snOPY snoRNA Orthological Gene Database

Family: SNORA36

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300052 -----------------CACGGCCAGTTTGA---GTTGATT--------- C_familiaris300203 ------------GCCTTGA-GTTCAGTTCAG--GGCAGCCC--------- C_familiaris300310 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- C_familiaris300355 -----TTCCAAAGTGTTGA-GTTCAGTTCAA--GGTAGCTT--------- C_porcellus300717 ------TCCCAAATTTTGACGATCAGTTCAG--GGTATATT--------- C_porcellus300922 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAACTT--------- D_rerio300284 -----AGCCAAAGCGTTGA-GTTCAGCTCTG--GGTTTCTC--------- D_novemcinctus300084 -----TTCCAAAGTGTTGA-GTTCAGTTCAC--AGAGGCTT--------- D_novemcinctus300222 TCACAAAGGTAAAAAGGCA-ACCTAATTTAG--AGTAGCTT--------- D_novemcinctus300323 -----TTCCAAAGCATTGA-GTTCAGTTTAG--GGCATCTT--------- D_novemcinctus300347 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGTAGTTT--------- D_novemcinctus300369 -----TTCCAGAGTGTTGA-ATTCAGTTCAG--GTCAGCTT--------- D_novemcinctus300514 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAACTT--------- D_melanogaster300219 ---------------TTTGCCCCCGGTTGAGTACGGAAATA--------- E_telfairi300196 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GACAGCTT--------- E_telfairi300291 ------TACAACAGA------AATAACCGTA--GTCTAAGA--------- E_telfairi300349 -----TTCCAAGGGCTTCC-CAAGTGTTGAG--GGCAGCTT--------- E_telfairi300359 ------TTTAAAAAT------AACATTTACA--GCTT------------- E_telfairi300407 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- E_telfairi300501 -----TTCCAAAGTGT-GA-GTTCAGTTCAG--AGCAGCTT--------- E_telfairi300609 -CATCAATAAAAAAC------AGTGGTTCAG--GGCAGCTT--------- E_telfairi300835 -----TCCCAAAGTGTTGA-GTTCAGTTCAG--GGCTGCTC--------- E_caballus300000 ------------GCTTTGA-GTTCAGTTCAG--GGCAGCTG--------- E_caballus300275 -----TTCCAAAGCGTTGA-GTTCAGTTCAG--GGTAGCTT--------- E_caballus300378 -----CTCCAAAGTGTTGA-GTGCAGTTCAG--GGTAGCTT--------- E_europaeus300004 -----CTTCAAAGCTTTGG-GTTCATTTCAG--AGAAGCTT--------- E_europaeus300047 -----TTTCTAAGTGTCAA-GTTCAGTTCAG--GACAGCTT--------- E_europaeus300347 -----TCCCATAGTGTTGA-GTTAGGTTCAG--GGCAGCTT--------- E_europaeus300448 ------TTTATAATCCAGT-GTTCAATTCAG--GACAGTTT--------- E_europaeus300596 -----TGCCAAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- E_europaeus300625 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCTGATT--------- E_europaeus300659 -----TTCTAAAGTGTTGA-GTTTGGTTCAG--GGTGGCTT--------- E_europaeus300720 -----ATGCAGAGTGTTGA-GTTCAGTTCTG--GGAAACTT--------- H_sapiens300499 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- H_sapiens300552 --------CAATGCCTTGA-GTTCAGTCGAG--GACAGCTT--------- H_sapiens300646 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- H_sapiens300767 -----TTCCAAAGTGTTAA-GTTCAGTTCAG--GGTAGCTT--------- M_mulatta300121 -----TTCCAAAGTATTGA-GTTCAGTTCAA--GGCAGCTT--------- M_mulatta300345 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGTGGATC--------- M_mulatta300637 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- M_mulatta300699 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- M_mulatta300725 --------CAATGCCTTCA-GTTCAGCCGAG--GACAGCTT--------- M_murinus300221 -----TTCAAAAGTGTTGA-CTTCAGTTCAG--GGAAGCTT--------- M_murinus300281 --------TTCTATACTCT-TCATAATCTAATTGATGTACT--------- M_murinus300397 -----TTCCAAAGTGTTGA-GTTCAG-------GGAAGCTT--------- M_murinus300498 -----TTCCAACATGTTGA-GTTCAGTTCAG--GGAAGCTT--------- M_murinus300577 -----TTCCAAAGTGTTGA-GTGCAGTTCAG--GGAAGCTT--------- M_domestica300191 -----ATCCAAAGTGTTGA-GTTCAGCACAG--GGAAGTTC--------- O_anatinus303565 -----CTCCAAAGTGTTGA-GTTCAGGTCAG--GGTTTCTC--------- O_anatinus304502 -----CTCCAAAGTGTTGA-GTTCAGGTCAG--GGTTTCTC--------- O_cuniculus300445 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCATCTT--------- O_garnettii300067 --------TTCCTTGTTTG-TT-TAATTAAGGAAAT-CCTT--------- O_garnettii300671 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGAAACTT--------- P_troglodytes300220 -----TTCCAAAGAATTGA-GTTCAGTTCAA--GGCAGCTT--------- P_troglodytes300383 -----TTCTAAAGTGTTGA-GTTCAGTCCAG--GGTGGATC--------- P_troglodytes300506 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- P_troglodytes300598 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- P_troglodytes300712 --------CAATGCCTTGA-GTTCAGTCGAG--GACAGCTT--------- P_pygmaeus300526 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--TGTGGATC--------- P_pygmaeus300619 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- P_pygmaeus300675 -----TTCCAAAGTGTTGA-GTTCAGTCCAG--GGCAGCTT--------- P_pygmaeus300761 --------CAATGCCTTGA-GTTCAGTCGAG--GACAGCTT--------- R_norvegicus300078 -----CTCCAAAGTGCTGA-GTTCAGTTCAG--GGCAACTT--------- R_norvegicus300149 -----CTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAACTT--------- R_norvegicus300556 -----CTCCAAAGGGTTGA-GCTTGGTTCAG--AGCAACTT--------- R_norvegicus300582 -----CTCCAGAGTATTCA-GTGCAGTTCAG--GGCAGCTT--------- R_norvegicus300839 -----CTCCGAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- R_norvegicus300926 ----------GTGTGTATA-TCATCGTTAAA--AATATTTT--------- R_norvegicus300929 -----CTCCAAAGGGTTGA-GTTCAGTTCAG--GGCAACTT--------- R_norvegicus301007 -----CCCCAGAGTGTTGA-GTTCAGTTCAG--GGCCGCTT--------- R_norvegicus301031 -----CTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAACTT--------- R_norvegicus301064 -----CCCCAGAGTGTCAA-GTTCAGTTCAG--GGCAGCTT--------- R_norvegicus301065 -----GTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAACTT--------- R_norvegicus301092 -----CTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAATTT--------- S_cerevisiae300009 -----TTGCCCTGTGCCTC-GCTCGGTTGTT--AATTGCCAATATTACGA S_araneus300024 -----AACCAAAGTGTTGA-GCCTAGTTCAG--GGCTGCTT--------- S_araneus300072 -----GACCAAAGTATTGA-GCTTAGTTCAG--GATTGCTT--------- S_araneus300119 -----TACCTAAGTATTGA-GGTTAGTTCAG--GGCTGCTT--------- S_araneus300513 --------CAAAATATTAA-GCCTAGTTCAA--GGCTGCTT--------- S_araneus300652 -------GTTAAGCCTAGT-TCAGGGATCAG--GGCTGCTT--------- S_araneus300698 -----AACCAAAGTGTTGA-GCATAGGTCAA--GGCTGCTT--------- S_araneus300703 -----AACCAAGGTGTTGA-GCATAGTTCAG--GACTGTTCTGGTAATTA S_araneus300893 -----CACCAAAGTGTTGA-GCCTTATCCAG--GGCAGCTT--------- S_araneus301016 -----AACCAAAGTGTTGA-GTCTAGTTCAG--GGCTGCTT--------- S_araneus301017 -----AACCAAAGTGTTGA-GTCTAGTTCAG--GGCTGCTT--------- S_araneus301077 -----AACCAAAGCGTTGA-GCCTAGTTCAG--GGCTGCTT--------- S_tridecemlineatus300329 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- T_nigroviridis300157 -----GTTCAAAGTGTTGA-GTTCTGCCCTG--CTGCTCAG--------- T_belangeri300197 -----TTCCTAAGAGTTGA-ATTCAGTTCAG--GGCAGCTT--------- T_belangeri300263 -----TTCCTAAGTGTTGA-GTTCAGTTCAG--GGCAGCAT--------- T_belangeri300419 -----TTCCAAAGTGTTGA-GTTCAGTTCAG--GGCAGCTT--------- C_elegans300052 CGCTCTTTCGC--AATAGAGCTTTGAGT-CAAATTACTGT--------CC C_familiaris300203 CCCTGCTTAGT---ATTAAACTCTGGG---ACAT--------------GA C_familiaris300310 CCCTGTTCTGT-TAATTAGACTTTGGA---ACATTGAA----------GC C_familiaris300355 CCCTGTTCTGT-TAATTGAACTTTGGA---ACATTGAA----------AT C_porcellus300717 TTCTGCTCTGG-TAAATTAAACTTTGA---ACATGAAA------------ C_porcellus300922 CCCTGGTCTGA-TAATTAAACTTTGGG---ACATTGAA------------ D_rerio300284 CCCAGTTCTGC-TAATTAATCTTTGGT---ACAGAAAA------------ D_novemcinctus300084 CCCTGTTCTAT-TACTTAAACTTTGGG---AAATTGAA----------AT D_novemcinctus300222 CCCTGTTCTGT-TAATAAAACTTTGGA---AAATTG------------AA D_novemcinctus300323 CCCTGTTCTGT-TCATTAAACTTTGGG---AGATTGAA----------GT D_novemcinctus300347 CTCTGTTCTGT-TAATTAAACTTTGGA---AAATTGAA----------AT D_novemcinctus300369 CCCTGTTCT-----ATTAAACTTTAGG---AAATTTAA----------AT D_novemcinctus300514 CTCTGTTCTGT-TAATTAAACTTTGGG---AAATTGAA----------AT D_melanogaster300219 -CGTGTTTAGC-ATCTAGAACAGTTTCC-TTAATTAAG-----------G E_telfairi300196 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTA------------AA E_telfairi300291 ATATAATTTGA-TAATTAAACTTTTGG---ACATTA------------AA E_telfairi300349 CCCTGTTCTAT-TAATTAAACTTTGGG---ACATTA------------AA E_telfairi300359 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTA------------AA E_telfairi300407 CCCTGTTCTGC-TAATTAAACTTTGGG---ACATTA------------AA E_telfairi300501 CACTGTTCTGT-TCATTAAACTTTGGG---ACATCG------------AA E_telfairi300609 CCCTGTTCTGT-TCATTCAACTTTGAG---ACATTA------------AA E_telfairi300835 CCCTGATCTGG-TAATTGAACTTTGGG---ATATCGAA----------AT E_caballus300000 TCCTGTTCTGT-TAATTAAACTCTGGG---ACATTGAA----------CC E_caballus300275 CCCTGTTCTGT-TAATTAAACTTTGGA---ACATTGAA----------AC E_caballus300378 CCCTGTTCTGT-TAATTAGACTTTGGA---ACATTGAA----------AC E_europaeus300004 CCCTGCTCTGC-TCATTAAACTTAAGG---GCTTTGAA----------CA E_europaeus300047 CCCTGTTCTGC-TTATTAAACTTTGGGG-CACATTGAA----------AC E_europaeus300347 CCCTGTTCCGT-TAATTAAGCTTTGGA---ACACTGAA----------AT E_europaeus300448 TCCTGTTCTGT-TAATTTAAATTTTGG---ATATTGAA----------AC E_europaeus300596 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AA E_europaeus300625 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AC E_europaeus300659 TCCTGTTCTGT-TAATTAAGCTTTGGG---ATATTGAA----------AT E_europaeus300720 TCCTGTTCTGT-TAATAGAACTCAGGG---ACATTGAA----------AT H_sapiens300499 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AT H_sapiens300552 CCCTTTTCTGT-TAATTAAACTTTGGA---ATGTTGGGGCATTA----AA H_sapiens300646 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTAAA----------AT H_sapiens300767 CCCTGCTCTGT-TAATTAAACTTTGGA---ACATTGAA----------AC M_mulatta300121 CCCTATTCTGT-TAACTAAACTTTGGG---ACACTGAA------------ M_mulatta300345 TCCTGCTCTGT-TAATTAAAC--TGGA---ACATTTCA----------AC M_mulatta300637 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AT M_mulatta300699 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTAAA----------AT M_mulatta300725 CCCTTTTCTGT-TAATTAAACTTTGGA---ACGTTGGGGCATTA----AA M_murinus300221 CCCTGTTCTGA-TAATTAAACTT---G---ACATTGAC----------AT M_murinus300281 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTG------------AC M_murinus300397 CCCTATTATGT-TAATCAAACTTTGGG---ACATTGAC------------ M_murinus300498 CCCTGTTGTAT-TTATTAAACTTTGGG---ACATTGAC----------AT M_murinus300577 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAC----------AT M_domestica300191 CCCTGTTCTGT-TAATT-AACTTTGGA---ACATTAAG----------AA O_anatinus303565 CCCTGTTCTGG-TAATTTAACTTTGGA---ACATTGGT----------AA O_anatinus304502 CCCTGTTCTGG-TAATTTAACTTTGGA---ACATTGGT----------AA O_cuniculus300445 CCCTGTTCTGT-TAATTAAACTTTGGT---ACACTAAA----------AG O_garnettii300067 CCTTGTTCTGT-TAATTAAACTTTGGG---ACATTG------------AA O_garnettii300671 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AT P_troglodytes300220 CCCTGTTCTGT-TAACGAAACTTTGGG---ACATTGAA----------AT P_troglodytes300383 CCCTGCTCTGT-TAATTGAAC--TGGA---ACATCTAA----------AC P_troglodytes300506 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTAAA----------AT P_troglodytes300598 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AT P_troglodytes300712 CCCTTTTCTGT-TAATTAAACTTTGGA---ATGTTGGGGCATTA----AA P_pygmaeus300526 CCCTGCTCTGT-TAATTGAAC--TGAA---ACATTTAA----------AC P_pygmaeus300619 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTAAA----------AT P_pygmaeus300675 CCCTGTTCTGT-TAATTAAACTTTGGG---ACGTTGAA----------AT P_pygmaeus300761 CCCTTTTCTGT-TAATTAAACTTTGGA---ACATTGGGGCATTA----AA R_norvegicus300078 CCTTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus300149 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus300556 CCCTGTTGTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus300582 CCATGTTCTGT-TAATTAAACGTTGGA---ACATTGAA------------ R_norvegicus300839 TCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus300926 TCTT----TGT-TAATTAAACTTTGGG---ACATTG------------AA R_norvegicus300929 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus301007 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus301031 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ R_norvegicus301064 CCCTGTGCTGT-TAATTAAACTTCGGG---ACATTGAA------------ R_norvegicus301065 CCTTGTTCTGT-TAATTAAACTTTGGG---ACATGGAA------------ R_norvegicus301092 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA------------ S_cerevisiae300009 TCTTGAGCTGGATGACAAAAAAATAAAAATACATTTTATTTTTTTGATCA S_araneus300024 CCCTGCACTTG-CAATTAAACTTTGGG---ACAGTAAG----------TT S_araneus300072 CCCTGTTTTAG-TAATTAAACTTTGGG---ACATTAAG----------AC S_araneus300119 CCCTGTTCTGA-TAATTTAACTTTGGG---ACATTAAG----------AC S_araneus300513 TCCTGTTGTGG-TAATTAGGTTTTGAA---ATATTAAG----------AC S_araneus300652 CCCTGTTCTGG-TAATTAA-TTTTGGA---ACATTAAG----------AC S_araneus300698 TCCTGTTTTGA-TAATTAAACTTTAGG---ACAGGAAG----------AT S_araneus300703 CCCTGTTCTAG-TAATTAAACTTGGGG---ACAGTAAG----------AC S_araneus300893 CCCTGTTCTAG-TAATTAAACTTTGGG---ACACTAAG----------GT S_araneus301016 CCCTGTGCTGG-TAATTAAACTTTGGA---ACAGTAAG----------AC S_araneus301017 CCCTGTGCTGG-TAATTAAACTTTGGA---ACAGTAAG----------AC S_araneus301077 CCCTGTTCTGG-TAATAAGACTTTGGG---ACATTAAG----------AC S_tridecemlineatus300329 CCCTGTTCTGT-TAATTAAACTTTGGA---ACATTAAA------------ T_nigroviridis300157 TGCAGGTCTGA-TAATTAAGCTTTGAA---ACAGGAAG------------ T_belangeri300197 CTCTGTC-TGT-TCTTTAAACTTTGGG---ACAATCGA------------ T_belangeri300263 ATCTGTTCC----------ACTTTGAG---ATGTCGAA----------AT T_belangeri300419 CCCTGTTCTGT-TAATTAAACTTTGGG---ACATTGAA----------AT C_elegans300052 GGAAATTATAGAGATGAAGCTCATTTGGAGCAATAACAATTGTTGAAGCT C_familiaris300203 CCAGGCTAGGGTAGA-TGATTACATGGGGA------ATATTACTCTATT- C_familiaris300310 CTGGGCCGTGAGAGG-TGGTTGGATAGAACG------CATTACTCTATT- C_familiaris300355 -GGGC-TAGGAAAAA-TGATTGGATAAAAAA------TATTATTCTATT- C_porcellus300717 ----C-TGGGAGAAT---GTTGGATAGAAAA------TGTTATTCTATT- C_porcellus300922 ATGGGCTGTGGGTGA-CAACTGGATAAAAAG---------TACTCCAAG- D_rerio300284 --TGGCTGAGTGGTGATCAACATGAAGGGGTTA--TACTTTGACCTCCTT D_novemcinctus300084 -GGGA-CAGGGTAAG-TGTTTGGATAGAAAA-----GTACTGTTCTATT- D_novemcinctus300222 ACAGGATAGGATAAGTGG-TTGGATAGAAAA-----GTACTGTTCTATT- D_novemcinctus300323 -GGGC-TAGAGTCAG-TGTTTGGATAGAAAA-----TTACTGTTCTATT- D_novemcinctus300347 -GGGC-TAGGATAAT-TGGTTGGATAGAAAA-----GTACTGTTCTATT- D_novemcinctus300369 -GGGC-TAGAATAGG-TGATTGGATAGAAAA-----GTACTGTTATATT- D_novemcinctus300514 -GGGC-TAGGGTAAG-TGTTTGGATAGAAAA-----GTACTGTTCTATT- D_melanogaster300219 GTGGCCAAAGTAAGAGCTGCGCGAGGCAAAACG--AGCCATTTCCGAATG E_telfairi300196 ACAGGCTTTGGAAAA-TAACTTGGTAGAAA------ATATTATTCTATT- E_telfairi300291 ACAGGCTTGGGAAAA-TGACTGGGTAGAAA------ATATTATTCTATT- E_telfairi300349 ACAGGCTCGGAAAAA-TGCCTGGGTAGAAA------ATATTATTCTATT- E_telfairi300359 ACAGGCTTGGGAAAA-TGACTGGGTAGAAA------ATATTATTCTATT- E_telfairi300407 ACAGGCTTGGGTAAA-TGACTGGGTAGAAA------ATATTATTCTATT- E_telfairi300501 ACAGGCTTGCGTAAAATGACTGGGTAGAAA------ATAGTATTCTAAT- E_telfairi300609 ACAGGCTTGGGAAAA-TGATGGGGTAGAAA------ATATTATTCTATT- E_telfairi300835 -GGGCCTAGGGTAAA-TAAGTGGATAGAAAG------CATTCCTCTCTA- E_caballus300000 T----------------GCTGGGGTAGAC-G----------ACAGCATA- E_caballus300275 ATGGGCTAGGGGGCA-TGATTGGATAGAAAG------CATTGCTCTATT- E_caballus300378 -AGGC-TAGGAAAAC-TGATTGGATAGAAAA------TATTACTCTATT- E_europaeus300004 TGGGA-TAGAGGTAA-TGATTGGATAGAAAG------CGTTAATCTGTT- E_europaeus300047 ACAAACGAGGGGAGA-TAATTGGATAGAAAG------TATTACGCTTTT- E_europaeus300347 ACAGGCTAAGGAGGA-TGACTGGGTAGAAAA------CGCTAGTTTACC- E_europaeus300448 TTAGACTAAGGGGGG-TGATTGGGTAGAA-G------TACTACTCTATT- E_europaeus300596 AGTGGCTAGTGAGGA-TGATTGGATAGAAAA------CATTATTCTATT- E_europaeus300625 AGAGGCTAGTGAAGA-TGACTGGATAGAAAA------CATTATTCTATT- E_europaeus300659 ACAGTCTAGGGAGGA-TAACTGGGTAGAAAA------CGCTACTCTACT- E_europaeus300720 ACAGACTAGGGGAGA-TGATTGGAT--ACAG------TATTTCTCTATT- H_sapiens300499 --GGGCTAGGGGAGA-TGATTGGGTAGAAAG------CATTATTTTATT- H_sapiens300552 ACAGGCTAGGGTAGG-TGATTGCACAGAGA------ATACTATTCTATT- H_sapiens300646 --GGGCTAAGGGAGA-TGATTGGGTAGAAAG------TATTATTCTATT- H_sapiens300767 -TGGC-TAGGGAAAA-TGATTGGATAGAAAC------TATTATTCTATT- M_mulatta300121 ATGGGCTACAGGAGA-TGATTAGTTAGAAAC------CATTATTCTGGGT M_mulatta300345 -TGGT-TAGGCAAAA-TGCCTAGATAGAAAG------CATTACTCTTTT- M_mulatta300637 --GGGCTAGGGGAGA-TGATTGGGTAGAAAG------CATTATTTTATT- M_mulatta300699 --GGACTAAGGGAGA-TGATTGGGTAGGAAG------TATTATTCTATT- M_mulatta300725 ACAGGCTAGGGTAGG-TGATTGCACAGAGA------ATATTATTCTATT- M_murinus300221 --GGGCTAGGGGAGA-TGACTGGATAGAATG------CTTTATCT-ATT- M_murinus300281 ATGGGCTAGGGGAGATGA-CTGGATAGAAA------GCACTATTCTATT- M_murinus300397 ATGGGCTAGGGGAGA-TGACTGGATAGAAAG------CATTATTCTGGCC M_murinus300498 --GGGCTAGGGGAGA-TGACTGGATAGAAAT------CATTATCC----- M_murinus300577 --GGGCTAGGGGAGA-TGACTGGATAGAAAG------GACTATTCTATT- M_domestica300191 -CGGC-CGGGGAAAA-TGA--GGATAGAAAA------AGAC-TTCTATC- O_anatinus303565 -TGGC-TAGAGGAAA-TGAAAGGGTGGAGAG------TGTTGCTCTACC- O_anatinus304502 -TGGC-TAGAGGAAA-TGAAAGGGTGGAGAG------TGTTGCTCTACC- O_cuniculus300445 -GGGT-TTGGAGATA-GAACTGGATAGAAAG------TATCACTATTCG- O_garnettii300067 ATGGGATAGTGAAAATGA-CTGGGTAGAAG------GCATTATTCTATT- O_garnettii300671 --GGGATAGGGGAAA-TGACTGGATAGAAAG------CCTTATTCTATT- P_troglodytes300220 G--GGCTACGGGAGA-TGATTGGTTCAAAAG------CATTATTCTATT- P_troglodytes300383 -TGGC-TAGGCAAAA-TGCCTACATAGAAAG------CATTACTCTTTT- P_troglodytes300506 --GGGCTAAGGGAGA-TGATTGGGTAGAAAG------TATTATTCTATT- P_troglodytes300598 --GGGCTAGGGGAGA-TGATTGGGTAGAAAG------CATTATTTTATT- P_troglodytes300712 ACAGGCTAGGGTAGG-TGATTGCACAGAGA------ATACTATTCTATT- P_pygmaeus300526 -TGGC-TAGGCAAAA-TGCCTAAACAGAAAGTTTAGGCATTACTCTTTT- P_pygmaeus300619 --GGGCTAAGGGAGA-TGATTGGGTAGAAAG------TATTATTCTATT- P_pygmaeus300675 --GGGCTAGGGGAGA-TGACTGGGTAGAAAG------CATTATTTTATT- P_pygmaeus300761 ACAGGCTAGGGTAGG-TGATTGCACAGAGA------ATATTATTCTATT- R_norvegicus300078 ATTGGCTGAGGGAAA-TTACTGAATAGAGAA------TATTACTCTATT- R_norvegicus300149 ATTGGCTGAGGGAAA-TTACTGAATAGAGAA------TATTACTCTATT- R_norvegicus300556 ATTGGCTGAGGGAAA-TTACTGAATAGAGAA------TATCACTCTATT- R_norvegicus300582 ATTGGCGGAGGGAAG---ACTAAATGGAGAG------T--TACTCTATT- R_norvegicus300839 ACTGGCTAGTGGAAA-TGACTGAATAGAGAG------GAATTCTCTGTT- R_norvegicus300926 ATTGGCTGAGGGAAATAAACTGAATAGAGA------ATATTACTCTATT- R_norvegicus300929 ATTGGCTGAGGGAAA-TTACTGAATAGAGAA------TATTACTCTATT- R_norvegicus301007 AGTGACTAAGAGAAA-TGATTGAATAGAGAA------TATTGCTCTATT- R_norvegicus301031 ATTGGCTGAGGGAAA-TTACTGAATAGAGAA------TATTACTCTATT- R_norvegicus301064 AGTGACTGAGAGAAA-TGATTGAATAGAGAG------TATTACTCTATT- R_norvegicus301065 ATTGGCTGAGAGAAA-TGATTGAATAGAGAG------TATTACTCTATT- R_norvegicus301092 ATTGGCTGAGGGAAA-TAACTGAATAGAGAA------TATTACTCTATT- S_cerevisiae300009 ACGGGCTAAAACAATTAGACTTCTTTGAGTACGAGGATATCGCTATTTT- S_araneus300024 ATGGGCTGGGAGAGA-TCATTGAGCAGAAG------ATATTTCTCTGTT- S_araneus300072 ATGAGTTGAGGAGAT--GATTGGGTAGTAG------GTATTTCTCTATT- S_araneus300119 A--AGCTGGAGGAGA-TGATTGTGTAGAAG------GTATTCCTCTATT- S_araneus300513 AGAAGCTAGGGAAGA-TGATTCGGCAGAAG------GTATTTGTCTATT- S_araneus300652 AAGATCTGGGAGAAA-TGATTGGGTAGATG------GTATATCTCTATT- S_araneus300698 GATGTCTAGAAGAGA-TGACTGGGTAGAAG------GTATATCTCTATT- S_araneus300703 AGGGGCTGGGAGAGA-TGACTGGATAGTAG------TTATTTCTCTATG- S_araneus300893 ATCAGCTGGGGAAGT-TGATTGGGTAGAAG------GTATTTCTCTATG- S_araneus301016 ACGGGCTGGGGGAGA-TGATTGGGTAGAAG------GTATTTCTCTATT- S_araneus301017 ACGGGCTGGGGGAGA-TGATTGGGTAGAAG------GTATTTCTCTATAA S_araneus301077 AAGGTCTGGGAGAGA-TGATTGGATAGAAG------GTATGTCTCTATT- S_tridecemlineatus300329 ATTGACTAGGGGAGA-TGATCAGATAGAAAA------TATTAATCTATTT T_nigroviridis300157 --CTGCAGTG-GAGGCCCATTGTTGCAAGA-------------------- T_belangeri300197 ATGGACTAGGGGAGA-TGATTGAATAGAAAA------TATTACTCTATTC T_belangeri300263 --GGGCT-GGGGAGA-TGACTGAATAGAAAG------TATTACTCTAT-- T_belangeri300419 --GGGCTAGGGGAGG-TGACTGGATAGAAAG------TATTATTCTGTT- C_elegans300052 CCGAAAATGATGCTCTT-CCCACAATT---------------- C_familiaris300203 CA---TTTATCTCCCAG-CCTACAAAA---------------- C_familiaris300310 CATTTCCTACCTCTCAG-CCTACAGAA---------------- C_familiaris300355 CA---TTTATCTCCCAG-CCTACAAAA---------------- C_porcellus300717 CA---TTTATC-CCTAG-CTAG--------------------- C_porcellus300922 -----TTCATCTCTGAG-CATACGGAA---------------- D_rerio300284 TA---TTAAACCCTTCAGCCGACATGA---------------- D_novemcinctus300084 CA---TTTATGTCCTGG-CATGCACAA---------------- D_novemcinctus300222 CA---CTT-ATGTCCCA-GTC-TACAAAA-------------- D_novemcinctus300323 CA---TTTATGTCCTGG-CCTACAAAT---------------- D_novemcinctus300347 CA---CTCATATCCCAG-CCTACAAAA---------------- D_novemcinctus300369 CA---CTTATGTCCCAG-CCTATAAAA---------------- D_novemcinctus300514 CA---TTTATGTCCTGG-CCTACAAAA---------------- D_melanogaster300219 GATTTGGTTCAGCCAAGTGCAGCGACAGCT------------- E_telfairi300196 CA---CTTTGTTCCCAG-CCTGCATTT---------------- E_telfairi300291 CA---CTTTGTTCCCAG-CCTACATTT---------------- E_telfairi300349 CC---CTTTGTTCCCAG-CCTACATTA---------------- E_telfairi300359 CA---CTTTGTTCCCAG-CCTACATTT---------------- E_telfairi300407 CA---CTTTGTTCCCTG-CCTACATTT---------------- E_telfairi300501 CA---CTTTGTTCCCAG-CCTACATTT---------------- E_telfairi300609 CA---CTTTGTTCCCAG-CCTACACTT---------------- E_telfairi300835 TTCATC-TCTACCCCAG-CCTACAGCA---------------- E_caballus300000 CA---TTTACCTCCCAG-CCTACAAAA---------------- E_caballus300275 CA---TTTACTTCCCAG-CCTACAAAA---------------- E_caballus300378 CA---TTTATCTCCTAG-CCTACAAAG---------------- E_europaeus300004 CA---TTTACTTCCCAG-CCTCCAAAA---------------- E_europaeus300047 -------TATCTCCCAA---TATAT------------------ E_europaeus300347 CA---AGTACTTCTCCA-TCTACAACA---------------- E_europaeus300448 AA---ATTACTTCCCAA-GCTACAAAA---------------- E_europaeus300596 CA---TTTACTTCTCAG-CCTACAGTA---------------- E_europaeus300625 CA---TTTACTTCTCAT-CCTACAGTA---------------- E_europaeus300659 CA---TGTACTTCTCAG-CCTNNNNNN---------------- E_europaeus300720 CA---TTTACTTCTTGTCTTATTACA----------------- H_sapiens300499 CA---TTTGCCTCCCAG-CCTACAAAA---------------- H_sapiens300552 CA---TTTCCTTCCTAG-CCAAAAACA---------------- H_sapiens300646 CA---TTTGCCTCCCAG-CCTACAAAA---------------- H_sapiens300767 CA---TTTATC-CCCAG-CCTACAAAA---------------- M_mulatta300121 GGT----GGGCGCCTGTAGTCCCAGCTA--------------- M_mulatta300345 TA---TTCATC-CCCAG-CCTACAAAA---------------- M_mulatta300637 CA---TTTGCCTCCCAG-CCTACAAAA---------------- M_mulatta300699 CA---TTTGCCTCCCAG-CCTACAAAA---------------- M_mulatta300725 CA---TTTCCTTCCTAG-CCAAAAAAA---------------- M_murinus300221 CA---TTTATCTCTTAGTCCTACAAAA---------------- M_murinus300281 CA---TTT-ACCTCTTA-GTCCTACAAAA-------------- M_murinus300397 GG-------GCACAGTGGCTCACACCT---------------- M_murinus300498 -A---TTTACCTCTTAGTCCTACAAAA---------------- M_murinus300577 CA---TTTACGTCTTAGTCCTACAAAA---------------- M_domestica300191 C-TTTT-TGTCACCCGG-CCTACAGTC---------------- O_anatinus303565 CGTTTT-TACCACCTAG-CGTACAGCC---------------- O_anatinus304502 CGTTTT-TACCACCTAG-CGTACAACC---------------- O_cuniculus300445 ----TT-TATCTCCCAG-CCTACAGCA---------------- O_garnettii300067 CA---TTTTATCTTCTA-GCCTTACAAA--------------- O_garnettii300671 CA---TTTATCTCCTAACCCCACAAAA---------------- P_troglodytes300220 CA---TTTGCCTCTCTTTTTTTTTTT----------------- P_troglodytes300383 TA---TTCATC-CCCAG-CCTACAAAA---------------- P_troglodytes300506 CA---TTTGCCTCCCGG-CCTACAAAA---------------- P_troglodytes300598 CA---TTTGCCTCCCAG-CCTACAAAA---------------- P_troglodytes300712 CA---TTTCCTTCCTAG-CCAAAAACA---------------- P_pygmaeus300526 TA---TTCATC-CCCAG-CCTACAAAA---------------- P_pygmaeus300619 CA---TTTGCCTCCCAG-CCTACAAAA---------------- P_pygmaeus300675 CA---TTTGCCTCCCAG-CCTACAAAA---------------- P_pygmaeus300761 CA---TTTCCTTCCTAG-CCAAAAACA---------------- R_norvegicus300078 CA---TATACTTC-TAG-CCTACACAA---------------- R_norvegicus300149 CG---TATACTTC-TAG-CCTACATAA---------------- R_norvegicus300556 CA---TATACTTC-TAG-CCTACACAA---------------- R_norvegicus300582 TA---TATACTTC-TAG-CTCACATGC---------------- R_norvegicus300839 CA---TATTCTTCCTAG-TCCACACCA---------------- R_norvegicus300926 CA---TAT-ACTTCTAG-GCTACATAA---------------- R_norvegicus300929 CA---TATACTTC-TAG-CCTAAACAC---------------- R_norvegicus301007 CA---TAGACTTCTTAG-CCTACACAC---------------- R_norvegicus301031 CA---TATACTTC-TAG-CCTACACAA---------------- R_norvegicus301064 CA---TAGACTTCCTAG-CCTATACCA---------------- R_norvegicus301065 CA---TAGACTTC-TAG-CCTACACAA---------------- R_norvegicus301092 CA---TATACTTC-TAG-CCTACACAA---------------- S_cerevisiae300009 TAT--CTCACGGTATCGTATTGTAATTAGAACGTCTCATATCA S_araneus300024 CA---TTTCCCTCCTGG-CCTGTAAAA---------------- S_araneus300072 CA---TTTCTCTCTTAG-CCTACAAAA---------------- S_araneus300119 TA---TATACCTCCTAG-CCTACAAAA---------------- S_araneus300513 CA---TTTCCCTCCCAG-TCTATAAAT---------------- S_araneus300652 CA---TTTTCCTTCCTG-CCTGCAAAA---------------- S_araneus300698 CA---TTTCCTTCCCAG-CCTGCAAGA---------------- S_araneus300703 TA---TTTCCCACCTAG-CCTACAAAA---------------- S_araneus300893 CA---TTTCCCTCTTAG-CCTACACAA---------------- S_araneus301016 CA---TTTCTCTCCCGG-CCTACAAAA---------------- S_araneus301017 CA---TTTCTCTCCCGG-CCTACAAAA---------------- S_araneus301077 CA---TTTCCCTCCCAA-CCTACAAAA---------------- S_tridecemlineatus300329 TA---TTTACTTTCTGG-TCTACAAAA---------------- T_nigroviridis300157 ------------------------------------------- T_belangeri300197 TGG----GACCAGCAGATGGCGTAC------------------ T_belangeri300263 CA---TTTACTTTCCAA-CCTACAAAA---------------- T_belangeri300419 CA---TTTACCTCCCAG-CCTACAAAA----------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved