snOPY snoRNA Orthological Gene Database

Family: SNORA41

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300382 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--CAGTAGCAGTTGT C_porcellus300155 GTCCA----CAGCTACTGGTCTG---------TCAA-TCGTAGCAGCTGT C_porcellus300350 GTCCA----CAGCTACTGGTCTGCAGCTGCTGTCAA-TCGTAGCAGCCGT C_porcellus300668 GTCCA----CAGCTACTGGTCTGCAGCTGCTGTCAA-TCGTAGCAGCCGT C_porcellus300789 GTCCA----CAGCTACTGGTCTGCAGCTGCTGTCAA-TCATAGCAGCTGT C_porcellus300823 GTCCA----CAGCTACTGGTCTGCAGCTGCTGTCAA-TCGTAGCAGCTGT D_novemcinctus300145 CTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TGGTGGCAATTGT E_telfairi300027 TTCCA----CAGCTACTGGTCTGCAGCTGTTTTTC--TGCTATTTTCTGT E_telfairi300044 TTCCA----CAGCTACTGGTCTGCAGCTGTTTTTA--TGGTAGCAGTTGT E_telfairi300236 TTCCA----TATTTACTGGTCTGCAACTGTTCTTA--TGATAGTCAATGA E_telfairi300339 TTCCA----CAGCTACTGGTCTGCAGCTGTTTTTC--TAGTAGCAGTTGT E_telfairi300368 TTCCA----CAGCTACTGGTCTGCAGCTGTTTTTA--TGGTAACAGTTGT E_caballus300393 CCCCA----CAGCTCCTGGGCCGCAGCTGTTCTCA--CGGCAGCAGCTGT E_europaeus300251 CCTTA----CAGCTACTGTTCTGCAGCTATCCTTA--TAGTAGCAGTTGT E_europaeus300360 TCCCA----CAACTACTGGTCTGCAACTCTTCTT-----GTAGCCATTGT E_europaeus300391 TTCCA----CAGCTAGTGATATGCAACTGTTCTTA--AGGTAGCAGTTGT F_catus300230 TTCCA----CAGCTACTGGTCTGCAGCCGCTCTTA--TGGTAGCAGTTGT H_sapiens300507 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TGGTAGCAGTTGT H_sapiens300519 TTCCA----CCACTATTGGTCTGCAGCTCTTCTTA--TGGTAGCAGTTGT L_africana300445 TTCCA----CAGCTACTGGTCTGCAACTGTCTTCA--TGGTAGCAGTTGC M_mulatta300367 TTCCA----CCACTATTGGTCTGCAGCTCTTCTTA--TGGTAGCAGTTGT M_mulatta300735 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TGGTAGCAGTTGT M_murinus300150 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TG-TAGCAGTTGT M_murinus300572 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TG-TAGCAGTTGT M_domestica300179 TTCCA----CAGCTACTGGTCTGCAACTGTTCTCAT-CTATAGCAGTTGT O_anatinus304356 TTCCA----CAGCTACTGGTCTGCAGCTGTTGTGCT-CTGTAGCAGTTGC O_cuniculus300030 TTCTACAACTATTGATTGGTCTGCAGCTCTTCTTA-------GTAATTGT O_cuniculus300316 TTCCG----CAACTACTGGTCTGCAGCTGTTCTTA--TGGTAGCAGTTGT O_cuniculus300391 TTCTG----CGACTACTGTTCTGCACCTGTTCTCA--GGGTAGCAGCTGT O_garnettii300220 TTCCA----TAGCTACTGGTCTGCAGCTGTTCTTA--TA-TAACAGTTGT O_garnettii300406 ------------TTTCAAAACTGTTAC----ATAAGGTGGGAGGCAC-AT O_garnettii300616 ATCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TG-TAACAGTTGT P_troglodytes300316 TTCCA----CCACTATTGGTCTGCAGCTCTTCTTA--TGGTAGCAGTTGT P_troglodytes300641 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TGGTAGCAGTTGT P_pygmaeus300210 TTCCA----CCACTATTGGTCTGCAGCTCTTCTTA--TGGTAGCAGTTGT P_pygmaeus300368 TTCCA----CCACTATTGGTCTGCAGCTCTTCTTA--TGGTAGCAGTTGT P_pygmaeus300695 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--TGGTAGCAGTTGT R_norvegicus300249 TTCCA----CAGCTACTGGTCTGCAGCTGTCCTTA--TGGTAGCAGTTGT R_norvegicus300536 TTTCA----CAACTACTGGTCTGCAGCTGTCCTTC--TGGTAACAGTTGT R_norvegicus300853 TTCCA----CAGCTACTGGTCTGCAGCTGTCTTTA--TGGTAGCAGTTGT R_norvegicus300907 -------TCTAATAAAGAGCTTGCTGCCCCAGTAATATGGGAGCAGTTGT S_tridecemlineatus300247 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTAA--TGGTAGCAGTTGT T_belangeri300366 TTCCA----CAGCTACTGGTCTGCAGCTGTTCTTA--CAGTAGCACTTGT * * C_familiaris300382 GGCATTCCT-CTGTGGGAAAGAAACT-GTTA-TGCAATT--------AAA C_porcellus300155 GGCATTCCA-CTGTAGGAAAGAAAGT-GTT-ACACAGTT--------AAA C_porcellus300350 GGCATCCCA-CTGTGGGAAAGAAAGT-GTT-ACACAGTT--------AAA C_porcellus300668 GGCATCCCA-CTGTGGGAAAGAAAGT-GTT-ACACAGTT--------AAA C_porcellus300789 GACATTCCA-CTGTGGGAAAGGAAGT-GTT-ACACAGTT--------AAA C_porcellus300823 GGCATTCCA-CTGTGGGAAAGGAAGT-GTT-ACACAGTT--------AAA D_novemcinctus300145 GGCATTCCT-CTGTGGTAAAGAATCT-GTT-ACATAAT-------T-AAA E_telfairi300027 GGCATTC----TGTGGGAAAGAAAGT-GTT-ACCCAATG------TAACA E_telfairi300044 GGCATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TGACA E_telfairi300236 GTCAGTTCT-CTGTGGAAAAGAAACT--GTTACACAATT--------GAA E_telfairi300339 GGGATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TAATC E_telfairi300368 GGCATTCCT-CTGTGGGAAAGAAAGT-GTT-ACCCAATG------TGACA E_caballus300393 GGCATTCCT-CTGTGGGAGAGAAACT-GTT-ACACGAT-------TGAAA E_europaeus300251 GGCATTCTT-CTGTGGAAAATAAAT---TT-ACACAAT-------TGAAA E_europaeus300360 GGCATTCGT-CTGTGGAAAATAAACT-GCT-ACACAAT-------GTAAA E_europaeus300391 GACATTCTT-CTGTGAGAAAGAAATA--ATGACACAAAT------TTAAA F_catus300230 GGCATTCCT-CTGTGGGAAAGGAAACTGTC-ACACAATT--------AAA H_sapiens300507 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA------------AA H_sapiens300519 TGCATTTCT-CT-----GTGGGAAAG--AAAAGAGGATT--------AAA L_africana300445 GGCATTCCT-CTGTGGGAAAGAAACT--GTTACGTGATT--------AAA M_mulatta300367 TGCATTTCT-CT-----GTGGGAAAG--AAAAGAGGATT--------AAA M_mulatta300735 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA------------AA M_murinus300150 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACAGTC--------AAA M_murinus300572 GGCATTCCT-CTGTGGGAAAGAAACT-CATGACACAGTC--------ATA M_domestica300179 TGTATTCCA-CTGTGGGAAAGGAACT-GTT-ACACTGTT--------AAA O_anatinus304356 AGTATTCCATCTGTGGGAAAGAAACTTGTTGACACTGTT--------CG- O_cuniculus300030 GGCATTCCA-CTGTGGGAAAGAAACT--GTTACACAATT--------GAA O_cuniculus300316 GGCATTCCA-CCGTGGGAAAGAAACT--GTTATACAATT--------AAA O_cuniculus300391 GG---------------GAGCGAATG--GTCACACAATC--------AAA O_garnettii300220 GGCATTCCT-CTGTGCGAAAGAAACC-GTTAACACAGCT--------AAA O_garnettii300406 GGCGTTCTG-CTGTGGGAAGGAAGCT-GTTAACACAGTT--------GAA O_garnettii300616 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACAGTT--------AAA P_troglodytes300316 TGCATTTCT-CT-----GTGGGAAAG--AAAAGAGGATT--------AAA P_troglodytes300641 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA------------AA P_pygmaeus300210 TGCATTTCT-CT-----GTGGGAAAG--AAAAGAGGATT--------AAA P_pygmaeus300368 TGCATTTCT-CT-----GTGGGAAAG--AAAAGAGGATT--------AAA P_pygmaeus300695 GGCATTCCT-CTGTGGGAAAGAAACT-GTTAACACA------------AA R_norvegicus300249 AGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT--------TAA R_norvegicus300536 AGCGTTCCT-CTGTGGGAAAGAAACT-GTT-ACACCATTACACCATTTAA R_norvegicus300853 AGCATTCCT-CTGTGGGAAAGAAACT-GTT-ACACAATT--------TAA R_norvegicus300907 AGCATTCCT-CTGTGGGAAAGAAACT-GTTA-CACAGTT--------TTA S_tridecemlineatus300247 AGCATTCCT-CTGTGGGAAATAAACT-GTT-ATACAATT--------ATA T_belangeri300366 GGCATTCCT-CTGTGGGAAAGAAACT-GTT--AACGGTT--------AAA * C_familiaris300382 C-ACCTCTTTCTTAGCACAACGGAAAGTGGG-CATAT--GAGTAACAAAC C_porcellus300155 T-ACCTCTTTCATACCCAAGAAGAAAGTGGG-CATGT--GAGTGACAGTG C_porcellus300350 T-ACCTCTTTCTTACCCAAGAAGAAAGTGGG-CATGT--GTGTGACAGAC C_porcellus300668 T-ACCTCTTTCTTACCCAAGAAGAAAGTGGG-CATGT--GTGTGACAGAC C_porcellus300789 T-ACCTCTTTCTTATCCAAGAAGAAAGTGGG-CATGT--GTGTGACAGTG C_porcellus300823 T-ACCTCTTTCTTATCCAAGAAGAAAGTGGG-CATGT--GTGTGACAGAC D_novemcinctus300145 T-ACTTCTTTCTTAGCAAAACAGAAAGTGGG---CATGTGTGTGACAAAG E_telfairi300027 T-CCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAGAC E_telfairi300044 T-CCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAGAC E_telfairi300236 A--CCTCCTTTCTA--AAAACATCAACTGGA---CATATGTGTGATGGAT E_telfairi300339 T-CCCTCTTCCCCAGCAAAATGGAAAGCTGGGCATATGTGTGTGACAGAC E_telfairi300368 T-CCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAGAC E_caballus300393 ---CCGCTTTCTTAGCAAAACAGAAAGCGGG---CATGTGTGTGACAAAC E_europaeus300251 T-AGTTCTTTCTTAGCAAAACAGAAAGTAGA---CATGTGTGTGACAAGG E_europaeus300360 T-G---CCCCATTAGCAAAATAGAAAGTGGA---CATGTGTGAGACAAAC E_europaeus300391 T-ACCTCTTGCCTAGCAAAACAGAAAGTTGG---CATATGTGTGACAAAT F_catus300230 T-ACCTCTTTCTTAGCACGACAGAAAGTGGG-CATGT--GAGTGACAAAC H_sapiens300507 C-ACCTCTTTCTTAGCAAAACAGAAAGTGGG-TATATATGTGTGACAGAC H_sapiens300519 C-ACCTCTTTCTTAGCAAAACAGAGAGTAGG---CATATGTGTGACAGAC L_africana300445 C-ACCTCTTTCTTAGCAAAACAGAAAGTGGG---CATATGTGTGACAGAC M_mulatta300367 C-ACCTCTTTCTTAGCAAAACAGAGAGTAGG---CATATGTGTGACAGAC M_mulatta300735 C-ACCTCTTTCTTAGCAAAACAGAAAGTGGG-CATAT--GTGTGACAGAC M_murinus300150 C-ACCTCTTTCTTAGGAAAACAGAAAGTGGG-TATAT--GTGTGACAGAC M_murinus300572 C-ACCTCTTTCTTAGCAAA-CGGAAAGTGGG-TATCA--GGGTGACAGAC M_domestica300179 TAACCTCTTTCTAATATAACAGAAAGTGGGT-TCTTT--GTGTGACAGAC O_anatinus304356 TTACCCCTTTCTCG-GCAACAGAATG-GGGT-TTTCT--GTGCGACAGAC O_cuniculus300030 C--ACTTCTTAGCA--AAA-CAGAAAGTAGG---CATATGTGTGAAGTAT O_cuniculus300316 T-ACCTCTGTCTTAGCAAAACAGAAAGTGGG---TATATGTGTGACACAC O_cuniculus300391 C-ACTTCTTTCTTAACAAAGCAGAAAGTGGG---CATATGTGTGACAGAC O_garnettii300220 C-ACCT--TTCTTAGCAAAACAGAAAGTG----ACAG--AAGAAAAAAAA O_garnettii300406 C-ACCTCTTTCTTAACAAAACAGAAAGTGGG---TATATATGTGACAGAC O_garnettii300616 T-ACCTCTTTCTTAGCAAAACAGAAAGTGGG-TATAC--GTGTGACAGAC P_troglodytes300316 C-ACCTCTTTCTTAGCAAAACAGAGAGTAGG---CATATGTGTGACAGAC P_troglodytes300641 C-CCCTCTTTCTTAGCAAAACAGAAAGTGGG-TATATATGTGTGACAGAC P_pygmaeus300210 C-ACCTCTTTCTTAGCAAAACAGAGAGTAGG---CATATGTGTGACAGAC P_pygmaeus300368 C-ACCTCTTTCTTAGCAAAACAGAGAGTAGG---CATATGTGTGACAGAC P_pygmaeus300695 C-ACCTCTTTCTTAGCAAAACAGAAAGTGGG-TATAT--GTGTGACAGAC R_norvegicus300249 T-GCCTCTTTCTTAGCCACATAGAAAGA-GG-AATATGCGTG--ACAGAC R_norvegicus300536 T-GCCTCTTTCTTAGCCACACAGAAAGAAGG-AATAAGCCTG--ACAGAC R_norvegicus300853 T-GCCTCTTTCTTAGCCACATAGAAAGA-GG-AATATGCGTG--ACAGAC R_norvegicus300907 T-GCCTCT----TAGCTACATAGAAAGAGGA----ATATGGGTGACAGAC S_tridecemlineatus300247 T-GCCTCTTTCTTAGCCAAAGAGAAAGTGGG-CACATGTGTGTGACAGAC T_belangeri300366 T-ACCTCTTTCTTAGTAAAATAGAAAGTAGT-CATGT--GTGTTTCAGAC * C_familiaris300382 ATAA C_porcellus300155 TAAA C_porcellus300350 AGTG C_porcellus300668 AGTG C_porcellus300789 TTAA C_porcellus300823 AGTG D_novemcinctus300145 TTAA E_telfairi300027 ACAG E_telfairi300044 ACAG E_telfairi300236 ACAA E_telfairi300339 ACAG E_telfairi300368 ACAG E_caballus300393 ACAG E_europaeus300251 TGTG E_europaeus300360 AA-- E_europaeus300391 AAGA F_catus300230 AGAT H_sapiens300507 ACAA H_sapiens300519 ACAA L_africana300445 AAGA M_mulatta300367 ACAA M_mulatta300735 ATAA M_murinus300150 ACAA M_murinus300572 ACAA M_domestica300179 ACCT O_anatinus304356 AAAT O_cuniculus300030 AGAA O_cuniculus300316 ATGA O_cuniculus300391 ATGA O_garnettii300220 AGAA O_garnettii300406 AGAA O_garnettii300616 AGAA P_troglodytes300316 ACAA P_troglodytes300641 ACAA P_pygmaeus300210 ACAA P_pygmaeus300368 ACAA P_pygmaeus300695 ACAA R_norvegicus300249 ACAA R_norvegicus300536 ACAA R_norvegicus300853 ACAA R_norvegicus300907 ACAA S_tridecemlineatus300247 ACAT T_belangeri300366 AAAA

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved