snOPY snoRNA Orthological Gene Database

Family: SNORA41

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300382 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTACA-GTAGCAGT C_porcellus300155 GTCCA----CAGCTACTGGTCTG-------------TCAATCGTAGCAGC C_porcellus300350 GTCCA----CAGCTACTGGTCTGCA----GCTGCTGTCAATCGTAGCAGC C_porcellus300668 GTCCA----CAGCTACTGGTCTGCA----GCTGCTGTCAATCGTAGCAGC C_porcellus300789 GTCCA----CAGCTACTGGTCTGCA----GCTGCTGTCAATCATAGCAGC C_porcellus300823 GTCCA----CAGCTACTGGTCTGCA----GCTGCTGTCAATCGTAGCAGC D_novemcinctus300145 CTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTGGCAAT E_telfairi300027 TTCCA----CAGCTACTGGTCTGCA----GCTGTTTTTCTG-CTATTTTC E_telfairi300044 TTCCA----CAGCTACTGGTCTGCA----GCTGTTTTTATG-GTAGCAGT E_telfairi300236 TTCCA----TATTTACTGGTCTGCA----ACTGTTCTTATG-ATAGTCAA E_telfairi300339 TTCCA----CAGCTACTGGTCTGCA----GCTGTTTTTCTA-GTAGCAGT E_telfairi300368 TTCCA----CAGCTACTGGTCTGCA----GCTGTTTTTATG-GTAACAGT E_caballus300393 CCCCA----CAGCTCCTGGGCCGCA----GCTGTTCTCACG-GCAGCAGC E_europaeus300251 CCTTA----CAGCTACTGTTCTGCA----GCTATCCTTATA-GTAGCAGT E_europaeus300360 TCCCA----CAACTACTGGTCTGCA----ACTCTTCTT----GTAGCCAT E_europaeus300391 TTCCA----CAGCTAGTGATATGCA----ACTGTTCTTAAG-GTAGCAGT F_catus300230 TTCCA----CAGCTACTGGTCTGCA----GCCGCTCTTATG-GTAGCAGT G_gorilla300628 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT G_gorilla300204 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT H_sapiens300507 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT H_sapiens300519 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT L_africana300445 TTCCA----CAGCTACTGGTCTGCA----ACTGTCTTCATG-GTAGCAGT M_mulatta300367 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT M_mulatta300735 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT M_murinus300150 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG--TAGCAGT M_murinus300572 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG--TAGCAGT M_domestica300179 TTCCA----CAGCTACTGGTCTGCA----ACTGTTCTCATCTATAGCAGT M_musculus300906 TTCCA----CAGCTACTGGTCTACA----GCTGTTTTTATG-GTAGCAGT M_musculus300178 TTCCT----CAGCTACTGGTCTGCA----GCTGTCCTCATG-GTAGCAGT M_musculus300785 TTCCA----CAGCTACTGGTCTACA----GCTGTCTTTATG-GTAGCAGT M_lucifugus300713 TTCCA----CAGCTACTGGTGTGCAGCTAGCTGTTCTTATG-GAGGCAGT M_lucifugus300935 TTCCA----CAGCTACTGGTGTGCAGCTAGCTGTTCTTATG-GAGGCAGT M_lucifugus300936 TTCCA----CAGCGCCGGGTCTGCA----GCTGTTC--ATG-GTGGCACT M_lucifugus300312 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTCATG-GTGGCAGT M_lucifugus300628 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTCATG-GTGGCAGT O_anatinus304356 TTCCA----CAGCTACTGGTCTGCA----GCTGTTGTGCTCTGTAGCAGT O_cuniculus300030 TTCTACAACTATTGATTGGTCTGCA----GCTCTTCTTA------GTAAT O_cuniculus300316 TTCCG----CAACTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT O_cuniculus300391 TTCTG----CGACTACTGTTCTGCA----CCTGTTCTCAGG-GTAGCAGC O_garnettii300220 TTCCA----TAGCTACTGGTCTGCA----GCTGTTCTTATA--TAACAGT O_garnettii300406 ------------TTTCAAAACTGTTAC------ATAAGGTG-GGAGGCAC O_garnettii300616 ATCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG--TAACAGT P_troglodytes300641 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT P_troglodytes300316 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT P_pygmaeus300210 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT P_pygmaeus300368 TTCCA----CCACTATTGGTCTGCA----GCTCTTCTTATG-GTAGCAGT P_pygmaeus300695 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTATG-GTAGCAGT R_norvegicus300249 TTCCA----CAGCTACTGGTCTGCA----GCTGTCCTTATG-GTAGCAGT R_norvegicus300853 TTCCA----CAGCTACTGGTCTGCA----GCTGTCTTTATG-GTAGCAGT R_norvegicus300907 -------TCTAATAAAGAGCTTGCTGCC--CCAGTAATATG-GGAGCAGT R_norvegicus300536 TTTCA----CAACTACTGGTCTGCA----GCTGTCCTTCTG-GTAACAGT S_tridecemlineatus300247 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTAATG-GTAGCAGT T_belangeri300366 TTCCA----CAGCTACTGGTCTGCA----GCTGTTCTTACA-GTAGCACT C_familiaris300382 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTA-TGCAATT-------- C_porcellus300155 TGTGGCATTCCA-CTGTAGGAAAGAAAGT-GTT-ACACAGTT-------- C_porcellus300350 CGTGGCATCCCA-CTGTGGGAAAGAAAGT-GTT-ACACAGTT-------- C_porcellus300668 CGTGGCATCCCA-CTGTGGGAAAGAAAGT-GTT-ACACAGTT-------- C_porcellus300789 TGTGACATTCCA-CTGTGGGAAAGGAAGT-GTT-ACACAGTT-------- C_porcellus300823 TGTGGCATTCCA-CTGTGGGAAAGGAAGT-GTT-ACACAGTT-------- D_novemcinctus300145 TGTGGCATTCCT-CTGTGGTAAAGAATCT-GTTA-CATAATT-------- E_telfairi300027 TGTGGCATTC----TGTGGGAAAGAAAGT-GTT-ACCCAATG------TA E_telfairi300044 TGTGGCATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TG E_telfairi300236 TGAGTCAGTTCT-CTGTGGAAAAGAAACT-GTT-ACACAA--------TT E_telfairi300339 TGTGGGATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TA E_telfairi300368 TGTGGCATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TG E_caballus300393 TGTGGCATTCCT-CTGTGGGAGAGAAACT-GTT-ACACGATT-------- E_europaeus300251 TGTGGCATTCTT-CTGTGGAAAATAAAT---TTA-CACAATTG------- E_europaeus300360 TGTGGCATTCGT-CTGTGGAAAATAAACT-GCTA-CACAATGT------- E_europaeus300391 TGTGACATTCTT-CTGTGAGAAAGAAATA-ATG-ACACAAAT------TT F_catus300230 TGTGGCATTCCT-CTGTGGGAAAGGAAACTGTC-ACACAATT-------- G_gorilla300628 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA----------- G_gorilla300204 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT H_sapiens300507 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA----------- H_sapiens300519 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT L_africana300445 TGCGGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACGTGA--------TT M_mulatta300367 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT M_mulatta300735 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA----------- M_murinus300150 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACAGTC-------- M_murinus300572 TGTGGCATTCCT-CTGTGGGAAAGAAACT-CATGACACAGTC-------- M_domestica300179 TGTTGTATTCCA-CTGTGGGAAAGGAACT-GTT-ACACTGTT-------- M_musculus300906 TGTAGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT-------- M_musculus300178 TGTAGCATTCCT-CTATGGGAAAGAAAAT-GTT-ACACCATT-------- M_musculus300785 TGTAGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT-------- M_lucifugus300713 TAAGGCATTCCT-CTGTGAGGAAAAAATT-GTT-ACATGATT-------- M_lucifugus300935 TAAGGCATTCCT-CTGTGAGGAAAAAATT-GTT-ACATGATT-------- M_lucifugus300936 TGTGGCATTCCT-CTGTGGGAAAGAAATT-GTT-ACACGATT-------- M_lucifugus300312 TGTGGCATTCCT-CTGTGGGAAAGAAATT-GTT-ACATGATT-------- M_lucifugus300628 TGTGGCATTCCT-CTGTGGGAAAGAAATT-GTT-ACACGATT-------- O_anatinus304356 TGCAGTATTCCATCTGTGGGAAAGAAACTTGTTGACACTGTT-------- O_cuniculus300030 TGTGGCATTCCA-CTGTGGGAAAGAAACT-GTT-ACACAA--------TT O_cuniculus300316 TGTGGCATTCCA-CCGTGGGAAAGAAACT-GTT-ATACAA--------TT O_cuniculus300391 TGTG---------------GGAGCGAATG-GTC-ACACAA--------TC O_garnettii300220 TGTGGCATTCCT-CTGTGCGAAAGAAACC-GTTAACACAGCT-------- O_garnettii300406 -ATGGCGTTCTG-CTGTGGGAAGGAAGCT-GTTAACACAGTT-------- O_garnettii300616 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACAGTT-------- P_troglodytes300641 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA----------- P_troglodytes300316 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT P_pygmaeus300210 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT P_pygmaeus300368 TGTTGCATTTCT-CTGTGGGAAAGAAA-------AGAGGA--------TT P_pygmaeus300695 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA----------- R_norvegicus300249 TGTAGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT-------- R_norvegicus300853 TGTAGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT-------- R_norvegicus300907 TGTAGCATTCCT-CTGTGGGAAAGAAACT-GTTA-CACAGTT-------- R_norvegicus300536 TGTAGCGTTCCT-CTGTGGGAAAGAAACT-GTT-ACACCATTACACCATT S_tridecemlineatus300247 TGTAGCATTCCT-CTGTGGGAAATAAACT-GTT-ATACAATT-------- T_belangeri300366 TGTGGCATTCCT-CTGTGGGAAAGAAACT-GTTA--ACGGTT-------- * C_familiaris300382 AAACACCTCTTTCTTAGCACAACGGAAAGT---GGGCATATGAGTAACAA C_porcellus300155 AAATACCTCTTTCATACCCAAGAAGAAAGT---GGGCATGTGAGTGACAG C_porcellus300350 AAATACCTCTTTCTTACCCAAGAAGAAAGT---GGGCATGTGTGTGACAG C_porcellus300668 AAATACCTCTTTCTTACCCAAGAAGAAAGT---GGGCATGTGTGTGACAG C_porcellus300789 AAATACCTCTTTCTTATCCAAGAAGAAAGT---GGGCATGTGTGTGACAG C_porcellus300823 AAATACCTCTTTCTTATCCAAGAAGAAAGT---GGGCATGTGTGTGACAG D_novemcinctus300145 AAATACTTCTTTCTTAGCAAAACAGAAAGT---GGGCATGTGTGTGACAA E_telfairi300027 ACATCCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAG E_telfairi300044 ACATCCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAG E_telfairi300236 GAAACCTCCTTTCTAA---AAACATCAACT---GGACATATGTGTGATGG E_telfairi300339 ATCTCCCTCTTCCCCAGCAAAATGGAAAGCTGGGCATATGTGTGTGACAG E_telfairi300368 ACATCCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAG E_caballus300393 GAA-ACCGCTTTCTTAGCAAAACAGAAAGC---GGGCATGTGTGTGACAA E_europaeus300251 AAATAGTTCTTTCTTAGCAAAACAGAAAGT---AGACATGTGTGTGACAA E_europaeus300360 AAATG---CCCCATTAGCAAAATAGAAAGT---GGACATGTGTGAGACAA E_europaeus300391 AAATACCTCTTGCCTAGCAAAACAGAAAGT---TGGCATATGTGTGACAA F_catus300230 AAATACCTCTTTCTTAGCACGACAGAAAGT---GGGCATGTGAGTGACAA G_gorilla300628 -AACACCTCTTTCTTAGCAAAACAGAAAGTG-GGTATATATGTGTGACAG G_gorilla300204 AAACACGTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG H_sapiens300507 -AACACCTCTTTCTTAGCAAAACAGAAAGTG-GGTATATATGTGTGACAG H_sapiens300519 AAACACCTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG L_africana300445 AAACACCTCTTTCTTAGCAAAACAGAAAGT---GGGCATATGTGTGACAG M_mulatta300367 AAACACCTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG M_mulatta300735 -AACACCTCTTTCTTAGCAAAACAGAAAGTG-GGCATAT--GTGTGACAG M_murinus300150 AAACACCTCTTTCTTAGGAAAACAGAAAGTG-GGTATAT--GTGTGACAG M_murinus300572 ATACACCTCTTTCTTAGCAAA-CGGAAAGTG-GGTATCA--GGGTGACAG M_domestica300179 AAATAACCTCTTTCTAATATAACAGAAAGT--GGGTTCTTTGTGTGACAG M_musculus300906 TAATGCCTCTTTCTTAGCCACACAGAAGGA--GGATTACGTGTG--ACAG M_musculus300178 TAATGCCTCTTTCTTGGCCACACAAAAGAA---GAATATGCTTG--ACAG M_musculus300785 TAATGCCTCTTTCTTAGCCACACAGGAGGA--GGATTATGTGTG--ACAG M_lucifugus300713 AAACACCTCTTTCTTAGCAAAACAGAAAGT---GGGCATATGTGTGACAA M_lucifugus300935 AAACACCTCTTTCTTAGCAAAACAGAAAGT---GGGCATATGTGTGACAA M_lucifugus300936 ACACACCTCTGTCTCTGCAAAACAGAGAGT---GGGTATCTGTGTGACAA M_lucifugus300312 AAACACCTCTTTCTTAGCAAAACAGAAAGG---GGGCATATGTGTGACAA M_lucifugus300628 AAACACCTCTTTCTTAGCAAAACAGAAAGG---GGGCATATGTGTGACAA O_anatinus304356 CG-TTACCCCTTTCTCG-GCAACAGAATG---GGGTTTTCTGTGCGACAG O_cuniculus300030 GAACACTTCTTAGCAA---AA-CAGAAAGT---AGGCATATGTGTGAAGT O_cuniculus300316 AAATACCTCTGTCTTAGCAAAACAGAAAGT---GGGTATATGTGTGACAC O_cuniculus300391 AAACACTTCTTTCTTAACAAAGCAGAAAGT---GGGCATATGTGTGACAG O_garnettii300220 AAACACCT--TTCTTAGCAAAACAGAAAGT---G---ACAGAAGAAAAAA O_garnettii300406 GAACACCTCTTTCTTAACAAAACAGAAAGT---GGGTATATATGTGACAG O_garnettii300616 AAATACCTCTTTCTTAGCAAAACAGAAAGTG-GGTATAC--GTGTGACAG P_troglodytes300641 -AACCCCTCTTTCTTAGCAAAACAGAAAGTG-GGTATATATGTGTGACAG P_troglodytes300316 AAACACCTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG P_pygmaeus300210 AAACACCTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG P_pygmaeus300368 AAACACCTCTTTCTTAGCAAAACAGAGAGT---AGGCATATGTGTGACAG P_pygmaeus300695 -AACACCTCTTTCTTAGCAAAACAGAAAGTG-GGTATAT--GTGTGACAG R_norvegicus300249 TAATGCCTCTTTCTTAGCCACATAGAAAGA--GGAATATGCGTG--ACAG R_norvegicus300853 TAATGCCTCTTTCTTAGCCACATAGAAAGA--GGAATATGCGTG--ACAG R_norvegicus300907 TTATGCCTCT----TAGCTACATAGAAAGA---GGA-ATATGGGTGACAG R_norvegicus300536 TAATGCCTCTTTCTTAGCCACACAGAAAGAA-GGAATAAGCCTG--ACAG S_tridecemlineatus300247 ATATGCCTCTTTCTTAGCCAAAGAGAAAGTG-GGCACATGTGTGTGACAG T_belangeri300366 AAATACCTCTTTCTTAGTAAAATAGAAAGT---AGTCATGTGTGTTTCAG * C_familiaris300382 ACATAA C_porcellus300155 TGTAAA C_porcellus300350 ACAGTG C_porcellus300668 ACAGTG C_porcellus300789 TGTTAA C_porcellus300823 ACAGTG D_novemcinctus300145 AGTTAA E_telfairi300027 ACACAG E_telfairi300044 ACACAG E_telfairi300236 ATACAA E_telfairi300339 ACACAG E_telfairi300368 ACACAG E_caballus300393 ACACAG E_europaeus300251 GGTGTG E_europaeus300360 ACAA-- E_europaeus300391 ATAAGA F_catus300230 ACAGAT G_gorilla300628 ACACAA G_gorilla300204 ACACAA H_sapiens300507 ACACAA H_sapiens300519 ACACAA L_africana300445 ACAAGA M_mulatta300367 ACACAA M_mulatta300735 ACATAA M_murinus300150 ACACAA M_murinus300572 ACACAA M_domestica300179 ACACCT M_musculus300906 ACACAA M_musculus300178 ACACAA M_musculus300785 ACACAA M_lucifugus300713 ACAGAA M_lucifugus300935 ACAGAA M_lucifugus300936 ACACAA M_lucifugus300312 ACATGA M_lucifugus300628 ACATGA O_anatinus304356 ACAAAT O_cuniculus300030 ATAGAA O_cuniculus300316 ACATGA O_cuniculus300391 ACATGA O_garnettii300220 AAAGAA O_garnettii300406 ACAGAA O_garnettii300616 ACAGAA P_troglodytes300641 ACACAA P_troglodytes300316 ACACAA P_pygmaeus300210 ACACAA P_pygmaeus300368 ACACAA P_pygmaeus300695 ACACAA R_norvegicus300249 ACACAA R_norvegicus300853 ACACAA R_norvegicus300907 ACACAA R_norvegicus300536 ACACAA S_tridecemlineatus300247 ACACAT T_belangeri300366 ACAAAA

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved