snOPY snoRNA Orthological Gene Database

Family: SNORA35

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300036 CAGCACTGGC-AA-GTGACCCATTGGGCTTCTCCTTGACCAACT-GGGCA C_porcellus300195 CAGCACTGGC-AA-GTGACCCATTGGGCTCCCTCTTGACCAATT-GGGCA D_rerio300261 ATGCACTGTGTGTAATATGTGGGTTGCCACC-TAATGGCATTCT-GCTCT E_telfairi300079 TAGCACTGGC-AA-GTGACCCATTGGGCTCCCCTTTGACCAATT-GGGCA E_caballus300013 CAGCACTGGC-AA-GTGACCCGTTGGGCTCCTCCTTGACCAACT-GGGCA E_europaeus300444 CAGCACTGGC-AA-GTGACCCATTGGGCTTCTCCTTGACCAACTTGGGCA H_sapiens300642 CAGCACTGCC-AA-GTGACCCATTGGGCTCCATCTTGACCAACT-GGGCA L_africana300225 CAGCACTGGC-AAAGTGGCCCATTGGGCTCCCTCTTGACCAAT--GGGCA M_mulatta300696 CAGCACTGCC-AA-GTGACCCATTGGGCTCCACCTTGACCAACT-GGGCA M_murinus300302 CAGCACTGGC-AA-GTGACCCATTGGGCTCCCCTTTGACCAATT-GGGCA M_musculus300835 CAGCACTGGC-AA-GTGACCCATTGGACTTTTTCTTGACCAACT-GGGCA O_anatinus302282 TTGCATTGTG-AA-GTGACCCACCGGTCTTCTGC-TAGCCGGCT-GGAGT O_garnettii300091 CAGCACTGGC-AA-GTGACCCATTGGGCTTCCCCTTGACCAATT-GGGCA P_pygmaeus300566 CAGCACTGCC-GA-GTGACCCATTGGGCTCCACCTTGACCAACT-GGGCA R_norvegicus300112 TAGCACTGGC-AA-GTGACCTGTTGGACTTTCTCTTGACCAACT-GGGCA S_tridecemlineatus300122 CAGCACTGGC-AA-GTGACCCATTGGGCTTCCACCTGACCAACT-GGGCA T_nigroviridis300119 GTGCACTGTC--AAGTGACTGGATTTCCTTTATCGTGGTCTTCC-AATCT T_belangeri300234 AAGCACTGGC-AA-GTGACCCATTGGGCTCCCTCTTGACCAACT-GGGCA *** ** * * * C_familiaris300036 TCGAGCAGTGCAAAAGCAAATCCCTCCACAAAGCTGGGAGAGTCATTCTG C_porcellus300195 TCGAGCAGTGCAAAAGCAAATCCCTCCATAA-GCTGGGAGAGTCACACTG D_rerio300261 TAAATCAGTGCAAGAGAAACCTCAGTTTGCAGAAGGGCCAAATCAAACTA E_telfairi300079 TCGAGCAGTGCAAAAACAAATCCCACCGTAAAGCTGGGAGAGCCACACTG E_caballus300013 TCGAGCAGTGCAAAAGCAAATCCCTCCACAAAGCTGGGAGAGTCATGCTG E_europaeus300444 TCGAGCAGTGCAAAAGTGAATCCCTCCCCAAATCTGGGAAAGTCATGCTG H_sapiens300642 TCAAGCGGTGCAAAAGCAAATCCCTCTC-AAAGCTGGGAGAGTCACACCG L_africana300225 TCGAGCAGTGCAAAAGCAAATCCCACCATAAAGCCGGGAGAGCCACACTG M_mulatta300696 TCGAGCGGTGCAAAAGCAAATCCCTCTC-AAAGCTGGGAGAGTCACACCG M_murinus300302 TCGAGCAGTGCAAAAGCAAATCCCTCTG-GAAGCTGGGAGAGTCAT-CTG M_musculus300835 TCGAGCAGTGCGAAAACAAAACCCTCCG-AAAGATGGGAGAGTCACACTG O_anatinus302282 TC---CAATGCAGTAGGAGTTCCCTCCTTGCAGAAAGGCCAGAGCTGCAG O_garnettii300091 TCGAGCAGTGCAAAAGTAAATCCCTCTG-AAAGCTGGGAGAGTCACACTG P_pygmaeus300566 TCAAGCGGTGCAAAAGCAAATCCCTCTC-AAAGCTGGGAGAGTCACACCG R_norvegicus300112 TCGAGCAGTGCGAAAACAAAACCCTCCG-AAAGCTGGGAGAGTCACACTG S_tridecemlineatus300122 TCGAGCAGTGCAAAAGCAAATCCCTCCA-AAAGCTGGGAGAGTCACACCG T_nigroviridis300119 CATTCCAGTGCCAGAGCAACCTCAGTTTGCAGAAGGGTTGAGCTAAACGA T_belangeri300234 TCGAGCAGTGCAAAAGCAAATCCCTCCA-AAAGCTGGGAGAGTCACACTG * *** * * * * * C_familiaris300036 TGGGCTA-CTCCTGCATGCTGGGGGGTACATAT C_porcellus300195 TAGGCTG-CTCCTGCATGCAGGTGGGTACATTC D_rerio300261 TTGGTTATTCCCTTTCGAAGGCTGAGAACAGAC E_telfairi300079 TGGGCTT-CTCTTGCATGTAAGTGGGTACATGT E_caballus300013 TGGGCTA-CTCCTGCATGCAGGTGGGTACATAT E_europaeus300444 TGGACTA-TTCCTGCATGCAGGAGGGTACATAA H_sapiens300642 TGGGCTA-CTCCTGCATGCAGCTGGGTACATAT L_africana300225 TGGGCTAACTCCTGCATGCAGGTGGGTACATGT M_mulatta300696 TGGGCTA-CTCCTGCATGCAGCTGGGTACATAT M_murinus300302 TGGACTA-CTTCTGCATACAGATGGGTACATCT M_musculus300835 TGGGCTA-CTCCCGCATGCAGGTGGGTACATAG O_anatinus302282 TGGACTGCC------------------------ O_garnettii300091 TGGACTA-CTTCTGCATGCAGATGGGTACATAT P_pygmaeus300566 TGGGCTA-CTCCTGCATGCAGCTGGGTACATAT R_norvegicus300112 TGGACTA-CTCCCGCATGCAGGTGGGTACATAA S_tridecemlineatus300122 TGGGCTA-CTCCTGCATGCGGGTGGGTACATAT T_nigroviridis300119 TTGGCCCCCCCCTTTCGAAGGCTGAGAACAAAA T_belangeri300234 TGGGCTA-CTCCTGCATGCAGGTGGGTACATGT * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved