snOPY snoRNA Orthological Gene Database

Family: SNORA43

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300060 ----------GGTG-CCCTGTAGATGT------------C---GCTGCTC C_familiaris300299 -----CAGGTGCTGGACCTACTAGCAC-CACAGATACAGC-----TGCTT C_familiaris300447 --------CCATCCCTTCTACTAGCAC-CACAGATACAGC-----TGCTT E_telfairi300275 ----------------CCGGCCAGCAC-CA--GGCATGGC------ACTC E_caballus300084 -------GATGCTGGACCTGCCAGCAC-CACAGACGCAGC-----TGCTC F_catus300132 -----CAGACGCCGGGCCTCCCGGCAC-CACAGACACAGC-----TGCTC F_catus300156 -----CTGATGCTGGACCTGCTGGCTC-CTCAGATGCAGC-----TGCGC F_catus300203 ----------GGTGGCTCAGTGGGTGA---GAACAGCTGC---TCTGCTT F_catus300216 -----------ATTGCCCTGCAGGTGC---CGGACCTG------CTGTTC G_gorilla301060 --GATGCCTTCTGGAACATGCCAGCAC-CGCAGATGCTGG-----CAGTC G_gorilla300544 -----GCTGTCCTGGACCTGTCGGCAC-CACAGACA--GT-----TGCTC G_gorilla300630 -----GCTATCCTGGACTTGCCAGCCC-CATAGACGCAGT-----TGCTG G_gorilla300682 -----GCTGTCCTGGACCTGCCAG--------------GA-----TGCTC H_sapiens300378 -----GCTGTCCTGGACCTGTTGGCAC-CACAGACA--GT-----TGCTC M_mulatta300287 -----GCTCTCCTGGACTTGCCAGCCC-CATAAACGCAGT-----TGCTC M_mulatta300301 -----GCTGTCCTGGACCTGCCAGCAG-CACAGATGCAGA-----TGCTC M_mulatta300417 -----GCTGTCCTGGACCTGCGAGCAC-CACAGACACAGT-----TGCTC M_mulatta300456 -----GCTGTCCTGGACCTGTCGGCAC-C--AGACA--GT-----TGCTC M_mulatta300611 -------------GCTACTCTTGAACT-CCTGACCTCAAG-----TGGTC M_murinus300161 ----GCTGCACTGGTCCCTGCCAGCAC-CACAGGTGTGGC-----TGCTC M_murinus300297 ----GCTGCACTGGTCC-TGCCAGCAC-CACAGGTGTGGC-----TGCTC M_domestica300049 --------ATTGCCCCTAGA---GGCGTTACAAATTTGGC-----TGCTG M_domestica300050 ----------------ACTGTTAACACATACAGCTGCTGCTGCAGTGCTG M_domestica300051 -------TCTGCCCCCTAGA---GGCATTACCAAAGTGAC-----TGCTA M_musculus300020 -----GCTGTCCTAGATCAGC----AC-CACAGACCTGGCCTAGCTGCTC M_musculus300091 -----GCTGTGCTGGATCTGTCAGGAC-TGCAGGAACAGC-----TGCTG M_musculus300358 -----GCTGTCCTAGATCAGC----AC-CACAGGCATGGCACAGCTGCTC M_lucifugus300938 -----------GCTGCCCTGTGGGTGC---TGGACCTGAG---GCTGCTG M_lucifugus300977 -----CGGGTGCTGGACCTGCCGGCAC-CACAGACGCGGC-----TGCC- M_lucifugus300978 -----CAGGTGCTGGACCTGCTGGCAC-CACAGATGCGGC-----TGCCG M_lucifugus300043 -----------GCTGCCCTGCAGGTGC---TGGATCTG---------CTG M_lucifugus300435 -----CAGGTGCTGGACCTGC-GGCAC-CACAGACGCGGC-----TGCCA M_lucifugus300558 -----CAGGTGCTGGACCTGC-GGCAC-CACAGACG---C-----TGCCG M_lucifugus300590 -----CGGGTGCTGGACCTGC-GGCAC-CACAGACGCGGC-----TGCCG O_anatinus304349 --------TATGCCCCTAGA---GGCGT-ACAGATGGGGC-----TGCTG O_garnettii300060 ----ACTGTACTGGACC-TGCCAGCAA-CACAGGTGTGGC-----TGTGC O_garnettii300150 ----GCTGTACTGGACC-TGCCAGCAC-CGCAGGTGTGGC---------- P_troglodytes300079 -----GCTGTCCTGGACCTGCCAG--------------GA-----TGCTC P_troglodytes300140 -----GCTGTCCTGGACCTGTTGGCAC-CACAGACA--GT-----TGCTC P_troglodytes300321 -----GCTATCCTGGACTTGCCAGCCC-CATAGACGCAGT-----TGCTG P_troglodytes300325 -----GCTGTCCTGGACCTGCCAGCAC-CACAGACACAGT-----TGCTC P_troglodytes300473 -------------GCTACTCTTGAACT-CCTGACCTCAAC-----TGATC P_troglodytes300062 -----GCCTTCCGGAACATGCCAGCAC-CGCAGATGCTGG-----CAGTC P_pygmaeus300033 -----GCTGTCCTGGACCTGCCAGCTG-CACAGATGCAGA-----TACTC P_pygmaeus300379 -----GCCATCCAGAACATGCCAGCAC-CGCAGATGCTGG-----CTCTC P_pygmaeus300419 -------------GCTACTCTTGAACT-CCTGACCTCAAC-----TGATC R_norvegicus300000 -----TTTGTCCTGTGTCTGTCAGCAC-CACAGGCACAGCACAGCTGCTT R_norvegicus300218 -----GCTGTCCTAGAACAGC----AC-CACAGGCCTGGC--------TC R_norvegicus300404 -----GCTGTTCTGGATCTGTCAGCAC-TGCAGGTACAGC-----GGCTG R_norvegicus300520 -----GCTGTCCTAGAACAAC----AC-CACAGTTATGGC--------TC R_norvegicus300028 ------AAATCTGAGAACA------AC-CACAGGCATGGC--------TC S_araneus300769 GGCATTTTGCAGCTGCTAAACTTATCCCTACAGATGTGGC-----CACCG S_araneus300786 ----------------CAAGCTCAACAATACAGATGTGGC-----TGCTG S_araneus300788 AGTGCCCTGCGGATGCTGAGCTGAGCGCCTCAGACATGGC-----TGCCC S_araneus301043 GGTGCCCTGCAGGTGCTG-GCCGGGCACCACAGACACGGC-----TGCCT S_tridecemlineatus300029 --------------ATTGTGGTAAGTT-TTAAAACTAAGC-----TGATT S_tridecemlineatus300148 -----GCTGGCCTGGGACAGCAAACAC-CACAGACATGAC-----TGCTT T_belangeri300067 -------------TTTGCCGCCAGCAC-CG--GGTGCGGC-----TGCTC C_familiaris300060 -TGCTGCACCTGCGAAGTGGAG--GCAAAGAGGAAGTGGCTATTTCTAGG C_familiaris300299 -TGCTGCACCTGGGATGTCAGG--GCAAAGAGGAAGTGGCTATTTCTACG C_familiaris300447 -TGCTGCACCTGGGATGTCAGG--GCAAAGAGGAAGTGGCTATTTCTACG E_telfairi300275 -TGCTGTGCCTGTG--GT--AG--GCCGAGAGGAAGTGGCTGTTTCTACA E_caballus300084 -TGCTGCACCTGTGACGTCAGG--GCAAAGAGCAAGTGGCTATTTCTACG F_catus300132 -TGCTGCACCTGTGACGTTGGG--GCAAAGAGGAAGCGGCTATTTCTACG F_catus300156 -TCCTGCACCTGTGACACTGGG--GCTAAGAGGAAGCGGCCGTTTCTACG F_catus300203 -TGCTGCACCTGTGACACTGAG--GCAAAGAGGAAGTGGCTATTTCTATG F_catus300216 -TGCTGCACCTGTGACGTTGGG--GCAAAGAGGAAATGGCTGTTTCCACG G_gorilla301060 -TGCTGTGCCCATGA-TATTGG--GCAAAGAGGAAGTGGCTATTTCTACA G_gorilla300544 -TGCTGTGCCTGTGGCCTCGGG--GCAAAGAGAAAGTGGCGATTTCTACA G_gorilla300630 -TGCTGTCCCTGTACTACTGGA--GCAAAGAAAAAGTGGCTATTTCTATG G_gorilla300682 -TGCTATGCCTGTAACATCGGG--GCGAAGTGAAAGTGGCTATTTCTACA H_sapiens300378 -TGCTGTGCCTGTGGCCTCGGG--GCAAAGAGAAAGTGGCGATTTCTACA M_mulatta300287 -TGCTGTGCCTGTACTATTGGA--GCAAAGAAAA-GTGGCTATCTCTATG M_mulatta300301 -TGCTATGCCTGTAACATCAGG--GCAAAGTGAAAGTGGCTATTTCTACA M_mulatta300417 CTGCCATGCCTGTAACACCGGG--GCAAAGAGAAAGTGCCTATTTCTAC- M_mulatta300456 -TGCCGTGCCTGTGACCTCGGG--GCAAAGAGGAAGTGGCGATTTCTACA M_mulatta300611 CGCCCGCCTCGGC--CTCCCAA--AGTGAGA--AAGTGGCTATTTCTATC M_murinus300161 -TGCTGCACCTGTGACATCGGG--GCAAAGAGAAAGTGGCTATTTCTACG M_murinus300297 -TGCTGCACCTGTGACATCGGG--GCAAAGAGAAAGTGGCTATTTCTACG M_domestica300049 -TGCCTCATTTGTGTCAGTAGGTGGCAAAGAGAAAGAGACTATGTCTACG M_domestica300050 -GGCTGTACCTGTGTCTTTAGGTAGCAAAGAGGAAGTGGCTTTTTCTACG M_domestica300051 -TGTCATATTTGGA--ATTAGGTGGCAAAGAGAAAAAGGCTATGTCTACG M_musculus300020 -AGCCCTGCCTGTGACATTGGG--GCAAAGAGCAAGTGGCTCTTTCTATG M_musculus300091 -GGCTCTGTCTGTGACAATGGG--GCAAAGAGCAAGTGGCTATTTCTCTA M_musculus300358 -AGCTGAGCCTGTGACATTGGG--GCAAAGAGCAAGTGGCTGTTTCTACG M_lucifugus300938 -TGCTGCACCTGTGACACCAGG--GCACAGAGGAAGTGGCTATTTCTACG M_lucifugus300977 -TGCTGCACCTGTGACGCCCGG--GCACAGAGGAAGTGGCTATTTCTACG M_lucifugus300978 -TGCTGCACCTGTGGCATCGGG--GCACAGAAGAAGTGGCTATTTCTACG M_lucifugus300043 -----GCACCACAGACATCGGG--GCACAGAGGAAGTGGCTATTTCTACA M_lucifugus300435 -GGCTGCACCTCTGACG---GG--GCCCAGGGGAAGTGGCCAGTTCTACC M_lucifugus300558 -GGCTGCGCCTGTGACGTCGGG--GCCCAGAGGAAGTGGCCAGTTCTACC M_lucifugus300590 -TGCTGCACCTGTGACGCCAGG--GCACAGAGGAAGTGGCTATTTCTACG O_anatinus304349 -TGCCTCATTTGTGTCATATGGTGGCATAGAGCAAAAGGCTATGTCTACG O_garnettii300060 -TGCTGTGCCTGTAACATCAGG--GCAAAGAGAAAGTGGCTATTTCTACG O_garnettii300150 ----TGTGCCTGTGACAACAGG--GCACAGAGAAAGTAGCTATTTCTATG P_troglodytes300079 -TGCTATGCCTGTAACATCGGG--GCGAAGTGAAAGTGGCTATGTCTACA P_troglodytes300140 -TGCTGTGCCTGTGGCCTCGGG--GCAAAGAGAAAGTGGCGATTTCTACA P_troglodytes300321 -TGCTGTGCCTGTACTATTGGA--GCAAAGAAAAAGTGGCTATTTCTATG P_troglodytes300325 CTGC-GTGCCTGTAACACCGGG--GCAAAGAGAAAGTGGCTATTTCTAC- P_troglodytes300473 CACCCGCCTCGGC--CTCCCAA--GGTACGA--AAGTGGCTATTTCTATC P_troglodytes300062 -TGCTGTGCCCGTGA-TATTGG--GCAAAGAGGAAGTGGCTATTTCTACA P_pygmaeus300033 -TGCTATGCCTGTAACATCGGG--GCAAAGTGAAAGTGGCTATTTCTACA P_pygmaeus300379 -TGCTGTGCCCGTGA-TATTGG--GCAAAGAGGAAGTGGCTATTTCTACA P_pygmaeus300419 CACCCGCCTTGGC--CTCCCAA--AGTACGA--AAGTAGCTATTTCTATC R_norvegicus300000 -AGCTGTGTCTGTCACATCAGG--GCTGGGGGCAAGTGGCTATTTCTGCA R_norvegicus300218 -GGCTTTGCCTGTGACATTGGG--GCAAAGAGCAAGTGGCTATTTCTACG R_norvegicus300404 -GGCTCTGTCTATGACACTGGG--GCAAAGAGCAAGTGACTATTTCTATA R_norvegicus300520 -AGCTGTGCCCGTGACATTGGG--GCAAAGAGCAAGTGGCTATTTCTACG R_norvegicus300028 -AGCTTTGCCTGTGACATCGGG--GAAAAGAGCAAGTGGCTATTTCTACA S_araneus300769 -AGCCACACTGGTGACAGCAGG--GCA--GAAAAAGTGGCTATTTCTACA S_araneus300786 -GGCTACACTGGTGACAGCAGG--GCACAGAGAAAGTGGCTATTTCTACA S_araneus300788 -GGATGCATCTGTGACAACAGG--GCACACAGTAAGTGGCTATTTCTACG S_araneus301043 -GGCCGCATC-GTGGCG-CAGG--GCAGAGA--AAGTGGCTATTTCTACG S_tridecemlineatus300029 CTGCTGTATCTGTGACATCTGG--GCAAAGAGCAAGTGGCTGTTTCTATG S_tridecemlineatus300148 -TGCTCTGCCTGTGATATCAAG--GCAAAGAGGAAGTAGCTATTTCTGTG T_belangeri300067 -TGCTGTGCCCGGGC-GTCGGG--GCAGAGAGAACCTGGCTATTTCTACG * * ** C_familiaris300060 CTCAGTGCTCAGTA--TAGTGAGCGCTAAGAA-----TGGTTTATAGCCT C_familiaris300299 CTCAGTGCTCAGAA--CAGTGGGCACTAAGAA-----TGGTTTGTAGCCA C_familiaris300447 CTCAGTGCTCAGAA--CAGTGGGCACTAAGAA-----TGGTTTGTAGCCA E_telfairi300275 CTCAGTGCCCCCA--CCCGTGGGCACTAAGAA-----TGGTTTATAGCCT E_caballus300084 CTCAGTGCTCAGAA--CAGTGAGCACTAAGAA-----TGGTTTGTAGCCT F_catus300132 CTCAGTGCTCAGAA--CCGTGGGCACTAAGAA-----TGGTTTGTAGCCG F_catus300156 CTCAGTGCTCAGAA--CAGTGAGCACTCCG-------TGGTTTGTAGCCG F_catus300203 CTCAGTGCTCAGAA--GAGTGACCACTAAGAA-----TGATTTGTAGCCT F_catus300216 CTCAGCGCTCACAA--CAGTGACCACTAAGCA-----CGGTCTGTAGCCC G_gorilla301060 CTTGGTGTTCAGAAACCAGTGAGCTCTAAGAA-----TGGTTTATAGCCT G_gorilla300544 CTCAGTGCTCGGGAACCAGTGGGCACTGAGAA-----TGGTTTATGGCCT G_gorilla300630 CTCAGTGTTCACAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT G_gorilla300682 CTCAGTGTTCAGAAAACAGTGAACAACAAGAA-----TGGATAATAGCCT H_sapiens300378 CTCAGTGCTCGGGAACCAGTGGGCACTGAGAA-----TGGTTTATGGCCT M_mulatta300287 CTCAGTGTTCACAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT M_mulatta300301 CTCAGTGTTCAGAAAACAGTGAACAACAAGAA-----TGGATAATAGCCT M_mulatta300417 CTGAGTAGCTAGGA--CTACAGGCGCATGCCA------------------ M_mulatta300456 CTCAGTGCCCGGGAACCAGTGGGCACTGAGAA-----TGGTTTATGGCCT M_mulatta300611 CTCAGTGTTCAGAAACCAGTGAGCACCAAAAAA----TGGCTTATAGCCT M_murinus300161 CTCAGTGTTCCGAAACCAGTGAACACTAAGAA-----TGGTTTGTAGCCT M_murinus300297 CTCAGTGTTCCGAAACCAGTGAACACTAAGAA-----TGGTTTGTAGCCT M_domestica300049 CTCAGTGCTCT-GACCCAGTGAGCACTCAGAA-----TGATTAATAGCCT M_domestica300050 CTCAGTGTTCAGAAATCTGTGAGCACTAAGAA-----TGGTTGATTGCCT M_domestica300051 CTCAGTGTTCTTAAACTTGTGAGCACTTAGAA-----TGATTAATAGCCA M_musculus300020 CTCAGTGTCCAGAAGCCATTGAGCACTAAGAA-----TGGTTTATAGCCT M_musculus300091 CTCAGTTTTCAGAAGCCAGTGAGCACTAAGAA-----TGGAATATAGCTT M_musculus300358 CTCAGTGCTCAGAAGCCCGTGAGCACTAAGAA-----TGGTTTGTAGCCT M_lucifugus300938 CTCAGTGCTCAGAA--CAGTGGGCACTAAGAG-----TGGTTTGTAGCCT M_lucifugus300977 CTCAGTGCTCAGAA--CCGTTGGCACTGAGAA-----TGGTTTGTGGCCT M_lucifugus300978 CGCAGTGCTCAGAA--CAGTGAGCACTAAGAA-----TGATTTGTAGCCT M_lucifugus300043 CTCAGTGCTCAGAA--CAGTGGGCACTAAGAA-----TAGTTTATAGCCC M_lucifugus300435 CTCCGTGCTCAGAA--CAGTGGGCACTAGGA------TGGTTTGTAGCCT M_lucifugus300558 CTCAGTGCTCAGAA--CAGTGGGCACTAGGA------TGGTTTGTAGCCT M_lucifugus300590 CTCAGTGCTCAGAA--CAGTGGGCACTAAGAA-----TGGTTTGTAGCCT O_anatinus304349 CTCGGTGTTCT-CAGTCCATGAACACTCAGAA-----TGATTAGTAGCCT O_garnettii300060 CTCAGTGTTCAGAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT O_garnettii300150 CTCAGTGTTCAGAATCCTGTGAGCCCTAAGAA-----TGGTTTATAGCCT P_troglodytes300079 CTCAGTGTTCAGAAAACAGTGAACAACAAGAA-----TGGATAATAGCCT P_troglodytes300140 CTCAGTGCTCGGGAACCAGTGGGCACTGAGAA-----TGGTTTATGGCCT P_troglodytes300321 CTCAGTGTTCACAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT P_troglodytes300325 CCGAGTAGCTGGGA--CTACAGGCGCATGCCA-----CCATGCTGGGCTA P_troglodytes300473 CTCAGTGTTCAGAAACCAGTGAGCACCAAAAAA----TGGCTTATAGCCT P_troglodytes300062 CTTGGTGTTCAGAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT P_pygmaeus300033 CTCAGTGTTCAGAAAACCGTGAACAACAAGAA-----TGGATAATAGCCT P_pygmaeus300379 CTTGGTGTTCAGAAACCAGTGAGCTCTAAGAA-----TGGTTTATAGCCT P_pygmaeus300419 CTCAGTGTTCAGAAACCAGTGAGCACCAAAAAA----TGGCTTATAGCCT R_norvegicus300000 CTCAGTGTTCAGAAGCCAGTAAGCACTGAATAGTGTTTGGCTGATAGCCT R_norvegicus300218 CTCAGTGTTCAGAAGCCAGTGAGCACTAAGAA-----TGGTTTGTAGCCT R_norvegicus300404 CTCAGCTTTCAGAAGCCAGTCAGCACTGAGAA-----TGGTATATAGCCT R_norvegicus300520 CTCAGTGTTCAGAAGCTATTGCGTACTAAGAA-----TGGTTTGTAGCTT R_norvegicus300028 CTCAGTGTTCAGAAGCCAGTGAGCACTAAGAA-----TGGTTTGTAGCCT S_araneus300769 CTCAGTGCTC--AAAACTGTGGGTGCTAAGAA-----TGGTTAGTAGCCT S_araneus300786 CTCAGTGCTC--AGACCTGTGGGTGTGAAGAA-----TGGTTTGCAGCCT S_araneus300788 CTCAGTGTCC--AGACCCATGGGCACTAAGAA-----TGGTTTGTAGCCT S_araneus301043 CTCAGCGCCC--AGACCCGTGGGCGCTAAGAA-----TGGTTTGTAGCCT S_tridecemlineatus300029 CTCTGTGTTCAGAAACCAGTGAGCACTAAGAA-----TGGTTTATAGCCT S_tridecemlineatus300148 CTTAGTTTTCAGA--CCAGTGCGCACTAAGAA-----AGATTTATAGCCT T_belangeri300067 CTCCGTGCCCGGAAACCAGTGGGCGCTGAGAA-----TGGTTTGTAGCCT * * C_familiaris300060 ATCACGC C_familiaris300299 AACATGC C_familiaris300447 AACATGC E_telfairi300275 GACATTC E_caballus300084 GACATTT F_catus300132 AACATGC F_catus300156 AACATGC F_catus300203 AACAAGC F_catus300216 CACGTGC G_gorilla301060 GACATTT G_gorilla300544 CACATTA G_gorilla300630 GACATTT G_gorilla300682 GACATTT H_sapiens300378 GACATTA M_mulatta300287 GACATTT M_mulatta300301 GACATTT M_mulatta300417 ------- M_mulatta300456 GACATGA M_mulatta300611 GACATTT M_murinus300161 GACATTT M_murinus300297 GACATTT M_domestica300049 GACACTT M_domestica300050 GACATTT M_domestica300051 CACAATG M_musculus300020 GACATTA M_musculus300091 GACACTT M_musculus300358 GACATTT M_lucifugus300938 GACATTC M_lucifugus300977 GACATTC M_lucifugus300978 GACATTC M_lucifugus300043 GACAGTC M_lucifugus300435 GACATTC M_lucifugus300558 GACATTC M_lucifugus300590 GACATTC O_anatinus304349 GACAATG O_garnettii300060 GACATTT O_garnettii300150 GACATTT P_troglodytes300079 GACATTT P_troglodytes300140 GACATTA P_troglodytes300321 GACATTT P_troglodytes300325 AT----- P_troglodytes300473 GACATTT P_troglodytes300062 GACATTT P_pygmaeus300033 GACATTT P_pygmaeus300379 GACATTT P_pygmaeus300419 GACATTT R_norvegicus300000 CACATTT R_norvegicus300218 GACATTT R_norvegicus300404 GACATTC R_norvegicus300520 GACATTT R_norvegicus300028 GACATTT S_araneus300769 CACATTT S_araneus300786 CATATTC S_araneus300788 CACATTG S_araneus301043 CACATTC S_tridecemlineatus300029 CACATTT S_tridecemlineatus300148 AATACTT T_belangeri300067 GACACAT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved