snOPY snoRNA Orthological Gene Database

Family: SNORA48

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 TAACCATTGATGAAATTCTATTGAATGTCCCCAATTTTCGGAAAAGGACTGCACCGAAAT S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 ATTTCAATCAAAATCATTTATCGTTTTGTTTAGCTATTTTTTTCTCAAATTATCACTCTT S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 TTCTTCCTTTTTCATTCTCTCAATTGTTCTTTTTATTTGAGGAAATTTGATTGTATTGCA S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 TATACAACTATGCGATGCACTTTGTTCATTTTAACTTTGGATATATGTGCCTTGCTATGA S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 ACGCGTTCATTTTTAAGTGACCGGACCCTAAAATATTCAGGTAGCATGACGGAAGCTATG S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 --------------------AGTCTCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- C_familiaris300339 --------------------TGTCCCTAAA-CTGG---GTACAGT-GGTATCTGGTT--- D_novemcinctus300331 ------------------TGCCTCCCTAC--CTGG---GTAGAGT-GGCATTTGGTA--- D_novemcinctus300389 --------------------------CGA--TTGG---GTAGAGT-GGCACTTGGTG--- D_melanogaster300026 -----------------GGGGGCCTGTGAAATCAG-----TTTGTTGCAATTTGACG--- E_caballus300344 --------------------TGTCCCTGAC-CTGG---GTAGAGT-GGCACCTGGTT--- E_europaeus300046 --------------------TGTTCCTGTC-CTAG---GTAGAAT-GGCATCTAG----- E_europaeus300096 --------------------AATTGTTGTC-CTGG---GTAGAGT-GGCATCTAG----- E_europaeus300103 --------------------GGTCTCTGTC-CTGG---GTAGAGT-GGCATCTAC----- E_europaeus300108 --------------------GGGCCTTGTC-CTGG---GTAGAGG-GGCATCTGG----- E_europaeus300140 --------------------TATCACTGTC-CTGG---GTAGAGT-GTCATCTAC----- E_europaeus300193 --------------------TGTCCCTGTC-CTGG---CTAGAGT-GACACCTAC----- E_europaeus300236 --------------------TGTCCCTGTC-CTGA---GTAGAGT-GGCATCTAA----- E_europaeus300259 --------------------TGTCCCTGTC-CTGA---GTAGAGT-GGCATTTTGGCATT E_europaeus300393 --------------------TGCCCCTGTC-CTGG---GTAGAGG-AGCATCTAG----- E_europaeus300431 --------------------TGTCCCTGTC-CTGG---GTAGGGT-GGCATCTAT----- E_europaeus300624 --------------------TTTCCCTGTC-CTGA---GTAGAGT-GGCCATTGG----- F_catus300270 --------------------GGTCCCTGAC-CTGG---GTGGAGT-GGCACCTGGTC--- H_sapiens300010 ----------------------TGTTACTC-TCTA---GCTTAAG-AACCTTTAATG--- H_sapiens300591 --------------------TGTCCTTGAC-TTGG---GTAGAGT-GATGTCTGGTT--- H_sapiens300700 --------------------TGTCCCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- M_mulatta300009 --------------------GGGTTCTGAT-GCGG---GAAGAGT-AGCTTCTAGTT--- M_mulatta300198 --------------------TGCCTCTGAC-CTGG---GTAAAGT-GGCATCTAG----- M_mulatta300232 --------------------TATCTCTGAT-CTGG---GTAGAGC-AGCATCTGCTTG-- M_mulatta300245 ----------------------------TG-TCTA---AAAAAAA-AAAAAAAAAAGC-- M_mulatta300252 --------------------TGTCTTTGAC-CTCA---GTAGAGT-GGCACCTGGTT--- M_mulatta300267 ----------------------TGTTACTC-TCTA---GCTTAAG-AACCTTTAATG--- M_mulatta300273 -----------------------CCCTGAC-CTGG---GCAGAGT-GGCATCTGGTT--- M_mulatta300402 --------------------TGTCCCTGAC-CTGA---GTAGAGT-GGCATCTGGTT--- M_mulatta300508 --------------------TGTCTCTGAC-CTGG---GTAAAGT-GGCATCTGGTT--- M_mulatta300615 --------------------TGTCCTTGAC-TTGG---GTAGAGT-GATGTCTGCTT--- M_mulatta300715 --------------------TGTCCCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- M_murinus300072 --------------------TGTCCCAAAC-CTGG---GTAGAGT-GACATCTGGTT--- M_murinus300097 --------------------TATCCCTGAC-CTGA---GTAGAGT-GGCTTCT---GG-- M_murinus300172 --------------------TGTCCATGAC-CTGG---GTAGTGT-GGCATCTGGTT--- M_murinus300179 --------------------TGTCCCTGTC-ATAG---GTAGAGT-GGCATCCG------ M_murinus300249 -------------------------TGACC-CTTA---CTTGAGC-GGCATCTAGTA--- M_murinus300285 --------------------TGCC-CGA-G-CTGA---GCAGAGT-GGCATCTGGTT--- M_murinus300310 --------------------TGTCCCAGCC-CTGG---GCAGAGT-GGCATCTGGTT--- M_murinus300346 --------------------TGTCCCTGAC-CTGG---GTAAAGT-GACATCTGG----- M_murinus300357 --------------------TATCTCCAAC-CTGG---GTAGAGT-GGCATTTGATTG-- M_murinus300409 --------------------TGTCCCAAAC-CTGG---GTAGAGT-GACATCTGGTT--- M_murinus300485 --------------------TGTCCCAGCA-CTGG---GTAGAGT-GGCATCTGGTT--- M_domestica300083 --------------------CACCCCTGACACTGG---GTAGAGA-GACACCTGG----- M_lucifugus300603 --------------------TGTCCTTTAC-CTGG---GTAGAGT-GGCACCTGGTTT-- M_lucifugus300610 --------------------TGTCTCTGAC--TGG---GTAGAGT-TACACCTGGTTT-- M_lucifugus300830 ------------------GAACCCCCTGGCAATGG---GCAAGGA-GACACCTGA----- M_lucifugus300845 -------------------TACCCCCTGGCAATTT---GCAAGGA-GACACCTGA----- M_lucifugus300898 --------------------ACCCCCTGGCAATGG---GCAAGGA-GACACCTGA----- M_lucifugus300987 --------------------ACCCCCTGTCAGTGG---GCAAGGA-GACACCTGA----- O_anatinus303342 --------------------CACCCCCGTCACTGG---GTAAAGA-GGCGCCTGA----- O_cuniculus300515 --------------------TGTCCCTGAC-TGGG---GTAGAAT-GGCTTTG---GG-- O_garnettii300059 --------------------TGTCCTTGTC-CTAG---GTAA---------TCGGCT--- O_garnettii300152 --------------------TGTCCCTGAG-CTGG---GGCGAGT-GGCCCTTGTG---- O_garnettii300297 --------------------TATCCTTGAC-CTGG---GCAGAGT-GACATCTGGTT--- O_garnettii300304 --------------------TGTCCCAGAC-CTGG---GTGGAGT-GGCA-CTGGTT--- O_garnettii300313 --------------------TGCCTCAA-C-CTGG---GAAGAATAGGCATCTGGTT--- O_garnettii300425 --------------------TGTCCCTGAC--TGG---GTAAAGT-GACTTCTGG----- O_garnettii300559 --------------------TGTCCCAGAC-CTGG---GTGGCGT-GGCATCTGGTT--- O_garnettii300604 --------------------TGTCCCAGAC-CTGG---GTGGAGT-GGCATCTGGTT--- P_troglodytes300038 --------------------TATCTCTGAC-CTGG---GTAGAGC-AGCATCTGGTTG-- P_troglodytes300055 --------------------TGCCTCTGAC-CTGG---GTAGAGT-GGCATCTGG----- P_troglodytes300088 --------------------TGCCCCTGAC-CTGG---GAAGAGA-GGGGCCTGG----- P_troglodytes300166 ---------------------TGTTCTGAC-ATGG---GAAGAGT-AGCTTCTGGTT--- P_troglodytes300229 --------------------TTTCCCTGAC-CTGG---GTAGAGT-GGCATCCAGTT--- P_troglodytes300279 --------------------TGTCCTTGGC-CTGG---GTAGAGT-GGCACCTAGTT--- P_troglodytes300336 -----------------------CCCTGAC-CTGG---GTAGAGT-GGCCTCTGGTT--- P_troglodytes300371 --------------------TGTTCCCG-A-CCTG---GTAGAGT-AGCATCTGGTT--- P_troglodytes300378 -------------------------TACCC-TCTA---GCTTAAG-AACCTTTAATG--- P_troglodytes300483 --------------------------TGTC-TCGG---AGAAAAA-AAAAAAAAAAGC-- P_troglodytes300582 --------------------TGTCCCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- P_troglodytes300689 --------------------TGTCCTTGAC-TTGG---GTAGAGT-GATGTCTGGTT--- P_pygmaeus300005 --------------------TGCCCCTGAT-CTGG---GGAGAGA-GGGGCCTGG----- P_pygmaeus300089 --------------------TATCTCTGAC-CTGG---GTAGAGC-AGCATCTGGTTG-- P_pygmaeus300180 ---------------------TGTTCTGAC-ATGG---GAAGAGT-AGCTTCTAGTT--- P_pygmaeus300239 --------------------TGTCCTTGGC-CTGG---GTAGAGT-GGCACCT-GTT--- P_pygmaeus300241 --------------------TGTTCCCA-A-CCTG---GTAGAGT-AGCATCTGGTT--- P_pygmaeus300280 ------------------------CCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- P_pygmaeus300328 ----------------------TGTTACTC-TCTA---GCTTAAG-AACCTCTAATG--- P_pygmaeus300352 --------------------TTTCCCTGAC-CTGG---GTAGAGT-GGCATCCGGTT--- P_pygmaeus300408 --------------------TGCCCCTGAT-CTGG---GGAGAGA-GGGGCCTGG----- P_pygmaeus300428 --------------------TGTCCTTGGC-CTGG---GTAGAGT-GGCATCT-GTT--- P_pygmaeus300508 --------------------TGCCTCTGAC-CTGG---GTAGAGT-GGCATCTGG----- P_pygmaeus300751 --------------------TGTCCTTGAC-TCGG---GTAGAGT-GATGTCTGATT--- P_pygmaeus300769 --------------------TGTCCCTGAC-CTGG---GTAGAGT-GGCATCTGGTT--- S_cerevisiae300031 AATTAATCCTGGTGGAGGGGTGTGTTCAGT-TTGA--GGGAGGATGATAAAATGGAACG- S_araneus300103 --------------------TGTACCCGTG-CTAG---GGGAAGG-GGCACCTGG----- S_araneus300410 ---------------------------TGG-CTTG---ATAAGGG-GGCATCTGG----- S_araneus300607 --------------------TGTACCCGTG-CTAG---GGGAAGG-GGCACCTGG----- S_araneus300610 --------------------TGCCTCTGTG-CTTG---ATAGAGA-GGAATCTGG----- S_araneus300873 --------------------TGTCCCTGTG-CTTG---ATAGTAG-GGCATCTGG----- T_belangeri300026 --------------------TGTCCTTGGC-CTGG---ATAGAGT-GACATTTGG----- T_belangeri300036 ---------------------TGTCCCTGGCCTGG---GTAGAGT-GGCATCTGG----- T_belangeri300040 --------------------TGCGCCTGGC-CTGG---GTAGAGT-GGCATCTGA----- T_belangeri300074 ---------------------TTTCCTGGGTCTGG---GTCGAGT-GGCATCTGG----- T_belangeri300086 --------------------TGTCCCTGGC-CTGC---GTAGAGT-GACACCTGG----- T_belangeri300091 --------------------GTCCCCTGGC-CTGG----TAGAGT-GGCAGCTGG----- T_belangeri300128 --------------------TGTCCCTGGC-CTGG---GTAGAGT-GGTG---------- T_belangeri300132 --------------------TGTCCCTGGT-CTGG---GCAGAGT-GGCATCTGG----- T_belangeri300160 --------------------TGTCCCTGGC-CTGG---GTAGAGT-GACATCTTG----- T_belangeri300206 --------------------TGTCCCTGAC-CCAA---GTAGAGT-GGCTTTTGG----- T_belangeri300237 --------------------TGTTCCTGAC-CTTA---GTGGAAA-TGCCCCTAGGGT-- T_belangeri300244 ---------------------------GGGTCTGGCTCGCCGGAG-TGCATCTGG----- T_belangeri300252 ---------------------TGTCCCTGGCCTGG---GCAGAGT-GGCATCTGG----- T_belangeri300297 --------------------TATCCCTGG--TGGG---GTAGAGC-AGCACCACGTGG-- T_belangeri300349 --------------------TGTCCCTGGC-CTGA---ATAGAGT-GGTGTCTGT----- C_familiaris300025 -----GGTAGTGC----CTGCCTCATATTAGC-CAGGGACAAAGCAA--------CGCCT C_familiaris300339 --------GGTGC----CTGTCTCCTATCAGT-CGGGGACCGAGCAA--------CTCCT D_novemcinctus300331 ----TGGTGGTGC----TCATCTCATTTCATC-CAGGGACAGAGCAA--------CCCTT D_novemcinctus300389 ----TGGTGGTGC----CCATCTCCT----GC-CAACGACAGAGCAA--------TCCCT D_melanogaster300026 ---TTACTAGAATTGTTGCACTTTCCGCGGGCCCAGAGAGATA------------CTTCC E_caballus300344 -----GGTGGTGC----CTGTCTCATATCAGC-CAGGGACAAAGCAG--------CTCCT E_europaeus300046 ---CTTGTGGTGT----CCACTTCATATCAGC-CAGGGACAATG--------CAATTCCT E_europaeus300096 ---CTTGTGGTGT----CCATCTCATATTAGC-CAGGGAAAAAA--------CAATTCCT E_europaeus300103 ---CTTGTGGTGT----CCATCTCATATCATC-CAGGGACAAAA--------CGATTCCT E_europaeus300108 ---CT-GTGGTGG----CC-TCTCATCCCGGC-CAGGGACAAAG--------CGACTCCT E_europaeus300140 ---CTGGCAGTGT----CCATTTCATATTAGC-CAGGGACAAAG--------CAATTCCT E_europaeus300193 ---TTGGCTGTGT----CCATCTCACGTCAGC-CAGGAACAAAGA-------AAATTCCT E_europaeus300236 ---CTGGTGGTGT----CCATCTCATATCAGC-TGGGGGAAAAAAAAAT---CAATCCCT E_europaeus300259 TATCTGGTGGAGT----CCATCTCATCTCAGC-CAGGGACAAAG--------CAACTCCT E_europaeus300393 ---CTTGTGGTGT----CCATCTTATGTCAGC-CAGGACCAAAG--------CAATTCCT E_europaeus300431 ---CTGGTGGTGT----CCATTTCATATCAGC-CAGAGACAAAG--------CAATTCCT E_europaeus300624 ---CTAGTGGTGC----CCATCTCTTATCAGC-CAGGAACAAAG--------CAACTCCT F_catus300270 -----AGTGGTGC----CAGCCTCATATCAGT-CTGGGGCAAAGCAA--------TTCCT H_sapiens300010 ----TGGTGATGT----CCATCTCATGTCATC-CAGGGATAAAGCAA--------CCC-T H_sapiens300591 -----GGTGCTGC----CTATCTCATATAAGC-CAGGGACAAATCAA--------TGCCT H_sapiens300700 -----GGTGATGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CTCCT M_mulatta300009 -----GGTGGTGC----CCACCTCACATCAGC-CAGAGACAAAGCAA--------CCCCT M_mulatta300198 ---CTG-TGGCAT----TCATCTCATATCAGC-CAGGGACAAAG--------CAATCCCT M_mulatta300232 -----G-TGGTGC----CCATCTCATATCAGC-CAGCGATACAGCAA--------TCCCT M_mulatta300245 ---TTGATGGTGC----CCATCTCATGTCAGC-CAGGAACAAAGCAA--------CCCCT M_mulatta300252 -----GGTGGTGC----CCGTCTTATATCAGC-CAGGGACAAAGCAA--------CCCCT M_mulatta300267 ----TGGTGATGA----CCATCTCATGTCATC-CAGGGACAAAGCAA--------CCC-T M_mulatta300273 -----GGTGGTGT----CCATCTTGCATCAGT-CAGGGACAAAGCAA--------CCCCT M_mulatta300402 -----GGTGGTGC----CCATCTCATATCA-C-CAGGGACAAAGTAA--------CCCCT M_mulatta300508 -----GGTGGTAC----TTATCTCAAATCA-CACAGACATAAGGCAA--------CCTCT M_mulatta300615 -----GGTGCTGC----CTATCTCATATAAGC-CAGGGATGAATCAA--------TGCCT M_mulatta300715 -----GGTGGTGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CTCCT M_murinus300072 -----GGTGGTGC----CCATCTTGTATCAGC-CAGGAACAAAGCAA--------CCCCT M_murinus300097 ---TTGGTGGTGC-----CACCTCATATCAGC-CAGGGACAAAACAA--------CCGCT M_murinus300172 -----GGTGGTAC----CCATCTCATATCAGC-CAGGGACAAAGTAA--------CCCCT M_murinus300179 ---------GTGC----CCATCTCATATCAGC-CAGAGACAAAGCAA--------CCCCT M_murinus300249 -----GGTGGTGC----CCATCTCACAACAGA-CAGGGACAAAGCAA--------CCCTT M_murinus300285 -----GGCAGTGC----CCATCTCATAACAGC-CAGGGACAAAGCAA--------CCC-- M_murinus300310 -----GGTGGTGC----CCATCTCACATCATC-CAGGAACAAAGCAA--------CCCCT M_murinus300346 ---TTGGTGATGC----CCATCTCATATCAGC-CAGGGACAAGGCAC--------CCCCT M_murinus300357 -----GGTGGTGC----CCATTTCATATCAGC-CAGAGACAAAACAA--------CCCCT M_murinus300409 -----GGTGGTGC----CCATCTTGTATCAGC-CAGGAACAAAGCAA--------CCCCT M_murinus300485 -----AGTGGTGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CCCCT M_domestica300083 ---TTGGTGGTGT----TCTTCTCATATCAGT-CAGGGGCATAGCAACTGTATAGTC-CA M_lucifugus300603 -----GGTGATAC----TTGTCTTGAATCAGC-CAGGGACAGAAAAA--------CTCCT M_lucifugus300610 -----GGTGGTAC----TTGTCTCATATCGA--CAGGGACAAAGGAA--------CTCCT M_lucifugus300830 ---TTGTTGGTGC----TGCTCTTATACCAGT-TGGG-TCCAAGCAGAGATACAGTC-TT M_lucifugus300845 ---TTGGTGGTGT----TGCTCTT-TATCAGT-CAGG-GCAAAGCAGATTTATGGTCCTT M_lucifugus300898 ---TTGGTGGTGT----TGCTCTTATATCAGT-CAGGGGCAAAGCAGATGTACAGTCCTT M_lucifugus300987 ---TTGGTGGTGT----TGCTCTTATATGAAT-TAGGAGCAAAGCAGATGTACAGTCCTT O_anatinus303342 ---TTGGTGGTGC----CAGTCTTATATCAGG-CGGGGGCAGAGCAG---CCCAGTCCCT O_cuniculus300515 ---TTAGTGGTGC----CCATCT---ATCAGC-CAGGGACAAAGCAA--------ACCCT O_garnettii300059 -----GGTGGT-C----CTGTCTCATCTCAGC-CAGAGTCAAAGCAA--------CCCCC O_garnettii300152 --------GGTGC----CCATCTCGCATCAGCCCAGGGACAAAGCAA--------CTGCT O_garnettii300297 -----GGTGGTGC----CCATCTCATATCAGC-CAGGGGCAAAGCAA--------CCCCT O_garnettii300304 -----GGC-GTGT----CCCCCTCATATCGGC-CAGATACAAGCAC---------CCCCT O_garnettii300313 -----GGTCATGC----CCATCTCCTATCAGC-CAGAGACAAAGCAA--------CCCCC O_garnettii300425 ---TTGGTGGCGC----CCATCTTATATCAGC-CAGGGACAAAGTAA--------TCGTT O_garnettii300559 -----GGTGGTGC----CCATCTCATGTCAGC-CAGGGACAAAAAAAA-------CCCTT O_garnettii300604 -----GGTAGTGC----CCATCTCATATCAGC-CAGGGACAAAGAAA--------CCTCT P_troglodytes300038 -----G-TGGCGC----CCATTTCATATCAGC-CAGAGGTACAGCAA--------TTCCT P_troglodytes300055 ---CTG-TGACAT----TCATCTCATATCAGC-CAGGGACAAAG--------CAACCCCT P_troglodytes300088 ---CTGGTGGTAT----CCATGTCATACCAGC-TAGAAATGAAG--------AAACTGCT P_troglodytes300166 -----GGTGGAGC----CCATCTCACATTAGC-CAGAGACAAAGCAA--------CACCT P_troglodytes300229 -----GGTGGTGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CCCCT P_troglodytes300279 -----GGTGGTGC----CCATATTA-----GC-CAGGGACAAAGCAA--------CCCTT P_troglodytes300336 -----GGTGGTGT----CCATCTTGCATCAGT-CAGGGACAAAGCAA--------CCCCT P_troglodytes300371 -----GGTGGTGA----CCATCTAATACCAGC-CAGGGACAAAGCAA--------CCCCT P_troglodytes300378 ----TGGTGATGT----CCATCTCATGTCATC-CAGGGATAAAGCAA--------CCC-T P_troglodytes300483 ---TTGATGGTGC----CCATCTCACATCAAC-CAGGAACAAAGCAA--------CCCCC P_troglodytes300582 -----GGTGATGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CTCCT P_troglodytes300689 -----GGTGCTGC----CTATCTCATATAAGC-CAGGGACAAATCAA--------TGCCT P_pygmaeus300005 ---CTGGTGACAC----CCGTCTCATACCAGC-TAGGGATGAAG--------AAACCACT P_pygmaeus300089 -----G-TGGTGC----CCATCTCATATCAGC-CAGAGATACAGCAA--------TTCCT P_pygmaeus300180 -----GGTGGAGC----CCATCTCACATCAGC-CAGAGACAAAGCAA--------CCCCT P_pygmaeus300239 -----GGTGGTGC----CCATATTATATCAAC-CAGGGACAAAGCAA--------CCCCC P_pygmaeus300241 -----GGTGGTGA----CCATCTCATACCAGC-CAGGGACAAAGCAA--------CCCCT P_pygmaeus300280 -----GGTGGTGT----CCATCTTGCATCAGT-CAGGAACAAAGCAA--------CCCCT P_pygmaeus300328 ----TGGTGATGT----CCATCTCATGTCATC-CAGGGATAAGGCAA--------CCC-T P_pygmaeus300352 -----GGTGGTGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CCCCT P_pygmaeus300408 ---CTGGTGACAC----CCGTCTCATACCAGC-TAGGGATGAAG--------AAACCACT P_pygmaeus300428 -----GGTGGTGC----CCATATTATATCAAC-CAGGGACAAAGCAA--------CCCCC P_pygmaeus300508 ---CTG-TGACAT----TCATCTCATATCAGC-CAGGGACAAAG--------CAACCCCT P_pygmaeus300751 -----GGTGCTGC----CTATCTCGTATAAGC-CAGGGACAAATCAA--------TGCCT P_pygmaeus300769 -----GGTGATGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------CTCCT S_cerevisiae300031 ---GAGATTGCAAGGAGACGTAGAAAATAAAG-TAGGAGCAAATGGATTTTCTGCTTGGC S_araneus300103 ---TTAGTGGTGC----CCATCATATAGCAGC-CAGGCACAAAA--------CAATTCCT S_araneus300410 ---TTAGTGGTGC----CCATCTCATAGGAGC-CAGGGACATAG--------CAATTCCT S_araneus300607 ---TTAGTGGTGC----CCATCATATAGCAGC-CAGGCACAAAA--------CAATTCCT S_araneus300610 ---TCAGTGGTAC----CCATCTCCTA---GC-CAGGGACAAAG--------CAATTTCT S_araneus300873 ---TCAGTGGTAC----TCATCTTCTA---GC-CAGGGACAGAG--------CAAATCCT T_belangeri300026 ---CTGGTGCT-------CACCTCATAACAGC-CAGGGACAAAA--------CAACCCTT T_belangeri300036 ---CAGGTGGTGC----CCATCTCATATCAGT-CGGGGACAAAGCAA--------CTCCT T_belangeri300040 ---CTGGCAGTGC-----CACCTCACATCATC-CAGGGACAAAG--------CAACCCCT T_belangeri300074 ---CTGGTGATCC----CCATCTTATATCAGT-CAGGGACAAAGCAA--------CCCCT T_belangeri300086 ---CTAGTTGTGC----CCATCTCTTATCAGT-CAGGGACAAAGCAG--------CCCTG T_belangeri300091 ---CTGGCGGTGC----TCATGTCATACCAGC-TAGGGACAAAG--------CAAACCCT T_belangeri300128 -----------GC-----CATGTCAGATCAGC-CAGGAACAAAA--------CAACCTCT T_belangeri300132 ---CTGGTGGTGC----CCATCTCATATCAGC-CAGGGACAAAGCAA--------ACCCT T_belangeri300160 ---CTGGTGCTGC----TCATCTCATATCAGT-CAGGGACAAAA--------CAACCCCT T_belangeri300206 ---CTGGCAGTGC----CCATCTCCCATCAGC-CAGGGACAAAGCAA--------CCCCT T_belangeri300237 ---TTTACATTAAGGTGCTGCTCCATATCAAT-CAAGAACAAAGCGA--------CCCTT T_belangeri300244 ---CTGGTGGTGT----CCACCTCATATGAGT-CAGGGACAAAGCAA--------CCCCT T_belangeri300252 ---CTGGTGGTGC----CCATCTCATATCAGT-CAGGGACAAACCAA--------CCGCT T_belangeri300297 ---TTGGTGGTGT----TCCCCTCATATCAGC-CAGCAACAGCATAA--------CCCCT T_belangeri300349 ---TTGGTGGCAT----TCTTCTCTTATCAGT-GAGGGACAAAG--------CAACCCCT C_familiaris300025 TGTTTATCCCAGCTTGGCTTT-------TGGTCTGTGCCTGTGCC------TAGTTC-AT C_familiaris300339 TGTTTATCCAGGCTTGGCTTT-------TGGTCTGTGTTCATGCCC-----TGGCCACAT D_novemcinctus300331 TGTTCATCCCACCTTCGCTTT-------TGTAGCATGCCTATGCC------TGGTTC-AT D_novemcinctus300389 TGTTTACTGCAGCTTGGCTTT-------TCTATCATACTTAAGCC------TGGTTC-GT D_melanogaster300026 GGATAATCATAGGCTGCTGGTT--------TTCAATACCATAGTC------TATTTCATG E_caballus300344 TGTTCATCCCAGCTTGGCTTT-------TGGTCTGTGCCCATGCCTG------GTTC-AT E_europaeus300046 TGTTCAT-CTA--------TT-------TGGTCTATGCTCATGCC------TCATTC-AT E_europaeus300096 TGTTCATCCCAGCTTGGCCTT-------TGGTCTGTGCCCATGCT------TAGTTC-CT E_europaeus300103 TATTC-TCCCAGCTTGGCCTT-------AGGTCTGTGCCCATGCC------TGGTTC-AT E_europaeus300108 TGTTCATCCCGGCCCGGCCCT-------TGCTCTGTGCCCGTG-C------TGGTTC-AT E_europaeus300140 TTTTTCTCCCAACTTGGCTTT-------TGGTCTGTGCCCATGCT------TGGTTC-AT E_europaeus300193 TGTTTATTCCAGCTTGGCTTT-------GCATCTATACCC--GTC------TGGTTC-AT E_europaeus300236 TATTTATCCCACTTAGGCTTT-------TGGCCTGTGTC------------TGGTTC-AT E_europaeus300259 TATTTATCCCAGCTTGCCTTT-------CTGCCTGTGCCCATGTC------TGGTTC-AT E_europaeus300393 TTTTTATACTAGCTTGGACTT-------TGGTCTGTGTCCAGGC---------------- E_europaeus300431 TGTTTATCCC--CTTGGCTTT-------AGGCCTATGCCCATGTT------TGATTC-AT E_europaeus300624 TGTTCATCCTAACTTGCCTTT-------TGATCTGTGTCCATGCC------TGGTTC-AT F_catus300270 TGTTTATCCCAGCTTGGCTTT-------TGGTTTGTGCCGGTGCCTG------GTTC-AT H_sapiens300010 TGTTTATCCCATCTTGGCTCT-------TGGTCTGTGCCCATGGC------TGGTTC-GT H_sapiens300591 TATTTATTCCAGCTTGGCTTT-------TGGTCTGTGCCCATACC------TGGTTT-AT H_sapiens300700 TGTTCATCCCAGCTTGGCTTT-------TGATCCGTGCCCATGCC------TGGTTC-AT M_mulatta300009 TGTTTATCCCTGCTTGACTTT-------TGGCCTGTGTCTATGCC------TGGTCC-AT M_mulatta300198 TGTCTATCTCGGCTTGGCCTT-------TGGTCTGTGGCCGTGGC------TGCTTC-AT M_mulatta300232 TGTTTATCCC---TTGGCCTT-------TGGTCTGTACCCATGCC------TGGTTC-AT M_mulatta300245 TGTTTATCCCAGCTTGGCTTC-------TGGTCTATGCCCATGCC------TGGTTT-AT M_mulatta300252 CGTTCATCCCAGGTTGGCTTT-------TAATCTGTACCCATACC------TGGTTC-AT M_mulatta300267 TGTTTATCCCAGCTTGGCTCT-------TGGTCTGTGCCCATGGC------TGGTTC-GT M_mulatta300273 TGTTCATCTCAGCTTGGTTTC-------TGGCCTGTGCCCATGCC------TTGGAC-AA M_mulatta300402 TGTTCATCCCAGCTTGGCTTC-------TCATCTGTGCCTACGCC------TGGTTC-AT M_mulatta300508 TGTTTATCCCAGCTTGGCTTTT---------CTTATCTTTTTTTT------TTTTTTTTT M_mulatta300615 TATTTATCCCAGCTTGGCTTT-------TGGTCTGTGCCCATACC------TGGTTT-AT M_mulatta300715 TGTTCATCCCAGCTTGGCTTC-------TGATCTGTGCCCATGCC------TGGTTC-AT M_murinus300072 TGTTTATCCCAGCTTGGCTTT-------TTGTTTGTGCCTATGCC------TGGTTC-AT M_murinus300097 TGTTTATCACAGCTTGGCTTT-------TGGTGTGTGCTTATGTC------TGGTTC-AA M_murinus300172 TGTTTATCCGAGGTTGGCTTT-------TGATCTGTTCTCATGCC------TGGTTC-AT M_murinus300179 TGTTTATCCCAGCTTAGCTTT-------TGGTCTGTGTCCATGCC------TTGGAG-AC M_murinus300249 TGTTTATCCCAGCTTGGCTTT-------TGGTCTGTGCCCATGCC------TGGTTC-AT M_murinus300285 TATTTGTCCCAGCTTGGCTTT-------TGGTCTGTGCCCATACA------TGGTTC-AT M_murinus300310 TGTTTATCCCAGCTAGGCTTT-------TGGTCTGTGCCTATGCC------TGGTTC-AT M_murinus300346 TGTTTATCCCAG-------------------------------CT------TGGTTC-AT M_murinus300357 TGTTTACCCCACCTT-GCCTT-------TTGTTTGTGCCCATGCC------T-GGAT-AC M_murinus300409 TGTTTATCCCAGCTTGGCTTT-------TTGTTTGTGCCTATGCC------TGGTTC-AT M_murinus300485 TGTTTATCCCAGCTTGGCTTC-------TGGTCTGTGCCTATGCC------TGGTTC-AT M_domestica300083 AGTTCATCCCAGCTTGATGCTT------TGCTTGGTAGTCATAGC------TGGTTC-AT M_lucifugus300603 TGTTTATCCCAGCTTGGCTTT-------AGGTCTGTGCCCATGCC------TGGCTA-AT M_lucifugus300610 TGTTTATCCTAGCTTGGCTTT-------TGGTCTGTGCCTGTGCCTGTGCCTGGTTC-AT M_lucifugus300830 AATTCATCCTACCTTGATGCCT------GTGTTGGTGGCCAGAGC------TGTTTC-AT M_lucifugus300845 AGTTTATCGTAGCTTGATGCCT------GTGTTGGTGGCCAGAGC------TGTTTC-AT M_lucifugus300898 AGTTCATCCTAGCTTGATGCCT------GTGTCGGTGGCCAGAGC------TGTTTC-AT M_lucifugus300987 AGTTCATTCTAGTTTGATATCT------GTGTCGGTGGCTAGAGC------TCTTTC-AT O_anatinus303342 -GTTCATCCCAGCCCAACGCCC------CGGGTAGTGGCCGCGGC------TGGTTC-AT O_cuniculus300515 TGTTTATCCCAGCTTGGCTTT-------TGGTCTGTGCCCCTGCC------TGGGTC-AT O_garnettii300059 TATTTATGCCAGCTTGGCTTT-------TAGTCTGTGCCCATGCC------TGGTTC-AT O_garnettii300152 CATTTATCCCAGCTTGTTTTTT------TGGCCTGTGCCTATATC------TGGCTC-AT O_garnettii300297 TGCTTATCCCAGCTTGGCTTC-------TGGTCTGTGCCCATGCT------TGGTTC-AT O_garnettii300304 TGTTTATCCCAGCTTGGCATT-------TGATCTGTCCTTACACC------TGGTTC-AT O_garnettii300313 TGTTTGTCCCAACTTGGCTTT-------CCATCTGTGCCCAGGCT------TGGTTC-AT O_garnettii300425 TGCTTACCTCAGGCTGGC-TTC------TGAGC----TCATGCCC------TGGTTC-AT O_garnettii300559 TGTTTATCCCAGCTTGGCTTT-------TGATCTGTGCTTATGCC------TGGTTC-AT O_garnettii300604 TGTTTATCCCAGCTTGGCTTT-------TGATCTGTGCTTATGCC------TGGTTC-AT P_troglodytes300038 TGTTTATCCCAGCTTGGCTTT-------TAGTCTGTGCCCACGCC------TGGTTC-AC P_troglodytes300055 TGTTTATTTCAGCTTGGCCTT-------TTGTCTGTGCCCATGCC------TGGTTC-AT P_troglodytes300088 TGCTCATCCCAGCCTGGCTCC-------TGGTCTATGCCCATGCC------TGGTTT-AT P_troglodytes300166 TGTTTATCCCGGCTTGGCTTT-------TGGCCTGTGTCCATGAC------TGGTCC-AT P_troglodytes300229 TGTTCCTCCCAGCTTGGCTTT-------TCATCTGTGCCTATGCC------TGGTTC-AT P_troglodytes300279 TGTTCATCCCAGCTTGACTTT-------TGATCTGTACCTATACC------TGGTTC-AT P_troglodytes300336 TGTTCATCCCAGCTTGGTTTC-------TGGCCTGTTCCCATGCC------TTGGAC-AA P_troglodytes300371 TGTTTATCCCAGCTTGGCTTT-------TGGTCTGTGCCCATGCT------TGGTTC-AT P_troglodytes300378 TGTTTATCCCAGCTTGGCTCT-------TGGTCTGTGCCCATGGC------TGGTTC-GT P_troglodytes300483 TGTTTATCCCAGCTTGGCTTC-------TGGTCTATGCCCATGCC------TGGTTT-AT P_troglodytes300582 TGTTCATCCCAGCTTGGCTTT-------TGATCCGTGCCCATGCC------TGGTTC-AT P_troglodytes300689 TATTTATTCCAGCTTGGCTTT-------TGGTCTGTGCCCATACC------TGGTTT-AT P_pygmaeus300005 TGCTCATCCCAGCCTGGCTCC-------TGGTCTATGCCCATGCC------TGGTTC-AT P_pygmaeus300089 TGTTTATCCCAGCTTGGCTTT-------TAGTCTGTGCCTATACC------TGGTGC-AT P_pygmaeus300180 TGTTTATCCCAGCTTGGCTTT-------TGGCCTGTGTCCATGCC------TGGTCC-AT P_pygmaeus300239 TGTTCATCCCAGCTTGGCTTT-------TGATCTGTACCTATACC------TGGTTC-AT P_pygmaeus300241 TGTTTATCCTAGCTTGGCTTT-------TGGTTTGTGCCCATGCT------TGGTTC-AT P_pygmaeus300280 TGTTCATCCCAGCTTGGTTTC-------TGGCCTGTTCCCATGCC------TTGGAC-AA P_pygmaeus300328 TGTTTATCCCAGCTTGGCTCT-------TGGTCTGTGCCCATGGC------TGGTTC-GT P_pygmaeus300352 TGTTCCTCCCAGCTTGGCTTT-------TCATCTGTGCCTATGCC------TGGTTC-AT P_pygmaeus300408 TGCTCATCCCAGCCTGGCTCC-------TGGTCTATGCCCATGCC------TGGTTC-AT P_pygmaeus300428 TGTTCATCCCAGCTTGGCTTT-------TGATCTGTACCTATACC------TGGTTC-AT P_pygmaeus300508 TGTTTATCTCAGCTTGGCCTT-------TGGTCTGTGCCCATGCC------TGGTTC-AT P_pygmaeus300751 TATTTATCCCGGCTTGGCTTT-------TGGTCTGTGCCCATACC------TGGTTT-AT P_pygmaeus300769 TGTTCATCCCAGCTTGGCTTT-------TGATCTGTGCCCATGCC------TGGTTC-AT S_cerevisiae300031 GGTATAGCAC-GTTTGAGTTTTTCAGTCGTGTCTATGTTCAGGTTTA----TGATATGCT S_araneus300103 TGCTTATCCCAGCATGGTTTTAGGTTTATGCCCTGTGCCCTTGCT------CGGTTC-AT S_araneus300410 TGTTCATTCTCATGTGACTTT-------TGTTCTATGCCCTTGTC------TGGTTC-AT S_araneus300607 TGCTTATCCCAGCATGGTTTTAGGTTTATGCCCTGTGCCCTTGCT------CGGTTC-AT S_araneus300610 TTCTTTTTCCAGAGTGGCTTT-------TGGTCTGTGCCCTTACC------TGGTTC-AT S_araneus300873 TGTTTATCCCTGACTGGCTTT-------TGGTCT-------TGTC------TGGTTC-AT T_belangeri300026 CATTTATCCCAGTTTGACTTT-------TGGTTAGTGCCCATACC------TGGTTC-AT T_belangeri300036 TGTTCATCCCAGCTTGGC-TTT------TGGTCAGTGCTCTTGCC------TGGTTC-AT T_belangeri300040 TGTTTACCCCAGCTTGGCTTT-------TGGTCAGTGGCCATGCC------TGATTC-AC T_belangeri300074 TGTTCATCCCAGCTTGGC-TTT------GAATCAGTGTCCTTGCC------TGGTTC-AT T_belangeri300086 TGTTCATCCCACCTTGGCTTTT------GGG-CAGTGCCCTTGCC------TAGTTC-AT T_belangeri300091 TGTTTATCCCAGCTTGGCTTT-------TAGTCACTGCCCATTCC------CAGTTC-AT T_belangeri300128 TGTTCATCCCAGCTTGACTTT-------TGGTCAGTGGCCTTGCC------TGATTC-AT T_belangeri300132 CGTGTATCCCAGCGTGGC-TTT------TGGTCAGTGCCCATGCC------TGGTTC-AT T_belangeri300160 TGTTTATCCCAGCTTGGCTTT-------TGGTCAGGGCCCTTGCC------TGGTTT-TT T_belangeri300206 TGTTTACCCCAGCTTGATTTT-------TGGTCAGTACCTATGCC------TGGTTC-AT T_belangeri300237 TGTTTATGCCAGCTTGGCTTT-------TAGTCTGTGCCCATGCC------TGGTTT-AT T_belangeri300244 TCTTCATCCCAGCTTGGC-TTT------TGGACAGCGCCCTTGCC------TGGTTC-AT T_belangeri300252 TGTTCATCCTAGATTGGC-TTT------TGGTCAGTGCCTTTGCC------TGGTTC-AT T_belangeri300297 TGTTTATCCCAGCTTGACTCT-------TGGTCTGTTCTCATGCC------TGGTTC-AT T_belangeri300349 --GTTATTCTAGGTTGGCTTT-------TGGTCAGTGCCCATGGC------TGGTTC-AT C_familiaris300025 GC-CCTGGACATGTGG-------------------------------------------- C_familiaris300339 GC---------------------------------------------------------- D_novemcinctus300331 GC-CTAGGACACACGG-------------------------------------------- D_novemcinctus300389 GC-CTAAGACATACGT-------------------------------------------- D_melanogaster300026 GCCGGCAAACAAAT---------------------------------------------- E_caballus300344 GC-CCTGGACACATGG-------------------------------------------- E_europaeus300046 GC-TTTGGATATACTG-------------------------------------------- E_europaeus300096 GC-CTTGGATATATTG-------------------------------------------- E_europaeus300103 GC-CTGGGATATATTG-------------------------------------------- E_europaeus300108 GCCC-TGGACACAGCA-------------------------------------------- E_europaeus300140 GC-CTTGGATATATGG-------------------------------------------- E_europaeus300193 GC-CTTGGATATATAT-------------------------------------------- E_europaeus300236 GC-CAAAAATTTATGG-------------------------------------------- E_europaeus300259 ACCTTTGGATATATGG-------------------------------------------- E_europaeus300393 ---CTTGGATATATTG-------------------------------------------- E_europaeus300431 GC-CTTGGATATATAG-------------------------------------------- E_europaeus300624 GC-TGTAGGTATACAG-------------------------------------------- F_catus300270 GC-CCTGGACACATGG-------------------------------------------- H_sapiens300010 GC-CTTGGATACATGG-------------------------------------------- H_sapiens300591 GC-CTTGGACACATGG-------------------------------------------- H_sapiens300700 GC-CTTGGACACATAG-------------------------------------------- M_mulatta300009 GC-CTTGATGGAAGGA-------------------------------------------- M_mulatta300198 GC-CTTGGACACATTG-------------------------------------------- M_mulatta300232 GT-GTGGAAAATATGG-------------------------------------------- M_mulatta300245 GC-TTTGGACACATAG-------------------------------------------- M_mulatta300252 GC-CTTGGACATATGG-------------------------------------------- M_mulatta300267 GC-CTTGGATACATGG-------------------------------------------- M_mulatta300273 AC-AG------------------------------------------------------- M_mulatta300402 GC-CTTGGACACATTA-------------------------------------------- M_mulatta300508 TTTTTTAGACAGGGTC-------------------------------------------- M_mulatta300615 GC-CTTGGACACATGG-------------------------------------------- M_mulatta300715 GC-CTTGGACACATAC-------------------------------------------- M_murinus300072 GC-CCTGGTCACATGA-------------------------------------------- M_murinus300097 GC-CTTTAACACATGG-------------------------------------------- M_murinus300172 GC-CTTGGCCATATGG-------------------------------------------- M_murinus300179 AT-G-G------------------------------------------------------ M_murinus300249 GT-CTTGGACACATAG-------------------------------------------- M_murinus300285 GC-CTTGGACACGTGG-------------------------------------------- M_murinus300310 GC-CTTGGTCACATGA-------------------------------------------- M_murinus300346 GC-CTTGGACACATGG-------------------------------------------- M_murinus300357 AA-G-GAAAAATAAATTC------------------------------------------ M_murinus300409 GC-CCTGGTCACATGA-------------------------------------------- M_murinus300485 GC-CTTGGTCACATGA-------------------------------------------- M_domestica300083 GC-CCTGGGCACATAA-------------------------------------------- M_lucifugus300603 GC-CTTGGACCATGTG-------------------------------------------- M_lucifugus300610 GT-CCTG-ACACATAG-------------------------------------------- M_lucifugus300830 GC-CTGGGGCACATAA-------------------------------------------- M_lucifugus300845 GT-CTGGGACACACTA-------------------------------------------- M_lucifugus300898 GC-CTGAGGCACATAA-------------------------------------------- M_lucifugus300987 GC-CTGAGGCACATAT-------------------------------------------- O_anatinus303342 GG-CTCGGACACATCG-------------------------------------------- O_cuniculus300515 GC-CTGGGACACACGG-------------------------------------------- O_garnettii300059 AC-CTTGGACACATGG-------------------------------------------- O_garnettii300152 GG-TTCCGACCCAGGA-------------------------------------------- O_garnettii300297 GC-CTTGGACACATGG-------------------------------------------- O_garnettii300304 GC-CTGGGGTACCTGG-------------------------------------------- O_garnettii300313 GC-CTTGGATATATGG-------------------------------------------- O_garnettii300425 GC-CTTGGACACATGG-------------------------------------------- O_garnettii300559 GC-CTGGGGCACATGA-------------------------------------------- O_garnettii300604 GC-TTAGGGCACATGG-------------------------------------------- P_troglodytes300038 AT-GTGGAAAATATAG-------------------------------------------- P_troglodytes300055 GC-CTTGGACACACTG-------------------------------------------- P_troglodytes300088 GCCT-TGGACATATCA-------------------------------------------- P_troglodytes300166 AC-CTTGGACACATGG-------------------------------------------- P_troglodytes300229 GC-CTTGGACACATTT-------------------------------------------- P_troglodytes300279 GC-CTTAGACACATGG-------------------------------------------- P_troglodytes300336 AC-AA------------------------------------------------------- P_troglodytes300371 GC-CTTGGACACATGG-------------------------------------------- P_troglodytes300378 GC-CTTGGATACATGG-------------------------------------------- P_troglodytes300483 GC-TTTGGACACATAG-------------------------------------------- P_troglodytes300582 GC-CTTGGACACATAG-------------------------------------------- P_troglodytes300689 GC-CTTGGACACATGG-------------------------------------------- P_pygmaeus300005 GCCT-TGAACATATCA-------------------------------------------- P_pygmaeus300089 GT-GCAGAAAATATGG-------------------------------------------- P_pygmaeus300180 GC-CTTGGACACATGG-------------------------------------------- P_pygmaeus300239 GC-CTTGGACACATGG-------------------------------------------- P_pygmaeus300241 GC-CTTGGACACATGG-------------------------------------------- P_pygmaeus300280 AC-AA------------------------------------------------------- P_pygmaeus300328 GC-CTTGGATACATGG-------------------------------------------- P_pygmaeus300352 GC-CTTGGACACATTT-------------------------------------------- P_pygmaeus300408 GCCT-TGGACATATCA-------------------------------------------- P_pygmaeus300428 GC-CTTGGACACATGG-------------------------------------------- P_pygmaeus300508 GC-CTTGGACACATTG-------------------------------------------- P_pygmaeus300751 GC-CTTGGACACACGG-------------------------------------------- P_pygmaeus300769 GC-CTTGGACACATAG-------------------------------------------- S_cerevisiae300031 GTGGTTGATTCTGTTGATTCACACGTTTCGCTTCCATATAGTGTGTTAACGGAAACTCCA S_araneus300103 GGCC-TAGACACAGAG-------------------------------------------- S_araneus300410 GCCCCTGAATACAGAA-------------------------------------------- S_araneus300607 GGCC-TAGACACAGAG-------------------------------------------- S_araneus300610 GTGC-TATGAGTAGTA-------------------------------------------- S_araneus300873 GTCG-TGGACATAGAC-------------------------------------------- T_belangeri300026 GC-CTTGGACACATGA-------------------------------------------- T_belangeri300036 GC-CTTGGACACATGG-------------------------------------------- T_belangeri300040 GC-TTTGGACATCTGG-------------------------------------------- T_belangeri300074 GC-CTTGGACACATGG-------------------------------------------- T_belangeri300086 GC-CTTGGACACATGG-------------------------------------------- T_belangeri300091 GT-CTTGGACACATGG-------------------------------------------- T_belangeri300128 GA-CTTGGACCCATGG-------------------------------------------- T_belangeri300132 GC-CTTGGACACATGG-------------------------------------------- T_belangeri300160 GA-CGTGGACATATGA-------------------------------------------- T_belangeri300206 GC-CTTGAACATGAAA-------------------------------------------- T_belangeri300237 GT-CTTGAACACAAGA-------------------------------------------- T_belangeri300244 GC-CCTGGACACATGG-------------------------------------------- T_belangeri300252 GC-CTTGGACACGTAG-------------------------------------------- T_belangeri300297 GC-CTTGGACACAAGG-------------------------------------------- T_belangeri300349 GC-CTTGGACAGATGG-------------------------------------------- C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 TGTTAAGGTTTATTATAAGAAAATTTTTTGAATTTGTTCTTTTTATATTGGTTTACTCTC S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 CTCGTGATTTCTTTTCTTTTTTTATCGTCATCCTCTCTGAATGTATTTATTACGCATGGC S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 TTTTATTCATTGCTTTCTAACTGTGATGGGAGTTTTTTTCTTGTTGCATAAATGAACGTG S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 GGCGAGGTTTTTATTTTCAAACTTGGTGTACTATAGTGCAATGCGTTGTTAATTGTAATA S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 CGATGTTTCTTCGATAAAAGGAGCGGAGGGAGAAGGTGAAATTACGAAGGAAAGAAAGAG S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 ATGAGAAATCAAGAATGAAGCAAGACATTGATTGATATGGTTGTTTTCGGTGCATGTTTG S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 ------------------------------------------------------------ C_familiaris300339 ------------------------------------------------------------ D_novemcinctus300331 ------------------------------------------------------------ D_novemcinctus300389 ------------------------------------------------------------ D_melanogaster300026 ------------------------------------------------------------ E_caballus300344 ------------------------------------------------------------ E_europaeus300046 ------------------------------------------------------------ E_europaeus300096 ------------------------------------------------------------ E_europaeus300103 ------------------------------------------------------------ E_europaeus300108 ------------------------------------------------------------ E_europaeus300140 ------------------------------------------------------------ E_europaeus300193 ------------------------------------------------------------ E_europaeus300236 ------------------------------------------------------------ E_europaeus300259 ------------------------------------------------------------ E_europaeus300393 ------------------------------------------------------------ E_europaeus300431 ------------------------------------------------------------ E_europaeus300624 ------------------------------------------------------------ F_catus300270 ------------------------------------------------------------ H_sapiens300010 ------------------------------------------------------------ H_sapiens300591 ------------------------------------------------------------ H_sapiens300700 ------------------------------------------------------------ M_mulatta300009 ------------------------------------------------------------ M_mulatta300198 ------------------------------------------------------------ M_mulatta300232 ------------------------------------------------------------ M_mulatta300245 ------------------------------------------------------------ M_mulatta300252 ------------------------------------------------------------ M_mulatta300267 ------------------------------------------------------------ M_mulatta300273 ------------------------------------------------------------ M_mulatta300402 ------------------------------------------------------------ M_mulatta300508 ------------------------------------------------------------ M_mulatta300615 ------------------------------------------------------------ M_mulatta300715 ------------------------------------------------------------ M_murinus300072 ------------------------------------------------------------ M_murinus300097 ------------------------------------------------------------ M_murinus300172 ------------------------------------------------------------ M_murinus300179 ------------------------------------------------------------ M_murinus300249 ------------------------------------------------------------ M_murinus300285 ------------------------------------------------------------ M_murinus300310 ------------------------------------------------------------ M_murinus300346 ------------------------------------------------------------ M_murinus300357 ------------------------------------------------------------ M_murinus300409 ------------------------------------------------------------ M_murinus300485 ------------------------------------------------------------ M_domestica300083 ------------------------------------------------------------ M_lucifugus300603 ------------------------------------------------------------ M_lucifugus300610 ------------------------------------------------------------ M_lucifugus300830 ------------------------------------------------------------ M_lucifugus300845 ------------------------------------------------------------ M_lucifugus300898 ------------------------------------------------------------ M_lucifugus300987 ------------------------------------------------------------ O_anatinus303342 ------------------------------------------------------------ O_cuniculus300515 ------------------------------------------------------------ O_garnettii300059 ------------------------------------------------------------ O_garnettii300152 ------------------------------------------------------------ O_garnettii300297 ------------------------------------------------------------ O_garnettii300304 ------------------------------------------------------------ O_garnettii300313 ------------------------------------------------------------ O_garnettii300425 ------------------------------------------------------------ O_garnettii300559 ------------------------------------------------------------ O_garnettii300604 ------------------------------------------------------------ P_troglodytes300038 ------------------------------------------------------------ P_troglodytes300055 ------------------------------------------------------------ P_troglodytes300088 ------------------------------------------------------------ P_troglodytes300166 ------------------------------------------------------------ P_troglodytes300229 ------------------------------------------------------------ P_troglodytes300279 ------------------------------------------------------------ P_troglodytes300336 ------------------------------------------------------------ P_troglodytes300371 ------------------------------------------------------------ P_troglodytes300378 ------------------------------------------------------------ P_troglodytes300483 ------------------------------------------------------------ P_troglodytes300582 ------------------------------------------------------------ P_troglodytes300689 ------------------------------------------------------------ P_pygmaeus300005 ------------------------------------------------------------ P_pygmaeus300089 ------------------------------------------------------------ P_pygmaeus300180 ------------------------------------------------------------ P_pygmaeus300239 ------------------------------------------------------------ P_pygmaeus300241 ------------------------------------------------------------ P_pygmaeus300280 ------------------------------------------------------------ P_pygmaeus300328 ------------------------------------------------------------ P_pygmaeus300352 ------------------------------------------------------------ P_pygmaeus300408 ------------------------------------------------------------ P_pygmaeus300428 ------------------------------------------------------------ P_pygmaeus300508 ------------------------------------------------------------ P_pygmaeus300751 ------------------------------------------------------------ P_pygmaeus300769 ------------------------------------------------------------ S_cerevisiae300031 ATTACTAAAAGTTGGGGCATTCGATGGTTTACAGAAGTCATAAATTCAAATATCCCGTTT S_araneus300103 ------------------------------------------------------------ S_araneus300410 ------------------------------------------------------------ S_araneus300607 ------------------------------------------------------------ S_araneus300610 ------------------------------------------------------------ S_araneus300873 ------------------------------------------------------------ T_belangeri300026 ------------------------------------------------------------ T_belangeri300036 ------------------------------------------------------------ T_belangeri300040 ------------------------------------------------------------ T_belangeri300074 ------------------------------------------------------------ T_belangeri300086 ------------------------------------------------------------ T_belangeri300091 ------------------------------------------------------------ T_belangeri300128 ------------------------------------------------------------ T_belangeri300132 ------------------------------------------------------------ T_belangeri300160 ------------------------------------------------------------ T_belangeri300206 ------------------------------------------------------------ T_belangeri300237 ------------------------------------------------------------ T_belangeri300244 ------------------------------------------------------------ T_belangeri300252 ------------------------------------------------------------ T_belangeri300297 ------------------------------------------------------------ T_belangeri300349 ------------------------------------------------------------ C_familiaris300025 --------------------------------------------------------- C_familiaris300339 --------------------------------------------------------- D_novemcinctus300331 --------------------------------------------------------- D_novemcinctus300389 --------------------------------------------------------- D_melanogaster300026 --------------------------------------------------------- E_caballus300344 --------------------------------------------------------- E_europaeus300046 --------------------------------------------------------- E_europaeus300096 --------------------------------------------------------- E_europaeus300103 --------------------------------------------------------- E_europaeus300108 --------------------------------------------------------- E_europaeus300140 --------------------------------------------------------- E_europaeus300193 --------------------------------------------------------- E_europaeus300236 --------------------------------------------------------- E_europaeus300259 --------------------------------------------------------- E_europaeus300393 --------------------------------------------------------- E_europaeus300431 --------------------------------------------------------- E_europaeus300624 --------------------------------------------------------- F_catus300270 --------------------------------------------------------- H_sapiens300010 --------------------------------------------------------- H_sapiens300591 --------------------------------------------------------- H_sapiens300700 --------------------------------------------------------- M_mulatta300009 --------------------------------------------------------- M_mulatta300198 --------------------------------------------------------- M_mulatta300232 --------------------------------------------------------- M_mulatta300245 --------------------------------------------------------- M_mulatta300252 --------------------------------------------------------- M_mulatta300267 --------------------------------------------------------- M_mulatta300273 --------------------------------------------------------- M_mulatta300402 --------------------------------------------------------- M_mulatta300508 --------------------------------------------------------- M_mulatta300615 --------------------------------------------------------- M_mulatta300715 --------------------------------------------------------- M_murinus300072 --------------------------------------------------------- M_murinus300097 --------------------------------------------------------- M_murinus300172 --------------------------------------------------------- M_murinus300179 --------------------------------------------------------- M_murinus300249 --------------------------------------------------------- M_murinus300285 --------------------------------------------------------- M_murinus300310 --------------------------------------------------------- M_murinus300346 --------------------------------------------------------- M_murinus300357 --------------------------------------------------------- M_murinus300409 --------------------------------------------------------- M_murinus300485 --------------------------------------------------------- M_domestica300083 --------------------------------------------------------- M_lucifugus300603 --------------------------------------------------------- M_lucifugus300610 --------------------------------------------------------- M_lucifugus300830 --------------------------------------------------------- M_lucifugus300845 --------------------------------------------------------- M_lucifugus300898 --------------------------------------------------------- M_lucifugus300987 --------------------------------------------------------- O_anatinus303342 --------------------------------------------------------- O_cuniculus300515 --------------------------------------------------------- O_garnettii300059 --------------------------------------------------------- O_garnettii300152 --------------------------------------------------------- O_garnettii300297 --------------------------------------------------------- O_garnettii300304 --------------------------------------------------------- O_garnettii300313 --------------------------------------------------------- O_garnettii300425 --------------------------------------------------------- O_garnettii300559 --------------------------------------------------------- O_garnettii300604 --------------------------------------------------------- P_troglodytes300038 --------------------------------------------------------- P_troglodytes300055 --------------------------------------------------------- P_troglodytes300088 --------------------------------------------------------- P_troglodytes300166 --------------------------------------------------------- P_troglodytes300229 --------------------------------------------------------- P_troglodytes300279 --------------------------------------------------------- P_troglodytes300336 --------------------------------------------------------- P_troglodytes300371 --------------------------------------------------------- P_troglodytes300378 --------------------------------------------------------- P_troglodytes300483 --------------------------------------------------------- P_troglodytes300582 --------------------------------------------------------- P_troglodytes300689 --------------------------------------------------------- P_pygmaeus300005 --------------------------------------------------------- P_pygmaeus300089 --------------------------------------------------------- P_pygmaeus300180 --------------------------------------------------------- P_pygmaeus300239 --------------------------------------------------------- P_pygmaeus300241 --------------------------------------------------------- P_pygmaeus300280 --------------------------------------------------------- P_pygmaeus300328 --------------------------------------------------------- P_pygmaeus300352 --------------------------------------------------------- P_pygmaeus300408 --------------------------------------------------------- P_pygmaeus300428 --------------------------------------------------------- P_pygmaeus300508 --------------------------------------------------------- P_pygmaeus300751 --------------------------------------------------------- P_pygmaeus300769 --------------------------------------------------------- S_cerevisiae300031 AATCGCTCATCTATTAAAATCAATAGTAGAATGTAGTTTCATACCCGGGAGAAATTC S_araneus300103 --------------------------------------------------------- S_araneus300410 --------------------------------------------------------- S_araneus300607 --------------------------------------------------------- S_araneus300610 --------------------------------------------------------- S_araneus300873 --------------------------------------------------------- T_belangeri300026 --------------------------------------------------------- T_belangeri300036 --------------------------------------------------------- T_belangeri300040 --------------------------------------------------------- T_belangeri300074 --------------------------------------------------------- T_belangeri300086 --------------------------------------------------------- T_belangeri300091 --------------------------------------------------------- T_belangeri300128 --------------------------------------------------------- T_belangeri300132 --------------------------------------------------------- T_belangeri300160 --------------------------------------------------------- T_belangeri300206 --------------------------------------------------------- T_belangeri300237 --------------------------------------------------------- T_belangeri300244 --------------------------------------------------------- T_belangeri300252 --------------------------------------------------------- T_belangeri300297 --------------------------------------------------------- T_belangeri300349 ---------------------------------------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved