----AAGCACTGTCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA P_troglodytes300688 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA P_pygmaeus300750 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA R_norvegicus300977 ----GAGCGCTGCCTTTGAATCTGATGT----CTTACTTGTAGCT-CAAGGGCCAGGCAA S_araneus300958 ----AAGCACTGCCTTTGAACCTGATGTG--TCTTGTTTGTAGCTTCACGGGCCAAGCAA T_nigroviridis300025 ----CAGCACT-CCACTGAACCTAACGGGC-TTTTCCGTGTCCGTTCGCGGGTCAAGCGG T_belangeri300290 ----AAGCACTGCCTTTGAACCTGATATG--TCTTGTTTGTAGCTTCACGGGCCAAGAAA * * * * C_familiaris300417 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC C_porcellus300920 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGAGCTCTTCAGCTCT--CAACTGAAC D_rerio300204 CAGTGCAACAGTAAAG----GGTTGTTATAACTGGAGCCCCTTGGCTTTTCTTCCCAAGT D_novemcinctus300525 CAGTACTAGAGCATAA--GGACTTGTTATAACTGGGGCTCCTCAGCTCT--CAGCTGAAC E_telfairi300021 CATTGCTAGAGCATAA--GGACTTGTTATAACTGGG-CTCTTCAGCTCC--CAACTGAAC E_telfairi300745 CAGTGCTCGAGCATAA--GGGCTTGTTATAACCGGG-CTCTTCAGCCCT--CAACCGAAC E_caballus300249 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC E_europaeus300688 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTCT--CGACTAAAC G_gallus300045 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC H_sapiens300590 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC L_africana300484 CAGTGCTAGAGCATAA--GGACTTGTTAGAACTGGGGCTCTTCAGCTCT--CAACTGAAC M_mulatta300614 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC M_domestica300138 CAGTGCTAGACCATATTTGGACTTGTTATAACTGGGGCTCTTCAGGTTC--AAACTGAAT M_musculus300810 CAGTACTAGAGCATAA--GGACTTGTTATAACTGGG-CTCTTCAGCTCG--CAACTGAAC O_anatinus303641 CAGTGCAGAACTGTGA---GTTTGTTTATAACTGCCTTATTGAAGCCTT----ACTGAG- O_anatinus304513 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC O_cuniculus300299 CATTGCAAGAGCATAA--TGACTCGTTATATCTGGGGCTCTTCAGCTCT--CAACTGAAC O_cuniculus300485 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC O_garnettii300378 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC P_troglodytes300688 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC P_pygmaeus300750 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC R_norvegicus300977 CAGTGCTAGAGGAAAG-------------AACTGGG-CTCTTCAGCGCT--CAGCTGAGC S_araneus300958 CAGTGCTAGAGCATAA--GGACTTGTTATAACTGGGGCTCTTCAGCTTC--CAACTGAAC T_nigroviridis300025 -AGTGCGAGACCATAT-----CTTGTCATAACTGGGGTTTCTTGGCACTG-TCACCAAGT T_belangeri300290 CAGTGCTAGAGCATAA--CGACTTGTTATAACTGGGGCTCTTCAGCTCT--CAACTGAAC * * * * * * * * * * C_familiaris300417 TGCTCTTTTAAAAACAAGGTACATTT C_porcellus300920 TGCTCTTTTAAAGACAAGGTACATTT D_rerio300204 TGCTCTTTTAAAAGCAACCTACAAAT D_novemcinctus300525 TGCAGTTTTAAAAATGAGGTGCATTT E_telfairi300021 TGCTCTTGTAAAAACAAGGTACATTT E_telfairi300745 TGCTCAGTTAAAAACAAGGTACATTT E_caballus300249 TGCTCTTTTAAAAACAAGGTACATTT E_europaeus300688 TGCTCTTTTAAAAACAAGGTACATTT G_gallus300045 TGCTCTTTTAAAAACAAGGTACACTT H_sapiens300590 TGCTCTTTTAAAAACAAGGTACATTT L_africana300484 TGCTCTTTTAAAAACAAGGTACATTT M_mulatta300614 TGCTCTTTTAAAAACAAGGTACATTT M_domestica300138 TGTTCCTTTAAAAACAAGGTACATTG M_musculus300810 TGCTCTTTTAAAAACAAGGTACATTT O_anatinus303641 AGCACATCT----------------- O_anatinus304513 TGCTCTTTTAAAAACAAGGTACATTT O_cuniculus300299 TGCTCTTTTAAAAACAAGA------- O_cuniculus300485 TGCTCTTTTAAAAACAAGGTACATTT O_garnettii300378 TGCTCTTTTAAAAACAAGGTACATTT P_troglodytes300688 TGCTCTTTTAAAAACAAGGTACATTT P_pygmaeus300750 TGCTCTTTTAAAAACAAGGTACATTT R_norvegicus300977 TGCTCTTTTACAAACAAGGTCCATTT S_araneus300958 TGCTCTTTTAAAAACAAGGTACATTT T_nigroviridis300025 AGCTCTTTTA-AAGCAAGACACACTT T_belangeri300290 TGCTCTTTTAAAAACAAGGTACATTT * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved