snOPY snoRNA Orthological Gene Database

Family: SNORA4

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300424 --------CTACCAAAAGT---TTGTTTTGGGGGGAAG--GTTTTT-TAATAACCTTTA- C_porcellus300269 --------AGACCAAAAGTTAAATTTCGAGGGT--AAAGTTTTT---TAATAAGCTTTA- C_porcellus300270 --------CTACCAAAAGTTAAATTTCGAGGGC--AAAGTTTTT---AAATAAGCTTTA- C_porcellus300881 --------CTACCAAAAGTTAAATTTCAAGGGT--AAAGTTTTT---AAATAAGCTTTA- D_novemcinctus300558 --------CTCCCAAAAGT---TA---TTCAGGGGAAG--GTTTTT-TAATAACCTTTA- D_melanogaster300242 -----------------------------CCGTTCTTGTGTTATTTTCTGGACGTT--GT D_melanogaster300243 -----------------------------CCGTTCTTGTGTTATTCGCTAAGCGAT-TAC D_melanogaster300244 -----------------------------CCGTTCTTGTGTTATTCGCTAGATCTT--TT D_melanogaster300245 -----------------------------TCGTTTTTGTGTTATTTGCTGGAAGTTACAT D_melanogaster300246 -----------------------------TCGTTCTTGTGTTTTTCGCTGGCTGTC-CTT E_telfairi300087 --------CTACTCAAAGTT-ATTTTTTGTGGC--AAGGTTTTTTTTCAATAATCCCTA- E_telfairi300121 --------ATATCAGAAGTTGATTTTTTGAGGC--AAGGGGTTTTTA--GTAACGTTTA- E_telfairi300151 --------CTACCAAAAGTTCATTTTTGGAGGC--AAGGGTTTTTTA--ATAACCTTTA- E_telfairi300248 -------CTTCCAAAAAGTTCATTTTTGGAGGGCAAGGGGTTTTTTA--ATAACCTTTTA E_telfairi300525 --------TTACCAAAAGTTGATTTTTGGAGGC--AAGGGTTTTTTA--ATAACCTTTA- E_telfairi300607 ---------------------------------TTACTTTTTCTTTATGT---TTGACA- E_telfairi300681 --------CTACCAAAAGTTGATTTTTGGAGGC--AAGGGTTTTTTC--ATAACCTTTA- E_telfairi300794 --------ATACCAAAAGTTGATTTTTGGAGGC--AAGGGTTTTTTA--ATAACCTTTA- E_telfairi300806 --------CTACCAAAAGTTGATTTTTGGAGGC--AAGGGTTTTTTC--ATAACCTTTA- E_caballus300349 --------ATACCAAAAGTG--TTTTTTTTGTGGGAAG--GTTTTT-TAATAACCTTTA- F_catus300326 --------CTACCAAAAGT---TTGTTTTGGGGGGAAG--GTTTTT-TAATAACCTTTA- H_sapiens300617 ---------TACCAAAAGTTAGCTTTTTGGGGG--GCAGGTTTT-T-AAGTAACCTTTG- L_africana300459 --------CTACCAAAAGTT-ATTTTG-GGGGC--AAGGTTTTTTTT-AATAACCTTTA- M_mulatta300061 --------CTATCAAAAGTTACTTTTTGTGGGGTGGAA--GTTTTTAAAATAACCTTTA- M_mulatta300412 --------CAACCAAAAGCTAATTTTTTTGTGGGGAAAGCTTTCTA--AATAACCTTTA- M_mulatta300610 --------CTACCAAAAGTTAGCTTTTTGGGGG--GAAGGTTTT-T-AAGTAACCTTTG- M_murinus300127 --------TTACCAAAAGGTAATTTGGTTGGAG--AGAGGTTGT-TAAAATAACCTTTA- M_murinus300494 --------CTACCAAAAGTTAGTTTTGGAGGGG-GAAGGTTTTGTTATAATAACCTTCA- M_musculus300370 TGACCAGTTTCTGTCCATCCTGCTCATAAGAAGTGCTCCA-GAATATTAAAAAGCCTTAA M_musculus300421 ------------------------------CCACAAAAAAATGGACAAA---AGTAAAA- M_musculus300794 --------CTACCAGAAGCTATATTTGTGGGGA----AGGTTTTATTAAATTACCTTAA- M_musculus300850 ---------TCAGTAAATGTT------AAAACATTAAAAA-GCATGACCTGTAAACTTAA M_musculus300876 --------GTACCAAAAGCTAGATTTGTGGGGA----AGGTTT-ATTAAATAACCTTAA- O_anatinus304520 --------GTTCCAAAAGCCAACGTTGCGGGGA---AGGCCGTG----ACCAGCCTTCG- O_cuniculus300504 --------CTACCAAAAGTTAACATTTT-GGGGGGAAGGTTTTGTT--AATAACCTTTA- O_garnettii300443 --------TAGTTAAAAATCACTCATCATGGGGGGGAAATGTTTTTGTAATACCATTTA- P_troglodytes300009 --------CTATCAAAAGTTACTTTTTGTGTGGTGGAA--GTTTTTAAAATAACCTTTA- P_troglodytes300014 --------CTACCAAAAGTTAATTTTTT-ATGGGGAAGGCTTTCTA--AATAACCTTTA- P_troglodytes300082 --------TTACCAAAAGTTAATGTTTTCAGAG--AATGCTTTTGTTAAAAAGCCTTTA- P_troglodytes300634 --------CTACCAAAAGTTAGCTTTTTGGGGG--GCAGGTTTT-T-AAGTAACCTTTG- P_pygmaeus300052 --------TTACCAAAAGTTAATGTTTTCAGAG--AATGCTTTTGTTAAAAAGCCTTTA- P_pygmaeus300206 --------CTACCAAAAGTTAATTTTTT-ACGGGCAAGGCTTTCTA--AATAACCTTTA- P_pygmaeus300507 --------CTATCAAAAGTTACTTTTTGTGGGGTGGAA--GTTTTTAAAATAACCTTTA- P_pygmaeus300730 --------CTACCAAAAGTTAGCTTTTTGGGGG--GAAGGTTTT-T-AAGTAACCTTTG- R_norvegicus300461 ---------TAAACTCATTTAAATAAGATGAAATTCAGGTTTTATTAAAT--AACCTTAA R_norvegicus300656 -----GCACTAAAGAGGCTTTATCTTGATACTGCAACACTTTCATTAAGT--ACTGGAA- R_norvegicus300801 ---------CAAACAAATAAAAACCTAATAATATAAAGGTCTTGCTAA-T--AACCTTAA R_norvegicus301033 --------GTACCAAAAGCTAGATTTGTGGAAA----AGGTTTTATTTAATAACCTTAA- R_norvegicus301057 --------------AGATCCTGTTTTATCTGCTTCAAACTTGGTTAAGAAAAATTGCTAC S_araneus300974 --------CTACCAAAAGATAATTCTT----GG--GGAGGTTTT-T-TAGTAACCTTTG- T_belangeri300360 --------ATACCAAAAGTAAAGTGTTTGGGGG--GAAGGTTTT-TCTGATAACCTTTA- T_belangeri300392 --------CTACCAAAAGTAA-GTGTTTTGGGG--GAAGGTTTT-TCTGATAACCTTGA- C_familiaris300424 -CCAGATTGG-G-CTGTTTGGGAGA----TTAAAGAAAAGA--CCA-CACTCCACAGTGG C_porcellus300269 -CCAATCTAA-G-CTCTTTGGGAGG----CTAAAAGA------CCA-CACTCCACAGTGA C_porcellus300270 -CCAATCTAG-G-CTGTTTGGGAGA----CTAAAAGA------CCA-CACTCCACAGTGA C_porcellus300881 -CCAATCTAG-G-CTATTTGGGAGA----CTAAAAGA------CCA-CACTCCACAGTGA D_novemcinctus300558 -CCAATTTGG-G-CTGTTTGGGAGA----ATAAA---AGGA--CCA-CACTCCACAGTGG D_melanogaster300242 TCAAGTCCAGCGATCGTCAAACAGAACGCAAAGTAATG-CAACGAATCACTCCACAATG- D_melanogaster300243 CTAAGCTCAGCGATTGTCAAACAGAACGTAGATTAACTGCCGCTAATCACTCCACAATG- D_melanogaster300244 CATGGCCTAGCGAGCGTCAAACAGAACGCAAACTGAAG-CAACGAATCACTCCACAATG- D_melanogaster300245 CCAAAGCCAGTGATTGTCAAACAGAACGTAAATTAATG-CGGCT-ATCACTCCACAATG- D_melanogaster300246 CCAAAGCCAGTGATTGTCAAACAGAACGTACATTAATGGCAGCTTATCACTCCACAATG- E_telfairi300087 -CCAGTTTGG-G-CTATTTGGGAAA----ATAAAGAGAAGG--CCA-CACTCCCCAGTGG E_telfairi300121 -CCAGTTTGG-G-CTGTTTGGGAGA----ATAGAGAGAAGA--CCA-CACTCCACAGTGG E_telfairi300151 -CCAGTGTGG-G-CTGTTTGGGAGA----AAAAAGAGAAGA--CCA-CACTCCACA-GTG E_telfairi300248 CCCAGTGTGG-GGCTGTTTGGAAGA----AAAAAAGAGAAAGACCA-CACTCCACA-GTG E_telfairi300525 -CCAGTTTGG-G-CTGTTTGGGAGA----ATAAAGAGAAGA--CTG-CATTCCACAGTGG E_telfairi300607 -TCAATTTTT-A-AAATGTGTCA-A----ATGA---AGA----CCA-CACTCCACAGTGG E_telfairi300681 -CCAGTGTGG-G-CTGTTTGGGAGA----ATAAAGAGAC-----CA-CACTCCACAGTGG E_telfairi300794 -CCAGTTTGG-G-CTGTTTGGGAGA----ATAAAGAGAAGA--CCA-CACTCCACAGTGG E_telfairi300806 -CCAATATGG-G-CTGTTTGGGAGA----ATAAAGTGG----------ACTATATATATA E_caballus300349 -CCAACTTAG-G-GTTTTTGGGAGA----GTAAA-AAAAGG--CCA-TGCTCCACAGTGG F_catus300326 -CCAACTTGG-G-CTCTTTGGGAGA----ATAAAGAACAGA--CCA-CACTCCACAGTGG H_sapiens300617 -CCAACTTGG-G-CTATTTGGAAGA----GTAAAAG------ACCA-CACTCCACAGTGG L_africana300459 -CCATTTCGG-G-CTATTTGGGAGA----ATAAAGAAAAGA--CCA-CACTCCACAGTGG M_mulatta300061 -CCTACTTGG-G-CTGTTTTGGAAA----ATAAAGAAAAGA--CCA-CACATAACAGTGG M_mulatta300412 -CCAATTTGG-G-CTACTTGGAAGA----GTAAAGGAAAGA--CCG-CACTCCA--GTGG M_mulatta300610 -CCAGCTTGG-G-CTATTTGGAAGA----GTAAAAG-----GACCA-CACTCCACAGTGG M_murinus300127 -CCAGCTTGG-T-CTATTTGGGAGA----ATAAAGAA----ATATT-CTCTCCACAGTGG M_murinus300494 -CCACCTTGG-G-CTGTTTGGGAGA----GCAAAGAAAAGA--CCA-CACTCCACAGTGG M_musculus300370 -CCAATTCAT-G-CTATTTGGCAGA----ATGAGTAAGA----CCA-CACTCCACTGTGG M_musculus300421 -CCA--TCAG-G-CTATTTGATAGA----ATGAGTAAGA----CCA-CACTCCACAGTGG M_musculus300794 -CCAATGCAG-G-CTATTTGGTAGA----ATGAGTAAGA----CCA-CACTCTGCAGTGG M_musculus300850 -CTAATCCAG-G-CTATTTGGCAGA----AGGAATAAGA----CCA-CACTCCACAGTAG M_musculus300876 -CCAATTCAG-G-CTATTTGGTAGA----ATAAGTAAGA----CCA-CACTCCACAGTGG O_anatinus304520 -CCGGGTCGG-G-CTCTTTGGAAGA----GAAAAAAAGA----CCG-CACTCCACGGTGG O_cuniculus300504 -CCAACTTTG-G-CTATTTGGGAGA----GTAAAGAAAAGA--CCA-CACTCCACAGTGG O_garnettii300443 -TGAATTTGG-G-CTATTTGGGAAG----ATAAAGAAAACA--CCA-CCCTCCACAGTGG P_troglodytes300009 -CCTACGTGG-G-CTGTTTTGGAAA----ATAAAGAAAAGA--CCA-CACTCAGCAGAGG P_troglodytes300014 -CCAATTTGG-G-CTATTTGGGAGAGAGAGTAAAGGAAAGA--CCA-CACTCCACAGCGG P_troglodytes300082 -CCAACTTGG-G-CTGTTTGGGATA----ATAATGTT----GACCA-TTTTCCACAGTGG P_troglodytes300634 -CCAACTTGG-G-CTATTTGGAAGA----GTAAAAG------ACCA-CACTCCACAGTGG P_pygmaeus300052 -CCAACTTGG-G-CTGTTTGGGATA----ATAATGTT----GACCA-CTTTCCACAGTGG P_pygmaeus300206 -CCAATTTGG-G-CTATTTGGGAGA----GTAAAGGAAAGA--CCA-CACTCCACAGCGG P_pygmaeus300507 -CCTACTTGG-G-CTGTTTTGGAAA----ATAAAGAAAAGA--CCA-CACTCAGCAGAGG P_pygmaeus300730 -CCAGCTTGG-G-CTATTTGGAAGA----GTAAAAGA---AGACCA-CACTCCACAGTGG R_norvegicus300461 -CCAATTCAG-G-CTATTTGGCAAA----ATGAGTAAGA----CCA-CACTCCACAGTGG R_norvegicus300656 -GCA--TCAC-A-CTATTTGGCAGA----ATGAGTAAGA----CCA-CACTCCACAGTGG R_norvegicus300801 -CCAATTCAT-G-CTATTTGGCAGA----ATGAGTAAGA----CCA-CACTCCACAGTGG R_norvegicus301033 -CCAGTTCAC-G-CTATTTGGCAGA----ATGAGTAAGA----CCA-CACTCCACAGTGG R_norvegicus301057 -TCAATTCAG-G-CTATTTGGCAGA----ATGAGTAAGA----GCA-CACTCCACAGTGG S_araneus300974 -CCAGCTTGA-A-CTTTTTGGGAGA----AAAAAAGCTGAAGACCA-CACTCCACAGTGG T_belangeri300360 -CCACCTTGA-G-CTATTTGGGAGA----TTAAGG-------ACCA-CACTCCACAGTGG T_belangeri300392 -CCACCTTGA-G-CTATTTGGGAGA----TTAAAG-------ACCA-CACTCCACAGTGG * C_familiaris300424 GCT-ATATCACTTAACG---TATAGTTCACTACTATTTTGTGGCCTACATT- C_porcellus300269 ACT-ATACCACTCAGT-----ATAGTTCATTACTATTTTGTGGC-TACATT- C_porcellus300270 ACT-ATACCACTCAGT-----ATAGTTCATTACTATTTTGTGGC-TACATT- C_porcellus300881 ACT-ATACCACTCAGT-----ATAGTTCATTACTATTTTGTGGC-TACATT- D_novemcinctus300558 GCT-ATTGCACTTAAC-----GTAGCTCACTACTATTCCGTGGCCTACATT- D_melanogaster300242 -TTGGGTCTACTTTGCCAGGACAGCATCATTACTTAAGGA-TTGCAACAGCA D_melanogaster300243 -TTGAGCCGACTCT-CAACGGCTACTGCATTACTATATG---CGCCACATTC D_melanogaster300244 -GTGGGTCTACTTTACCAGGACTGCATCATTACTAAAGGA-TTGCTACAGTT D_melanogaster300245 -TTGAGCCGGCTTT-CCAGGGCTACTGCATTACTTTTCGGCTCGCCACACTC D_melanogaster300246 -TTGAGCCGAGTTT-TCACGGTTACTGCATTACTTTCCGGCTCGCCACATCA E_telfairi300087 GCT-ATACCACTTAGT-----ATAGTTCACTACTATTTTGTGGCCTACATT- E_telfairi300121 GCT-ATACCACTTAGC-----ATAGTTCGCTGCTATTTTGTGGTCTACATT- E_telfairi300151 GCT-ATACCACTTAGT-----ATAGTTCGCTACTATTTTGTGGCCTACATT- E_telfairi300248 GCT-ATACCACTTAGT-----ATAGTTCGCTACTATTTTGTGGCCTACATT- E_telfairi300525 GCT-ATACCACTTAGT-----ACAGTTGGCTACTATTTTGTGGCCTACATT- E_telfairi300607 GCT-ATACCACTTAGT-----ATAGTTCGCTACAATTTTGTGGCCTACATT- E_telfairi300681 ACT-ATACCACTTAGT-----ATAGTTCGCTACTATTTTGTGGCCTACAGT- E_telfairi300794 GCT-ATACCACTTAGT-----ATAGTTCGCTACTATTTTGTGGCCTACAAT- E_telfairi300806 TAT-ATATATATATAT-----ATACTATATCACT-TAGTATAGT-------- E_caballus300349 GCT-ATACCACTTAAT-----GTAGTTCACTACTATTTTGTGGCCTACATT- F_catus300326 GCT-ATACCACTTAAC-----ATAGTTCACTACTATTTTGTGGCCTACATT- H_sapiens300617 GCT-ATACCACTTAG-----TATAGTTCGCTACTATTTTGTGGCCTACATG- L_africana300459 GCT-ATACCACTCAGT-----ATAGTTCGCTACTATTTTGTGGCCTACAGT- M_mulatta300061 GCT-ATATCCCTTAGT-----ATAGTTCACCACTATTTTGTGGCTTATATT- M_mulatta300412 GTT-ATACCA-----------ATAGTTCAGTACTATTTTGTGGCCTACATT- M_mulatta300610 GCT-ATACCACTTAG-----TATAGTTCGCTACTATTTTGTGGCCTACATG- M_murinus300127 CCT-GTACAACTTA-----GTATAATTTACTACTACTTTATGGCCTATATT- M_murinus300494 GCT-ATACCACTTAGT-----ATAGTTCATTACTATTTTGTGGCCTACATT- M_musculus300370 GCT-ATACTACTTAGT-----ATGGTTCATTACTATATTGTGGCCTACATT- M_musculus300421 GCT-ATACCACTTTGT-----ATGGTTCATTATTATATTGTGGCCTACATT- M_musculus300794 GAT-ATACCACTTAGT-----ATGGTTCATTACTATATTGTGGCCTACATT- M_musculus300850 GCT-GTACCCCTTAGT-----ATAGTGCATTACTATATTGTGGTCTACATT- M_musculus300876 GCT-ATACCACTTAGT-----ATGGTTCATTACTATATTGTGGCCTACATT- O_anatinus304520 ACT-ATATATCCGGTT-----GTAGTTCATTACTGTAAGGTGGCCAACAGA- O_cuniculus300504 GCTTATACCATTTAGT-----ATAGTTCACTACTATCTTGTGGCCTACAGT- O_garnettii300443 GCT-ATTCCACCTAGG-----GTAGCTCACTACAATTTTGTGGCCTCCATT- P_troglodytes300009 GCT-ATACCCCTTAGT-----ATAGTTCACCACTGTTTTGCAGCTTATATT- P_troglodytes300014 GCT-ATACCA-----------ATAGTTCACTACTATTTTGTGGTCTACATT- P_troglodytes300082 GTT-ATAACATTAATATATATATAATTCACTACTAGTTTGTAATCTACATT- P_troglodytes300634 GCT-ATACCACTTAG-----TATAGTTCGCTACTATTTTGTGGCCTACATG- P_pygmaeus300052 GTT-ATAACATTAATATACATATAATTCACTACTAGTTTGTAATCTACATT- P_pygmaeus300206 GCT-ATACCA-----------ATAGTTCACTACTATTTTGTGGTCTACATT- P_pygmaeus300507 GCT-ATACCCCTTGGT-----ATAGTTCACCACTATTTTGCAGCTTATATT- P_pygmaeus300730 GCT-ATATCACTTAG-----TATAGTTCGCTACTCTTTTGTGGCCTACATG- R_norvegicus300461 ACT-ATACCACTTAGT-----ATTGTTCATTACTATACTGTTGCCTATATT- R_norvegicus300656 ACT-ATACCACTTAGT-----ATGGCTCATTACTATATTGTGGCCTACATT- R_norvegicus300801 ACT-ATACCACTTACT-----ATGGTTCATTACTATATTGTGGCCTACATT- R_norvegicus301033 ACT-ATACCACTTAGT-----ATGGTTCATTACTATATTGTGGCCTACATT- R_norvegicus301057 ACC-ATACCACTTAGT-----ATGGTTCATTACTATATTGTGGCCTACATT- S_araneus300974 -CT-ATATCACTCAGC---ATATAGCTTGCTACTAACTTGTGGCCTACATT- T_belangeri300360 GCT-ATATCACTTAG-----TACAGTCCACTACTATTCTGTGGCCTACATG- T_belangeri300392 GCT-ATATCACTTAG-----TACAGTCCACTACTATTATGTGGCCTACATG-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved