snOPY snoRNA Orthological Gene Database

Family: SNORA46

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300066 -AGCACTGTATTGAAGC-CTGTGG-AATAGAATCGTCCCCA--TTCTTGG C_familiaris300418 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATTTTCCCCA--TTCTTGG C_porcellus300919 -AGCACTATATTTAAAC--TATGG-ATGGGAATTTTCCCCA--TTCTTGG D_novemcinctus300150 -ACCACTATATTTAAACCCTGTGG-ATAGGAATTTTCCTCA--TTCTTGA D_novemcinctus300524 -AGCACTATATTTAAAC-CTATGG-ATGGGAATTTTCCCCA--TTCTTGG E_telfairi300063 -AACGCTATACTTAAAC-CAATGG-ATGGGCATTTTCCCCA--TTCTCGG E_telfairi300124 -AGCACTATATTTAAAC-CAATGG-ATGGACATTTTCCCCA--TTCTCGG E_telfairi300126 -AGCGCTATATTTAAAC-CAATGGGATGGACCTTTTCCCCCATTTCTAGG E_telfairi300858 -AGCACTATATTTAAAC-CAATGG-ATGGACATTTTCCCCA--TTCTCGG E_caballus300248 -AGCACTATGTTTAAGC-CTGTGG-ATGGGAATTTTCCCCA--TTCTTGG E_europaeus300586 -AGCACTATATTTAAA--CTGTGG-ACGGGAACCCTCCCTG--TTCTTGG E_europaeus300687 -CGCACTATATTTAAAC--TGTGG-ATGGGAATCTTTACCA--TTCTTAG F_catus300165 -CACTATATATCTAAAC-CTGTCA-ATGGGAATTGTCCCCT--TTCTTGG F_catus300253 -TGCACTATTCTTTAAACCTGTGG-ATGGGAATTTTCCCCA--TTCTTGG G_gallus300044 -AGCACTATTTTTAAAC-CTGTTG-GTGGATTTTCCTGGCCA-TCATGGG G_gorilla300239 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATATTCCCCA--TTCTTGG H_sapiens300589 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATATTCCCCA--TTCTTGG H_sapiens300720 -------------AATCTTACTAGAAAAGTGAATGGCCA----TTCTTGG L_africana300483 -AGCACTATATTTAAAC-CAATGA-ATGGAAATTTTCCCCG--TTCTTGG M_mulatta300558 ---------AGTGAATCTTAGCAGAAAAGTGAATGGCCA----TTCTTGG M_mulatta300613 -AGCACTATATTTAAAC-CTGTGG-ATGGAAATATTCCCCA--TTCTTGG M_murinus300538 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATTTTCCCCA--TTCTTGG M_murinus300528 ------GTTATTAAAATGTTACCC------CATTTTCCCCA--TTCTTGG M_musculus300400 CAGAAGT-TGGGTAAGC--CATGA-ATGGGAAATTTCCTCA--TTCTTGG M_musculus300809 -AGCACTATATTTAAAC-CTATGT-ATGGGAAATTTCCCCA--TTCTTGG M_musculus300354 -AGCACTATATTTAAAC-CTATGG-ATGGGAAATTTCCCCA--CTCTGGA M_lucifugus300955 -GGCACTATATTTAAAC-CTGTGT-ATGGGAATTCTCCCCA--TTCTAGG O_anatinus304514 -AGCACTATTTTTAAAC-CTATTG-ATGGAAAA-CCTCACCA-TCCTAGG O_cuniculus300370 -AGCACTATATTTAAAC-CTACCG-ATGAGAATTTTCCTCA--TTCTTGG O_cuniculus300484 -AGCACTATATTTAAAC-CTATGG-ATGAGAATTTTCCTCA--TTCTTGG O_garnettii300463 -AGCACTATATTTAAGC-CTATGG-ACAGGAATCTTCCCCA--TTCTTGG O_garnettii300601 -AGCACTATATTTAAAA-CTGTGG-GTGGGAATTTTCCTCA--TTGTTGG P_troglodytes300557 -------------AATCTTACTAGAAAAGTGAATGGCCA----TTCTTGG P_troglodytes300687 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATATTCCCCA--TTCTTGG P_pygmaeus300749 -AGCACTATATTTAAAC-CTGTGG-ATGGGCGTATTCCCCA--TTCTTGG P_pygmaeus300788 ---------AGTGACTCTTACTAGAAAAGTGAATGGCCA----TTCTTAG R_norvegicus300374 -AGCACTATATTTAAAC-CTATGG-ATGGGAAATGTCCCCA--TTCTAGG S_araneus300291 -TTCTCTTTATTTAAAC-CAAAGT-ATGGGACTCTTCCCCA--TTCTTGG S_araneus300957 -AGCACTATATTTAAAC-CAATGG-ATGGGACTCTTCCCCA--TTCTTGG S_araneus300903 -AACACTGTATTTAAAC-GAACGG-A-TAGGGTTCTCCT-------TTGG S_tridecemlineatus300337 -AGCACTATATTTAAAC-CTGTGG-ATGGGAATTTTCCCCA--TTCTTGG T_belangeri300212 -AGTTTTATATTTAAGC-CTGTGG-ATGGGAACTTTCCCCA--TTCTTGG T_belangeri300289 -AGCACTATATTTAAGC-CGATGG-ATGGGAACTTTCCCCA--TTCTTGG * C_familiaris300066 TTATGCTGT-AGTGTGAAAGAATTGC---TGGC-----TCTCTGTTGCAC C_familiaris300418 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTTTA-TGCTGCAC C_porcellus300919 TTACGCTGT-AGTGCAAAAGAATTCCT---GGCTCTATC-----TTAAAC D_novemcinctus300150 TTATGCTGC-AGTACAAAATAATTCC---TTGG--CTCCTTCCCTTGCAC D_novemcinctus300524 TTACGCTGT-AGTGCAAAAGAATTCCTT--GGCTCTTTCCA---TTGCAC E_telfairi300063 TTACGCTGT-AGTGCTAACCAATTTCCCT-GGCTCTCCGTCCCCAGGCAC E_telfairi300124 TTACGCTGT-AGTGCTAAAGAATTCCCT--GGCTCTTCTTCCCCAGGCAC E_telfairi300126 TTATGCTGT-AGTGCTAAAGAATTTCCCTGGGCTCTTCTTCCCCACACAC E_telfairi300858 TTACGCTGT-AGTGCTAAAGAATTCCCT--GGCTCTTCTTCCCCAGGCAC E_caballus300248 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTTTC-TGTTGCAC E_europaeus300586 TTACGCTGT-AGTGCGAAAGGATTCC---TTGG--CCTGCTGTGCTGCAC E_europaeus300687 TTACGCTGT-AGTGCAAAATAATTTC---TTGAGGTTTCTTGTGTTGCAC F_catus300165 TCCCACTCT-TGTGTGAAAGAATTCC---TGGC---TCTTTCTGTCGCAC F_catus300253 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC---TCTTTCTCTTGCAC G_gallus300044 TTACGCTGT-AGTGCAAAAGAATCTCCT--GGCTCTTCAG-----AGTAT G_gorilla300239 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTCT---GTTGCAC H_sapiens300589 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTCT---GTTGCAC H_sapiens300720 TTACTCTGT-AGCACAGAAGAATTCC---TGGC--TTCTTTGTGTTGCAC L_africana300483 TTACGCTGT-AGTGCTAAAGAATTCCTT--GGCTCTTCCTC---TTGCAC M_mulatta300558 TTACTCTGT-AGCACAGAAGAATTCC---TGGC--TTCTTTCTGTTGCAC M_mulatta300613 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTCT---GTTGCAC M_murinus300538 T-ACGCTGT-AGTGCAAAAGAATTCC---TGGC---TCTATCTCTTGCAA M_murinus300528 TTTCGCTGT-AGTGCAAAAGAATTCC---TGGC---TCTTTCTCTTGCAC M_musculus300400 TTACACTATAGTTCGAAAAGAATTCC---TGGC-----TTCTTGTTGCAC M_musculus300809 TTACGCTGT-AGTGCAAAAAGAATTCCT--GGCTCCTTGT-----AGCAC M_musculus300354 TTACGCTGT-AGTGCAAAAAGAATTCCT--GGCTCTGTGT-----TGCAC M_lucifugus300955 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTTTTCTGTTGCAC O_anatinus304514 TTACGCTAT-GGTGCAAAATAATTTCTT--GGCTCTCCT------AGCAC O_cuniculus300370 TTACGCTGTTAGTGCAAAAGAATGTCCG-TGGC---TCCGTCAGTTGCAT O_cuniculus300484 TTACGCTGT-AGTGCAAAAGAAAACC---TGGC---TCCATCTGTTGCAC O_garnettii300463 TTACACTGT-GAAGCAAAAGAATTCC---TGGT---TTTCTC--TTGCAC O_garnettii300601 TTATGCTGT-AGTGTGAAAGAATTCC---TGGC--CTTTTTTCTCCACA- P_troglodytes300557 TTACTCTGT-AGCACAGAAGAATTCC---TGCC--TTCTTTGTGTTGCAC P_troglodytes300687 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTCT---GTTGCAC P_pygmaeus300749 TTACGCTGT-AGTGCAAAAGAATTCC---TGGC--TCTCT---GTTGCAC P_pygmaeus300788 TTACTCTAT-AGCACAGAATTATCCC---TGGC--TTCTTTGTGTTGCAC R_norvegicus300374 TTACGCTGT-AGTGCGAGAAGAATTCCT--GGCGCCTCAT-----TGCAC S_araneus300291 TTACTCTAT-AGTGCAAACGAATTCCT---GGCTCTCCAT------GCAC S_araneus300957 TTACGCTGT-AGTGCAAAAGAATTCCT---GGCTCTTCAT------GCAC S_araneus300903 TCATGCTGT-AGTGCAAAAGAATTCC---TGG------TTTTTGTTGCAC S_tridecemlineatus300337 TTACGCTGT-AGTGCGAAATAATTCC---TGTC---TCT-TCTGTTGCAC T_belangeri300212 TTATGCTGT-AGTACAAAAGAATTCC---TGAC---TCCTTTGGCTGCAC T_belangeri300289 TTACGCTGT-AGTGCAAAAGAATTCC---TGAC---TCTTT--GATGCAT * ** * * * C_familiaris300066 AGCCAACTTTGTGCCATTCTGCTGTTGCT-GTACGGAGTTAAGGAA-TGT C_familiaris300418 AGCTGACATTGTGCCATTCTGCTGTTGCT-GAATAGAGTTAAGGAA-CAT C_porcellus300919 AGCTGACT-TGTCTCATTCTGCTGTTGCT-TTGTGGAGTTAAGGTA-CAG D_novemcinctus300150 AGTTGACTATGTGCAAATTTGCTGTTCCT-CTGTGGAATTAATAAA-CAT D_novemcinctus300524 AGCTGACTATGTGCCATTCTGCTGTTGCT-CTTTGGAGTTAAGGAA-CAC E_telfairi300063 CGCTGACTGCC--AGTTGG--CTGTTGCT-TTGTGCAGTGAAGGAA-CAC E_telfairi300124 AGCTGACTGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CAC E_telfairi300126 AGCTGACTGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CAC E_telfairi300858 AGCTGACCGCC--ATTTGG--CTGTTGCT-TTGTGGAGTGAAGGAA-CAC E_caballus300248 AGCTGACTTTGTGCCAGTCTGCTGGTGCT-GTATGGAGTTAAGGAA-CAT E_europaeus300586 A-CGGATTGTCTGTCAGTCTGCTGT-CCT-GCCTGGTGCCAAGAAA-CAT E_europaeus300687 AGCTGACTT--TGCCAATCTGCTGTTGCT-ATATGAAGTTAAGGAA-CAT F_catus300165 AGCTGACTTCGTGCCATTCTGCTGTTGCT-GTATAGAGTTAGGGAA-CAT F_catus300253 AGCTGACC---TGCCATTCTGCTGTTGCT-ATGTAGAGTTAAGGAA-CAT G_gallus300044 AGTTGGCCTTC--TGTTTG-GCTGATGCTGCTCTGAAGCTAAGGGA-CAG G_gorilla300239 AGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CAT H_sapiens300589 AGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CAT H_sapiens300720 AGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CAT L_africana300483 AGCTGACTCTGTGCCATTCTGCTGTTGCT-GTATGGAGTTAAGGAA-CAT M_mulatta300558 AGCTGACT-TGTACCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CAT M_mulatta300613 AGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATGGAGTTAAGGAA-CAT M_murinus300538 AGCTTACT-TATACTATACTGCTGTGGCT-ATATGGAGTAAAGGA--CAT M_murinus300528 AGCTGACT-TGTACTATTCTGCTGTTGCT-ATATGGAGTTAAGGAA-CAT M_musculus300400 AGCTGACT-CATGCCATTTTGCTGCT----TCATGGAGTTAAGGAA-CAT M_musculus300809 AGCTGACTGATG-CCATTTTGCTGTTGCTTTATGGAGTTAAGGGACATGA M_musculus300354 AGCTGATTCATG-CCATGGCTCCGTG------------------------ M_lucifugus300955 AGCTGACATTGTGCCATTCTGCTGTTGCT-GGATGGAGTTAAGGAA-CAT O_anatinus304514 AGCTGACTGTT--CCTTTATACTGATGCTGTGGTGGAGTTAAAGAAACAT O_cuniculus300370 AGCTGACT-TGGGCCATTCTGCTGTTGCT-TAATGGAGTTAAG-AA-CGT O_cuniculus300484 AGCTTACT-TGTACCATTCTGCTGTTGCT-TAATGGAGTTAAGGAA-CAT O_garnettii300463 AGCTGACT-TGTACCATTCTGGTGT---T-CAATGGAGTTAAGGAG-CTT O_garnettii300601 A-CTGACT-TACACCATTCTGCTGTTCCT-ATATGGAATTAAGGAG-CAT P_troglodytes300557 AGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGTTGAGAAA-CAT P_troglodytes300687 AGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CAT P_pygmaeus300749 AGCTGAC-TTGTGCCATTCTGCTGTTGCT-GTATAGAGTTAAGGAA-CAT P_pygmaeus300788 AGCTGACT-TGTGCCATTCTGCTGCTATA-GTGTGGAGCTGAGAAA-CAT R_norvegicus300374 AGCTGACTCGCGCCGTTTG-GCTGTTGCT-CTGTG-AGCTAAGGGA-CAT S_araneus300291 GGCTGACTTTCTGCCATTCTGCTGTTGCG-ATATTGAGTTAAGGAA-CAT S_araneus300957 AGCTGACTTTCTGCCATTCTGCTGTTGCA-ATATTGAGTTAAGGAA-CAT S_araneus300903 AGCCACCTTTCTGCCAATTTGCTGTTGCT-ATACAGAGCTAAAGAG-CAC S_tridecemlineatus300337 AGCTGACT-TGTATAATTCTGCTGTTGCT-TTATGGAGTTAAGGAA-CAT T_belangeri300212 GGCCAACT-TGCACCATTCTGCTGTTGCT-CTATGGAGTTGAGGAA-CAT T_belangeri300289 AGCTGACT-TGCACCATTCTGCTGTTGCA-TTATGGAGTTAAGGAA-CAT * C_familiaris300066 AA- C_familiaris300418 AA- C_porcellus300919 AA- D_novemcinctus300150 GA- D_novemcinctus300524 AA- E_telfairi300063 AG- E_telfairi300124 AG- E_telfairi300126 AG- E_telfairi300858 AG- E_caballus300248 AA- E_europaeus300586 GT- E_europaeus300687 AT- F_catus300165 AC- F_catus300253 AA- G_gallus300044 AG- G_gorilla300239 GG- H_sapiens300589 GG- H_sapiens300720 GA- L_africana300483 AA- M_mulatta300558 GA- M_mulatta300613 GG- M_murinus300538 GA- M_murinus300528 GA- M_musculus300400 GA- M_musculus300809 --- M_musculus300354 --- M_lucifugus300955 AA- O_anatinus304514 TA- O_cuniculus300370 TGG O_cuniculus300484 TG- O_garnettii300463 TA- O_garnettii300601 GG- P_troglodytes300557 GA- P_troglodytes300687 GG- P_pygmaeus300749 GG- P_pygmaeus300788 GA- R_norvegicus300374 GA- S_araneus300291 GT- S_araneus300957 GT- S_araneus300903 TT- S_tridecemlineatus300337 GA- T_belangeri300212 AC- T_belangeri300289 AT-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved