snOPY snoRNA Orthological Gene Database

Family: SNORA32

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300161 ----------TGGTCATT-ACCAAGGCT-TTGA-GAA---TGCA--GTTT C_familiaris300469 ----------TGGTCATT-ACCAAGGCT-TTGA-GAA---TGCA--GTTT C_porcellus300087 ----------TGGTCACT-ACCCAGGC--TTTTAGAA---TGAA--GCTT C_porcellus300142 ----------TGGTCATT-ACCAAGGC--TATTAGAA---TGAA--GTTT C_porcellus300147 -------------------------------------AGGCCTTCAGTCA C_porcellus300163 ----------TGGTTATG-ACCAAGGCT-TTTA-GGA---CGCA--GTTT C_porcellus300168 ----------TGGTCATT-ATCAAGGC--TTTTAGAA---AGAA--GGTT D_rerio300214 ----------TGGTCATTTACCAAGGC--ATTTGGGA---TGCATTGTTC D_novemcinctus300000 ----------TGGTCATT-ACCAAAGCT-TTTA-GAA---TGCA--GTTT D_novemcinctus300037 ----------TAGTCATT-ACCAAGGCT-TTTA-GGA---TGCA--ATTT D_novemcinctus300146 ----------TGGTTCTT-ACAAAGGCT-TT-A-GAA---TGCA--GTTT D_novemcinctus300159 ----------TGGTCATT-ATAAAGGTT-TTTA-GAA---TACA--CTGT D_novemcinctus300248 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT D_novemcinctus300314 ----------TGGTCATT-ACTAAGGCT-TTTA-GAA---TGCA--GTTT D_novemcinctus300317 ------------ATAATACTGCTCTGTT-CATTAGAA---TGTT--GTTT D_novemcinctus300393 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT D_novemcinctus300429 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT D_novemcinctus300561 -------------------------AAGTTTGGGTATAGGCCATTAGTGC E_telfairi300030 ----------TGGTCGTT-ACCAAGGCT-TTT-AGAA---CGCA--GTTT E_telfairi300042 ----------TGGTCATT-ACAAAGGCT-TTTTACAA---TGCA--GTTT E_telfairi300136 ----------TGGTCATT-ACCAAGGCT-TTT-AAAA---TGTG--GTTT E_telfairi300167 --------------------ATGAAAATTCAGAAACAT--TAAGAAATTT E_telfairi300238 ----------TGGTCATT-ACCAAGGCT-TTT-AGAA---TGTG--GTTT E_telfairi300269 ----------TGGTCGTC-ACCAAGGCT-TTT-AGAA---TGCA--GCTT E_telfairi300311 ----------TGGTCATC-ACCAAGGCT-TTT-AGAA---GGCA--GTGT E_telfairi300458 ------------------CAGTCACTGTAGGAGGACATCGTGTGTGGGAT E_telfairi300537 ----------TAGTCACT-ATCTAGGCT-TTT-AGAA---TCCA--GTTT E_telfairi300543 ----------TGGTCATT-ACCAAGGCT-TTT-AGAA---TGCA--GTTT E_telfairi300546 ----------TGGTCATT-AACAAGGCT-ATT-AGAA---CACA--GTTT E_telfairi300598 ----------TGGTCTTG-ACCAAGGCT-TTTA-GAA---TGTA--GTTT E_telfairi300723 ----------TGAACATT-AGCAGGGCT-TTTAAGAA---TATA--GTTT E_telfairi300776 ----------TGGTCATT-ACCATGGCT-TCT-AGAA---TGTG--GGTT E_caballus300059 ----------------------------------------CTGTTGGTAT E_caballus300151 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT E_europaeus300076 GAGACATTAACAAAAATATATTTCTTC---TTTAGAA---TGTG--GTTT E_europaeus300114 ----------AGGTCATTACCAAGGCT---TTTAGAA---TGCG--GTTT E_europaeus300125 ----------AGGAAATGTACTT--------TTAGAA---TATG--GTTT E_europaeus300130 ----------AGGTCATTACCAAAGCT---TTTAGAA---TGTG--GTTT E_europaeus300176 ----------AAGTCATTACCAAGGCT---TTTAGAA---TGTG--GTTT E_europaeus300496 ----------AGGTCATTACCAAGGCT---TTTAGAA---TGTG--GTTT E_europaeus300509 ----------AGGTCATTACCAAGGCT---TTTAGAA---TGTG--GTTT F_catus300087 ----------TGGTCATT-ACCAAGGCT-TTGA-GAA---TGTA--GTTT G_gallus300010 ----------TGGTCATT-ACCAAGGC--TGCAAGGATATTGCT--GTTC G_gorilla300947 ----------TGGTAATT-ACCAAGAT--TTTTAGAA---TGCA--GTTT G_gorilla301062 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT G_gorilla300363 ----------TGGTTGTT-ACCAAGGCA-TTTA-GCA---TGCA--ATTT H_sapiens300747 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT L_africana300490 ----------TGGTCATT-ACCAAGGCT-TTTA-AAA---TGCC--ATTT L_africana300395 ----------AGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT M_mulatta300043 ----------TGGTAATT-ACCAAGAT--TTTTAGAA---TGCA--GTTT M_mulatta300197 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--TTTT M_mulatta300407 ----------TGGTTGTT-ACCAAGGCA-TTTA-GCA---TGCA--ATTT M_mulatta300461 ----------GAAAAACA-ACAAAGTCT-TTTA-GAA---TGCA--GTTT M_mulatta300660 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT M_murinus300191 ----------TGGTCATC-ACCAAGGCT-TTTA-GAA---TGCA--GTTT M_murinus300272 -----------------CAGCCTCCAAGGCTTTTAGAATGC----AGTTT M_murinus300354 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT M_murinus300011 ----------TCGTCATT-AGCAAGGCC-TTTA-GCA---TGCC--GTTT M_domestica300011 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300291 -------------------------------TATTTATT-TATTTGTAGA M_musculus300319 ----------TGGTCATC-ACCAAGGA--TTTTAGAA---TGCA--GTTT M_musculus300397 -------------------TATATTTTTTT-AAGATT-----AAAAAGAA M_musculus300565 ----------AGGTCATC-CCTAAGG---TTTA-GGA----ACT--CTTT M_musculus300576 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300602 --------TAGTGATTACTAATGTCTGCATGAAGGTTTCTCAAAAGACAG M_musculus300737 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300758 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTCT M_musculus300803 ----------TGGTCATT-ACCAAGGC--TTTTAGAG---TGCA--GTTT M_musculus300902 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300921 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300945 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300965 -----------------------------TCTTGACTTC---CGGATAAA M_musculus300034 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_musculus300100 ----------TGGTCATT-ACCAAGGC--TTCTAGAA---TGCA--GTTT M_musculus300112 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_lucifugus300218 ----------TTGTCATT-ACCAAGGC--TTTTCGAA---TGCA--GTTT M_lucifugus300332 ----------TGGTAATT-ACCAAGGCT-TTCA-GAA---GGCA--CTTT M_lucifugus300428 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTCT M_lucifugus300570 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_lucifugus300805 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_lucifugus300851 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_lucifugus300038 ----------TGGTCATT-ACTAAGGC--TTTTAGAA---TGCA--ATTT M_lucifugus300047 ----------GGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT M_lucifugus300050 --------------AGGC-CCTAAAG---TTTTAGAA---TGCA--GTTT O_anatinus304397 ----------TGGTCATT-ACCAAGGC---TATTAGA---AGCACAGTTT O_cuniculus300031 ----------AGGTCATT-ATCAAGGTT-TTTA-GAA---TGCA--ATTT O_cuniculus300395 ----------AGGTCATT-ACCAAGGCT-TATA-GAA---TGCA--GTTT O_cuniculus300514 ----------TGGTTTTT-ACCAAGGCT-TTTA-GAA---TGTA--ATTT O_garnettii300010 ----------TGGCCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300046 -----------------ACATTATTGCCATAAGGCAAATAAATTA---CA O_garnettii300069 ----------TGGCCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300199 ----------TGGTCACT-ACCAAGGCT-TTCA-GAA---TGCA--GTTT O_garnettii300206 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300285 ----------TGGCCATT-ACCAAGGT--TTTTAGAA---TGCA---GTT O_garnettii300305 ----------TGGTCATT-ACCAATGCT-TTGA-GAA---TGCA--GTTT O_garnettii300333 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300400 -----------------GGGTTTTTGCTATAAA--AAGTAAGTA------ O_garnettii300402 ----------TGGCCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300407 --------------------------CTGT-TATATACAGCCCC------ O_garnettii300412 ----------TGGTCATT-ATCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300437 ----------TGGTCATT-ACAAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300456 ----------TGGTCATG-ACCAAGGCT-TTTA-GAA---AGCA--ATTT O_garnettii300510 ---------------TGGCCAAGACTCAGTGGACTTGGAAAATAA----A O_garnettii300555 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT O_garnettii300645 -------------------------TGGGTGGATTTAGAAAACA------ O_garnettii300698 ------------------ATGTAAACCTGTGTGTTTAAAGATAG------ P_troglodytes300670 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT P_troglodytes300130 ----------TGGTAATT-ACCAAGAT--TTTTAGAA---TGCA--GTTT P_troglodytes300203 -----------AGGTGCCAGCCAAGGCAACTCTTAGAAGATGGATAGCTT P_troglodytes300363 ----------TGGTTGTT-ACCAAGGCA-TTTA-GCA---TGCA--ATTT P_pygmaeus300055 ----------TGGTAATT-ACCAAGAT--TTTTAGAA---TGCA--GTTT P_pygmaeus300252 ----------TGGTTGTT-ACCAAGGCA-TTTA-GCA---TGCA--ATTT P_pygmaeus300295 ----------TGGTCATT-ACCAAGGCT-TTTA-GAA---TGCA--GTTT R_norvegicus300104 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TCCA--GTTT R_norvegicus300114 ----------------------------ATACTGTGTCTAAGATTTTTAA R_norvegicus300211 -----------------------AGGTCCCATCGTAGAATAAGAAAGGTT R_norvegicus300284 ---------------------------------------ACATCTAGGAA R_norvegicus300310 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT R_norvegicus300488 --------------------------------------GGAAACTGGTAA R_norvegicus300511 ------------------TAGTCCAGTACTGACAGCAGGAAAATTCAAAT R_norvegicus300533 ----------TGGTCATT-ACCAAGTC--TTTTAGAA---TGCA--GTTT R_norvegicus300537 --------------------CTGCCCTTATAAAAGTTTTATATCTAAAAT R_norvegicus300544 --------------AAGA-ACAAATGC--TTTTAGAG---TGCA--GTTT R_norvegicus300583 ----------TGGTCAGT-ACCAAGGC--TTTTAGAA---TGCA--GTTT R_norvegicus300631 -----------------------TGCACATAAAATAAATTAATTTAAAAA R_norvegicus300650 -------------------------------TGCTTAATGTCTCTGCATA R_norvegicus300834 --------------------CTGCCCTTATAAAACTTTTATATCTAAAAT R_norvegicus300862 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT R_norvegicus300870 ------------------------------TGCTTCTGTAACGTTAGCCT R_norvegicus301102 ----------TGGTCATT-ACCAAGGC--TTTTAGAA---TGCA--GTTT R_norvegicus300557 ------------------------------------AGTAGAATT---AT S_araneus300044 ----------TGGTCATT-ACCAAGGCG-TTTTTAGA---AG-ACAGTTT S_araneus300663 ----------AGGTCATT-ATCAAAGT--TTTTAGAA---CACT--GTTT S_araneus301029 ----------CGATCCTT-GCCAAGGCT-CTT-AGAA---CCCG--GTTT S_araneus300722 ----------TGGTCATT-ACCAAGGCG-TTTTTAGA---AG-ACAGTTT S_tridecemlineatus300031 ----------GGGTCATT-ACCCAGGT--TTGTAGG---TTGCA--GTCT S_tridecemlineatus300111 ----------TGGTCATT-ACCAAGGCT-TTTT-GAA---TACA--GTTT T_belangeri300179 ----------TGGTCATT-ACCAAGGCT-TATG-GAA---TGCA--GTTC C_familiaris300161 -CTCATTTGCTGTGGGCATGACCATAAAAAAATTTT----------CTCA C_familiaris300469 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTT----------CCCG C_porcellus300087 -CTAATTTGCTGTGGACATGACCATAAAAAAATTCCC------------- C_porcellus300142 -CTCATTTGCTGTGGACATGGCCATAAAAAAATTTCC------------- C_porcellus300147 TTAGAAATGCTCAAGCACAAAGAAAAGGTAAGATTTC------------- C_porcellus300163 -CTAATTCACCAGTGACACAGCCTTAAAAATTCCAC-------------- C_porcellus300168 -CTCATCTTCTGTGGACTTGACCATAAAATAATTTTC------------- D_rerio300214 -CTGACTTGCTATGGACGTGACCAAAAATTAAAACCCA-----------T D_novemcinctus300000 -CGGATTTGCTGTGGAGTTGACCAT--AAAAAAAAAAAA-------AAAT D_novemcinctus300037 -CTGATTTGCTGCGGAGGTGACCGT--AAAAAAAA-------------TT D_novemcinctus300146 -CTGGTTTGCTGTAGAGTTGACCAT--AAAAAACCC------------CT D_novemcinctus300159 -CTGATTTGCTGAGGAATTGACAAT--AAAAAAGC-------------CT D_novemcinctus300248 TCTGCTTGGCTGTGGAGTTGACCATTAAAAAAAAACAAA-------ACCT D_novemcinctus300314 -CTGATTTGCTGTGGAGTTGACCAT--AAAAAAAA-----------AACT D_novemcinctus300317 -TTGATCTGCTATGGAGGTGACCATAAAAAAATACCC------------T D_novemcinctus300393 -CTGATTTGCTGTGGAGTTGACCAT--AAAAAAAA-------------CT D_novemcinctus300429 -CTGATTTGCTGTGGAGTTAAC---------------------------T D_novemcinctus300561 CTACTATTTAAGAACTC-TGACCATAAAAAAAACTCC------------- E_telfairi300030 -CTGATTTGCTGTGGGCAGGACCACAAACAA-TTTC----------CCAA E_telfairi300042 -CTGACTTGCTGTGGACATGACCATAAAAAA-TTTC----------CC-- E_telfairi300136 -CTAATTTTCTGTGGACATGACCATAGACAA-TTTC----------CCAG E_telfairi300167 GTG-ATTTGCTGTGGACATGACTATAGACA---ATTT------------- E_telfairi300238 -CTGATTTGCTGTGGACATGACCATAGACAA-TTTC----------CCAG E_telfairi300269 -CGGATCTGCTTTGGACAAGACCACAAAAAAATTTC----------CCAA E_telfairi300311 -GTGGGTTGCGGTGGGCAGGACCATAAAATA-TTTC----------CCTG E_telfairi300458 CTG-GTTTACTGTGGACATGGCCATCGACA---ATTT------------- E_telfairi300537 -CTGATTTGCTGGGGACATGGCCATAACACA-TTTC----------CCAG E_telfairi300543 -CTGATTTACTGTGGACATGATCATAAAACACTTAC----------CGTA E_telfairi300546 -CTGATTTGCTGTGGACATGACCACAAAAAA-TTTC----------CCAG E_telfairi300598 -CTGATTTGCTGTAGATTCCACATTAAAAAAATAA-------------AT E_telfairi300723 -CTGATTGGCTGTGGATTTGACCAAACAACAAAAA-------------CT E_telfairi300776 -CTGATTTCCTGTGGACATGACCATAATAAACACACG---------CATA E_caballus300059 GCTGGACCTAAAAACAAACAAACAAACAAAACTCTTC------------- E_caballus300151 -CTCATTTGCTGTGGACATGACCA-GAAAAAAAATT-------------- E_europaeus300076 -CTCATTTTCTGTGGACATGACCTTTAAAAAATACTC------------- E_europaeus300114 -CTCATTTGCTGTGGACATGACCTTAAA-AAATGCCC------------- E_europaeus300125 -CTCATTTTTTGTGGACATGACCTTAAAAACATGCCC------------- E_europaeus300130 -CTCATTTGCTGTGGACATGACCTTAAA-AAATAACC------------- E_europaeus300176 -CTTGTTTGCTGTGGATGTGACCTTAAAGAAACGCCC------------- E_europaeus300496 -CTCATTTGCTGTGGACATGACCTTAAAGAAATGCCC------------- E_europaeus300509 -CTCATTTGCTGTGGACATGACCTTAAA-AAATGCCC------------- F_catus300087 -CTCATTTGCTGTGGACATGACCATAAAAAA-TTTT----------TCCA G_gallus300010 -CTGGTGAGCTGTGGACATGACCATATAGCAAGT-CC------------- G_gorilla300947 -CTCATTTGCCATGGACATGACCATAAAATAATTTCC------------- G_gorilla301062 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- G_gorilla300363 -CTCATTTGCTGTGGACACGACGAGAAGAGAATTCC-------------- H_sapiens300747 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- L_africana300490 -CTGATTTACTGTGGACTTGACTATAAAAAAAAAA-------------A- L_africana300395 ---GATTTGCTGTGGACTTGACGGT--AATAAAAA-------------CC M_mulatta300043 -CTCATTTACCGTGGACATGACCATAAAATAATTTCC------------- M_mulatta300197 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- M_mulatta300407 -CTCATTTGCTGTGGACACATCGATAAGAGAATTCC-------------- M_mulatta300461 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- M_mulatta300660 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- M_murinus300191 -CTCATTTGCTGTGGACATGACCATAAAA--AAA-------------CTT M_murinus300272 -CTCATTTGCTGTGGACATGACCATAAAAACAAAACAAACAAAAAAAACT M_murinus300354 -CTCATTTGCTGTGGACATGACCATAAAA--AAA-------------CTT M_murinus300011 -CTCATTTGCTAGGGACATGACCATAAAA--AAA--------------CT M_domestica300011 -CTGA-TTGCTGTGGACATGACCATAAAAAAAATTATA------------ M_musculus300291 AATAAAAAT-TTCACATTTAACCATAAAGA-AAAATT------------- M_musculus300319 -CTCATTTGC-GTGGACGTGACCATAAAGAAAAATTC------------- M_musculus300397 AAGTGTTTGCTGTGGACATGACCATAAAGA-AAAGTT------------- M_musculus300565 -CTCAATTGTGGTGGACATCACCATGAAAAAAAATT-------------- M_musculus300576 -CTCACTTGCTGTGGACATGAACATAAAGAAAAATTC------------- M_musculus300602 AAATGTT-ACTGTGGACATGACCATAAAGAGAAAATT------------- M_musculus300737 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300758 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300803 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300902 -CTGATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300921 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300945 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_musculus300965 ATGTGACAACAATGGACGTTGCCATAAAGA-AAAGTT------------- M_musculus300034 -CTCAGTTGCTGGGGACATGACCATAAAGAAAAATTC------------- M_musculus300100 -CTCATTTGCTGTGGACATGACCATAGACAAATTCCC------------- M_musculus300112 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- M_lucifugus300218 -CTCATTTGCCATGGGCATGACCACAAAACATTTTCC------------- M_lucifugus300332 -CTCATTTGCTGTGGACAGAGCGT--------TTTC-------------- M_lucifugus300428 -CTCATTTGCTGTGCACATGACTAAAAAACATTTTCC------------- M_lucifugus300570 -CTCATTTGCTGTGGACATGACCACAAAACATTTCCC------------- M_lucifugus300805 -CTCATTTGCCGTGGACATGACCACGAAACATTTCCC------------- M_lucifugus300851 -CTCATTTGCCGTGGACATGACCACAAAACATTTCCC------------- M_lucifugus300038 -CTCATTTGCCGTGAACATGACTACAAAACATTTTCC------------- M_lucifugus300047 -CTCATTTGCCGTGGACATGACCACAAAACATTTCCC------------- M_lucifugus300050 -TTCATTTGCCGTGGACATGACCACAAAACATTTCCC------------- O_anatinus304397 -CTGATTTGCTGTGGACATGACCGT-----AGAATAA------------- O_cuniculus300031 -CTCATTTGCTGTGGACATGACCA-TAAAAAAATTT-------------- O_cuniculus300395 -CTCATTTGCTGTGGACATGACCA--TAAAGAAATT-------------- O_cuniculus300514 -CTCATTTGCTGTGGACATGACCACAAAAAAATTTCT------------- O_garnettii300010 -CTCAATTGCTAAGGACATGACCATAAAA--AAA-------------ATT O_garnettii300046 CTTTTTTTGCTGTGGACATAACCCCCCCAAACAATTT------------- O_garnettii300069 -CTCAATTGCTAAGGACATGACTATAAAA--AAA-------------CTT O_garnettii300199 -TTCAGTTGCTAAGAACATGACCATAAAA--AA--------------CTT O_garnettii300206 -CTCAATTGCTGTGGACATGACCATAAAA--AAA-------------CTT O_garnettii300285 -CTCAATGGCTAAGGACATAACCATAAAAAAAATTTC------------- O_garnettii300305 -CTCAATTGCTGTGGACATGACCACAAAACAAAAAT-----------ACT O_garnettii300333 -CTCAATTGCTGTGGACATGACCATAAAA--AAA-------------CTT O_garnettii300400 ---TGTATGCTGAGGACATGACCATAA-AAAGATTGT------------- O_garnettii300402 -CTCAATTGCTAAGGACATGACTATAAAA--AAA-------------CTT O_garnettii300407 --TTT-TGGACGTGACCAT----AAA--AAAAACTTC------------- O_garnettii300412 -CTCGATTGCTGTGGACATGACCATAAAA--AAA-A-----------CCT O_garnettii300437 -CTCAATTGCTGTGGACATGACCATAAAA--AAA-A-----------C-T O_garnettii300456 -CTCAATTGCTGTGTATATGACCCTAAAA--AAAGA-----------CTT O_garnettii300510 TTCTTATTGCTGTGGACATGACCATA--AAAAAACTT------------- O_garnettii300555 -CTCAATTGCTGTGGACATGACCATAAAA--AAA-A-----------C-T O_garnettii300645 --CTCTTCCTCGTGACAATAAAAAAA--AAAAGACTT------------- O_garnettii300698 --ATAGTGGACGTGACCAT----ACA--AAAAACTTC------------- P_troglodytes300670 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- P_troglodytes300130 -CTCATTTGCCATGGACATGACCACAAAATAATTTCC------------- P_troglodytes300203 -CTCTTTTGCTGTGGGTGTGACCACAAAAC-----------------ATT P_troglodytes300363 -CTCATTTGCTGTGGACACGACGAGAAGAGAATTCC-------------- P_pygmaeus300055 -CTTATTTGCCGTGGACATGACCATAAGATAATTTCC------------- P_pygmaeus300252 -CTCATCTGCTGTGGACACAACGAGAAGAGAATTCC-------------- P_pygmaeus300295 -CTCATTTGCTGTGGACATGACCATAAAAAAATTTC-------------- R_norvegicus300104 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300114 ATTCTTTTGCTGTGGATATGACCATAAAGA-AAAATT------------- R_norvegicus300211 TCTCATTTGCTGTGGACATGACCATAAAGA-AAAATT------------- R_norvegicus300284 ATCCAGGAC--ACAATGAGAAAATCAAACC-TAAGTT------------- R_norvegicus300310 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300488 AGG-AGGTA--ACATTTAAAATGTAAATAA-AAAATT------------- R_norvegicus300511 GTCAAAGATATCAGAATTAAGATAGAAAAG-TGAATT------------- R_norvegicus300533 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300537 ACTTATTAT--ATGGATATGACCATAAAGA-AAAATT------------- R_norvegicus300544 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300583 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300631 ATATGCTA--------CATGATCATAAAGA-AAAATT------------- R_norvegicus300650 GTGATAGATCTTTAAGTATAAGAATCATAA-CAAATT------------- R_norvegicus300834 ACTTATTAT--ATGGATATGACCATAAAGA-AAAATT------------- R_norvegicus300862 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300870 GTATCATTGTAGAAGCTTTGAAAGATACAG-AGTGTC------------- R_norvegicus301102 -CTCATTTGCTGTGGACATGACCATAAAGAAAAATTC------------- R_norvegicus300557 TTGGAATAGTTCAGTTTTTAAA-AGCGATG-ATCATT------------- S_araneus300044 -CTGAATTGATGTGGACATCACTTT-AAAGAAGATGC------------- S_araneus300663 -CTCAATTGCCATGGACATGACCTTAAAGAAAAATTC------------- S_araneus301029 -CTTAATTGCCGTGGACATGATCTTAGACAAAATGC----------CTCA S_araneus300722 -CTGAATTGATGTGGACATCACTTTCAAAGAAGATGC------------- S_tridecemlineatus300031 -CTCCTTTGCTGTGCATATGACCATACAAAATTT-CC------------- S_tridecemlineatus300111 -CTTATTTGCTGTGGACATGACCATAAAATAATTCC-------------- T_belangeri300179 -CTCATTTGCTGTGGACATGACCA--TAAAGAAATT-------------- C_familiaris300161 TTAGGTTTTCTTC-----TTTTTTTGCTA---GTTTGC--TAGCATT--- C_familiaris300469 TTAGGTTTTCTTC-----CTTTTT-GCTA---GTTTGC--TAGCATT--- C_porcellus300087 ---CACTAGGGTT-----TCTG--TC-TGCTACCTCGT--TAGCAA---- C_porcellus300142 ---CACTAGGTTT-----TATG--TC-TGCTATCTTGT--TAGCAA---- C_porcellus300147 --CTACTAAGTTT-----TCTGTCTGCTA---CCTTGT--TAGCAAT--- C_porcellus300163 --CCCCTAGGTTT-----TCTATT----A---CCTTTC--TAGCAAC--- C_porcellus300168 ---CACTAGGTTT-----TCTA--TC-TGTTACCTTGT--TAGCAA---- D_rerio300214 CCTAATGAGTCAC-----TTCA--GT-TTCAATGCTGT--TGGGGT---- D_novemcinctus300000 CCCCACTGGGCTT-----TCTTTTTGCTA---CCTTGC--TAGCAT---- D_novemcinctus300037 CCCCGCTAGGTTT-----TCTTTTTGCTA---CCTTGC--CAGCGTT--- D_novemcinctus300146 CCCTACTAAGCTT-----TCTTGTTGCTA---TCTTGC--TAGCATT--- D_novemcinctus300159 TCCCCCTAGGTTT-----TCTTTTTGCTA---CCTTGC--TAGCATT--- D_novemcinctus300248 TCCCACTAGGTTT-----TCTTTTTGCTA---CCTTGT--TAGCATT--- D_novemcinctus300314 CCCCACCGTGCTT-----TCTTTTTGCTA---CCTTGC--TAGCATT--- D_novemcinctus300317 TCCCACTAGGTTT-----TCTTTTTGCTG---CCTTGC--TAAAATT--- D_novemcinctus300393 CTCCACTGGGCTT-----TCTTTT-GCTA---CCTTGC--TAGCCTT--- D_novemcinctus300429 CCCCACTGGGCTT-----TCTTTTTGCTA---CCTTGC--TAGCATT--- D_novemcinctus300561 --CCACTGGGCTT-----TCTTT-TGCTA---CCTTGC--TAGCATT--- E_telfairi300030 TAAGTTT--GGTC-----TTTT--TGCCG---CCTTGC--TAGCATA--- E_telfairi300042 -AGGTTTTGGGTC-----CTCT--TGCTA---CCTTGC--TAGCATA--- E_telfairi300136 GAGTTTTGT-T-------CTTT---GCTA---CCTTGC--TAGCGTA--- E_telfairi300167 -CCCAGGAGGTTTTTG----TCTTTGCTA---CCTTGC--TAGCATA--- E_telfairi300238 GAGGTTTTTGT-------TTTT---GCTA---CCTTGC--TAGCATA--- E_telfairi300269 GAGGTTTTTGCTC-----TTTTCTTGCGA---CCTTGC--TAGCATC--- E_telfairi300311 GAGGTGTTTGTCC-----TTTT---GCTA---CCTTGC--AAGCATA--- E_telfairi300458 -CCCAGGAGGTTTTTG----TCTTTGCTA---CCTTGC--TAGCATA--- E_telfairi300537 TAGGTTTTTGTGG-----TTTT---GCTA---CCTTGC--TAACATT--- E_telfairi300543 AAAAGTTTTTGTC-----TTTT--TGCTA---TCTTGC--AAACATA--- E_telfairi300546 GAGGTTTTTGTCT-----GTTT-TTGCTA---CCTGGA--TAGCATA--- E_telfairi300598 TCCACTATGTTTT-----TGTCTTCATTT---CCCTGCTATAGCATG--- E_telfairi300723 TCCCACTAGGTTT-----TATCTTTGCTA---CCTTGC--TAGCATT--- E_telfairi300776 CCGGTCAATGTGT-----ATGC---GTGT---GTTTGC--TAGCATT--- E_caballus300059 --CCACTGGGTTT-----TTTTTCTGCTA---CCTTGC--TAGCGTT--- E_caballus300151 TCCCACTGGGCTT-----TTTCTC--CTGCTACCTTGC--TAGCATTG-- E_europaeus300076 ----ACTAGGTTT-----GTTTTCTGCTA---TACTGG--TAGCATC--- E_europaeus300114 ----ACTAGGTTT-----GTTCTCTGCTA---CATTGG--TAGCATT--- E_europaeus300125 ----ACTAGGTTT-----ATTCTGGGCTA---CATTGG--TACCATT--- E_europaeus300130 ----ACTAGGTTT-----GTTCTCTGCTA---CATTGG--TAGCATT--- E_europaeus300176 ----ACTAGGTTT-----GTTTGCTGCTA---CAATGG--TAACATT--- E_europaeus300496 ----ATTAGGTTT-----ATTCTCTGCTA---C-TTGG--TAGCATT--- E_europaeus300509 ----ACTAGGTTT-----GTTCTCTGCTA---CATTGG--TAGCATT--- F_catus300087 CTAGGCTTGCTTT-----CTTTAT-GCTA---CTTTGC--TAGCGTT--- G_gallus300010 ----ATCAGACTC-----TTG---AATTGCTGCGTTGTG-TGGCAG---- G_gorilla300947 ---CACTAGATTT-----TTTTTTATCTGTTACCTTGC--TAGCAA---- G_gorilla301062 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- G_gorilla300363 --TCGCTCGGTTT-----TCTGTCTGCCA---CCTTGC--TAGCGAT--- H_sapiens300747 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- L_africana300490 --------ACTTC-----CCACTAGGTTC---TACCTTGATGGCATT--- L_africana300395 TCCCACTAGGTTT-----TCTCTTTGCGA---CCTTGC--TAGCAGT--- M_mulatta300043 ---CACTAGATTT-----TTT--TATCTGTTACCTTGC--TAGCAA---- M_mulatta300197 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- M_mulatta300407 --TCACTGGGTTT-----TCTGTCTGCCA---CCTTGC--TAGCGAT--- M_mulatta300461 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- M_mulatta300660 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- M_murinus300191 CCCACTTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCACT--- M_murinus300272 TCCCACTAGATTT-----TCTATCTGCTA---CCTTGC--TAGCAAT--- M_murinus300354 CCCACTTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCACT--- M_murinus300011 TCCCGCTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- M_domestica300011 -TCCAACAGG-TT-----TATA--TT-TGCTATCTTAC--TAGCAT---- M_musculus300291 -CCCATTAGGTTTTC-----CATATGCTA---CTTCAC--TAGCAGT--- M_musculus300319 --CCATGAGGTTT-----TTCA--TA-TGCTACT---------------- M_musculus300397 -CCCATGGGGTTTTT-----CCAACACTA---CCTGAC--TAGCAGT--- M_musculus300565 TCCCACTGGGTTT-----CTGC----CTGGTACCTTTC--TAACAAT--- M_musculus300576 --CCATGAGGTTT-----TTCA--TA-TGCTACTTGAC--TAGCAT---- M_musculus300602 -CCCATGAGGTTTTT-----CATATGCTA---CTTGAC--TAGCAGT--- M_musculus300737 --CCATGAGGGTT-----TTCA--TA-TGCTACTTGTC--TAGCAG---- M_musculus300758 --CCATGAGGTTT-----TTCA--TA-TGCTACT---------------- M_musculus300803 --CCATGAGGTTT-----TTCA--TA-GGCTACT---------------- M_musculus300902 --CCATGAGGTTT-----TTCA--TA-TGCTACTTGAC--TAGCAG---- M_musculus300921 --CCATGAGGGTT-----TTCA--TA-TGCTACTTGAC--TAGCAG---- M_musculus300945 --CAATGAGGTTT-----TTCA--TA-TGCTACTTGAC--TAGCAG---- M_musculus300965 -CCCATTAGTTTCTC-----TATATGCTC---CTTGCC--TAGCAGT--- M_musculus300034 --CCATGGAGCTT-----CTCA--TA-GGCTACT---------------- M_musculus300100 ----ATGAGGTTC-----TTCA--T------ATGCTGT--TGGGAA---- M_musculus300112 --CCATGAGGTTT-----TTCA--TA-TGCTACTTGAC--TAGCAG---- M_lucifugus300218 ---CAGTAGGTTT-----TC---CTTCTGCTATGTTGG--TAGCAT---- M_lucifugus300332 --CCACTAGGTTT-----TCTTTCTGCTA---CATTGC--TAGCATT--- M_lucifugus300428 ---CACTAAGTTT-----TTTT-TTTCTGCTATGTTGG--CAGTGT---- M_lucifugus300570 ---CAATAGGTTT-----TTTT-TTTCTGCTATGTTGG--TAGCATAGC- M_lucifugus300805 ---CAATAGGTTT-----TT---TTTCTGCTATGTTGG--TAGCATAGC- M_lucifugus300851 ---CAATAGGTTT-----T----TCTCTGCTATGTTGG--TAGCATAGC- M_lucifugus300038 ---CAATAGGTTT-----TC---TTTATGCTATGTTGG--TAGCATTGCT M_lucifugus300047 ---CAATAGGTTT-----TT---TTTCTGCTATGTTGG--TAGCATAGC- M_lucifugus300050 ---CAACAGGTTT-----TT---TTTCTGCTATGTTGG--TAGCATAGC- O_anatinus304397 -CTCTCTCGGTTT-----TAAA--T--GGCTATATTAT--TAGCAC---- O_cuniculus300031 TCCACTTGGATTT-----CTCT----CTGCTATCTTGC--TAGTAAT--- O_cuniculus300395 TCCCACCAGGCTT-----TCTCT---CTGCTACCTTGC--TAGCAAT--- O_cuniculus300514 ---CACCAGGCTT-----TCTC-----TACTACCTTGA--TAGCAAT--- O_garnettii300010 TCC-ACTAGGTTT-----TCTATCTGCTA---CTCTGC--TAGCACT--- O_garnettii300046 --TCATTAGGTTT-----TCTATCTGCTG---CTTTGC--GAGCA-C--- O_garnettii300069 TCC-ACTAGGTTT-----TCTATCTGCTA---CTCTGC--TAGCACT--- O_garnettii300199 CCC-ACTAGGTTT-----TCTACCTGCTA---CTTTGC--TAGCCCC--- O_garnettii300206 CC--ACTAGGTTT-----TCTATCTGTTA---CTTTGC--TAGCACT--- O_garnettii300285 --CCACTAGGTTT-----TCTA--TC-TGCTACTCTGC--TANNNN---- O_garnettii300305 TCC-ACTAGGTTT-----TCTATCTGCTA---CTTCGT--TGACATT--- O_garnettii300333 CC--ACTAGGTTT-----TCTATCTGTTA---CTTTGC--TAGCACT--- O_garnettii300400 --CTGCTAGGTTT-----TCTATCTGCCA---CCTTGC--TAGCAAT--- O_garnettii300402 TCC-ACTAGGTTT-----TCTATCTGCTA---CTCTGC--TAGCACT--- O_garnettii300407 --C-ACTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCA-C--- O_garnettii300412 TCC-ACTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCACT--- O_garnettii300437 TCC-AGTAGATTT-----TCTATCTGATA---CTTTGC--TAGCACT--- O_garnettii300456 TCC-GATAGGTTT-----TCTATCTTCTAAGACTTTGT--TGGTACT--- O_garnettii300510 --CCACTGGGTTT-----TCTATCTGCTA---TTTTGC--TAGCA-C--- O_garnettii300555 TCC-ACTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCACT--- O_garnettii300645 --CCACTAGGTTT-----TCTATCTGCTA---CTTTGC--TAG---C--- O_garnettii300698 --CCACTAGGTCT-----TCTATCTGCTA---CTTTGC--TAGCA-C--- P_troglodytes300670 --CCAGTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCAAT--- P_troglodytes300130 ---CACTAGATTT-----TTT--TATCTGTTACCTTGC--TAGCAA---- P_troglodytes300203 TCCCACTTGGTTT-----TCTATCTGCTA---CCTTGC--TCTTAGC--- P_troglodytes300363 --TCACTTGGTTT-----TCTGTCTGCCA---CCTTGC--TAGCGAT--- P_pygmaeus300055 ---CACTAGATTT-----TTT--TATCTGTTACGTTGC--TAGCAA---- P_pygmaeus300252 --TCACTTGGTTT-----TCTGTCTGCCA---CCTTGC--TAGCGAT--- P_pygmaeus300295 --CCAGTAGGTTT-----TCTGTCTGCTA---CTTTGC--TAGCAAT--- R_norvegicus300104 --CCATTAGGTTT-----TCCA--CA-TGCTACTTGTC--TAGCAG---- R_norvegicus300114 -CCCATTAGGTTTTC-----CATATGCTA---CTTAAC--TAGCAGT--- R_norvegicus300211 -CTCATTAGGTTTTC-----CATATGCTA---CTTGGA--TAGCAGT--- R_norvegicus300284 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAG--TAGCACT--- R_norvegicus300310 --CCATTAGGTTT-----TCCA--GA-TGCTACTTGTC--TAGCAG---- R_norvegicus300488 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAC--TAGCAGT--- R_norvegicus300511 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAG--TAGCACT--- R_norvegicus300533 --CCATTAGGTTT-----TCCA--TA-TGCTACTTGAC--TAGCAG---- R_norvegicus300537 -TCCATTAGATTTTC-----TTTATGCTA---CTTGAC--TAGCAGT--- R_norvegicus300544 --CCATTAGGTTT-----TCCA--TA-TGCTCCTTGTC--TAGCAG---- R_norvegicus300583 --CCATTAGGTTT-----TCCA--TA-TGCTAATTGAA--TAGTAG---- R_norvegicus300631 -CCTGTTAGGTTTTC-----CATATGCTA---CCTGAC--TAGCAGT--- R_norvegicus300650 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAG--TAGCACT--- R_norvegicus300834 -TCCATTAGATTTTC-----TTTATGCTA---TTTGAC--TAGCACT--- R_norvegicus300862 --CCATTAGGTTT-----TCCA--TA-TGCTACTTGAG--TAGCAC---- R_norvegicus300870 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAG--TAGCACT--- R_norvegicus301102 --CCATTAGGTTT-----TCCA--TA-TGCTACTTGAC--TAGCAG---- R_norvegicus300557 -CCCATTAGGTTTTC-----CATATGCTA---CTTGAG--TAGCACT--- S_araneus300044 -CTCATTAGG-TT-----TGTC--TTCGGCTATTTTGC--TAGAA----- S_araneus300663 --TCTTTAGA-AT-----TTTA--G-----GAGACAAT--TAGAAT---- S_araneus301029 CTGG-----GTTT-----GTCT---TCTA---CCTTGC--TAGCATC--- S_araneus300722 -CTCATTAGGCTT-----TGTC--TTCGGCTATTTTGC--TAGAA----- S_tridecemlineatus300031 ---CACTAGGTTT-----TCT---AACTGCTG-ACTTTC-TAACAA---- S_tridecemlineatus300111 ---CTCTAGGTTT-----TCTATCTGCTA---CTTTGC--TAGCATT--- T_belangeri300179 TCCCACTAGGTTTTCTATCTGCTACATTGTTATGTTGC--TAGAAAT--- C_familiaris300161 ----CAGCCTATTG--GGA-ACATTT--- C_familiaris300469 ----CAGCCTATTG--GGA-ACATTT--- C_porcellus300087 ---TCAACCTGTT---GGGACCATTA--- C_porcellus300142 ---TCAACCTGTT---GGGAACATTA--- C_porcellus300147 ----CAACCTATT---GGGAACATTA--- C_porcellus300163 ----CAGCCTA-TG--GAA-ATATTT--- C_porcellus300168 ---TCAAACTGTT---GGGACCATTA--- D_rerio300214 ---T--TCTTAGG---AACAGTC------ D_novemcinctus300000 ----CAGTCTGTTG--GGA-ACATTC--- D_novemcinctus300037 ----CAGCTTATTG--GGA-ACATTC--- D_novemcinctus300146 ----CAGCCTATTG--GGA-ACATTC--- D_novemcinctus300159 ----CAGCCTATTG--GGG-ATATTT--- D_novemcinctus300248 ----CAGGTTATTG--GGA-ACATTC--- D_novemcinctus300314 ----CAGCCTATTG--GGA-ACATTC--- D_novemcinctus300317 ----CAGCCTGTTATAGGGAACATTC--- D_novemcinctus300393 ----CAGCCTGTTG--GGA-ACATTC--- D_novemcinctus300429 ----CAGCCTGTTG--GGA-ACATTC--- D_novemcinctus300561 ----CAGCCTGTT---GGGAACATTC--- E_telfairi300030 ----CCACCAACTG--GGG-ACACCA--- E_telfairi300042 ----CAACCAATTG--GTG-ACATCA--- E_telfairi300136 ----TAACCGATTG--GGG-ACATTG--- E_telfairi300167 ----TAACCGATT---GGGGACATTG--- E_telfairi300238 ----TAACCGATTG--GGG-ACATTG--- E_telfairi300269 ----CCACCAACTG--GGG-GCACCA--- E_telfairi300311 ----CAACCACCTG--GGT-AGATCA--- E_telfairi300458 ----TCACTAATT---GGGGACATTG--- E_telfairi300537 ----CAACAGATTG--GGG-ACATCG--- E_telfairi300543 ----CAACCAACTG--GGG-TCATCA--- E_telfairi300546 ----CAGTCAATTG--GGG-ACATCA--- E_telfairi300598 ----CAACCGGTTG--AAA-AGAGGT--- E_telfairi300723 ----AAGCCGATTC--GGA-ACATTT--- E_telfairi300776 ----CAGCCAATCG--GGG-ACACCG--- E_caballus300059 ----CAGCCTATT---GGGAACATTT--- E_caballus300151 ----CAGCCTATTG--GGA-ACATTT--- E_europaeus300076 ----CAGTCTTTTG--A-A-ACATTT--- E_europaeus300114 ----CAGCCTTGTG--GGA-ACATCT--- E_europaeus300125 ----CAGCATTGTG--GGA-ACATCT--- E_europaeus300130 ----CAGCCTTGTG--GGA-ACATCT--- E_europaeus300176 ----CATCCTTGTG--GGA-ACATTT--- E_europaeus300496 ----CAGCCTTGTG--GTA-ACATCT--- E_europaeus300509 ----CAGCCTTGTG--GGA-ACATCT--- F_catus300087 ----CAGCCTATTG--GGA-ACATTT--- G_gallus300010 ---TAGGTCTGCT---GGGAATAAAG--- G_gorilla300947 ---GCAGTCTATT---GGGAACATTT--- G_gorilla301062 ----CAGCTTATTG--GGA-ACAGTT--- G_gorilla300363 ----CAGCCCACTG--GGA-ACATTT--- H_sapiens300747 ----CAGCTTATTG--GGA-ACAGTT--- L_africana300490 ----CAACCGTTTG--GGA-ACATTG--- L_africana300395 ----CAACCAGCTG--GGA-ACATTT--- M_mulatta300043 ---GTAGTCTGTT---GGGAACATTT--- M_mulatta300197 ----CCGCTTATTG--GGA-ACAGTT--- M_mulatta300407 ----CAGCCCACTG--GGA-ACATTT--- M_mulatta300461 ----CAGCTTATTG--GGA-ACAGTT--- M_mulatta300660 ----CAGCTTATTG--GGA-ACAGCT--- M_murinus300191 ----CAGCCTAGTG--GGA-ACATTT--- M_murinus300272 ----CAGCCTATTG--GGA-ACATTT--- M_murinus300354 ----CAGCCTAGTG--GGA-ACATTT--- M_murinus300011 ----CAGCCTATTG--AGA-ACATTT--- M_domestica300011 ---CTAACCTGTT---GGGAACAGTT--- M_musculus300291 ----TAACCTGTT---GGGAACATTT--- M_musculus300319 ------ACCGGTT---GGGAACATGA--- M_musculus300397 ----TAACCTGTT---GGGGACATTT--- M_musculus300565 ----TGGCCTATTG--AGA-GCATTC--- M_musculus300576 ---TTAACCTGTT---GGGAACATGT--- M_musculus300602 ----TACCCTGTT---GGGTACATGC--- M_musculus300737 ---TTAACCTGTT---GGGAACATGT--- M_musculus300758 ------ACCTGTT---GGGAACATTT--- M_musculus300803 ------ACCTGTT---GGGAACATTT--- M_musculus300902 ---TTAACCTGTT---GGGAACATTT--- M_musculus300921 ---TTAACCTGTT---GGGAACATGT--- M_musculus300945 ---TTAACCTGTT---GGGAACACGT--- M_musculus300965 ----TAACCTGTT---TGGAATATTG--- M_musculus300034 ------CCCTGTT---GGGAACATTT--- M_musculus300100 -------CATGG----------------- M_musculus300112 ---TTAACCTGTT---GGGAACATTT--- M_lucifugus300218 ---TCAGCCTATT---GGGAACATTT--- M_lucifugus300332 ----CAGACTACTG--GGG-ACATTT--- M_lucifugus300428 ---TCAGCTTATTT--GGGAACATTT--- M_lucifugus300570 AT-TCAGCCTACT---GGGAACATTT--- M_lucifugus300805 AT-TCAGCCTACT---GGGAACATTT--- M_lucifugus300851 AT-TCAGCCTACTT--GGGAACATTT--- M_lucifugus300038 ATGTCTACCTTTT---GGGAATACTT--- M_lucifugus300047 AT-TCAGCCTACT---GGGAACATTT--- M_lucifugus300050 AT-TCAGCCTACT---GGGAACATTT--- O_anatinus304397 ---A--AACCTGG---AGAGACATGC--- O_cuniculus300031 ----TAGCCTATTG--GGA-ACAATT--- O_cuniculus300395 ----CAGCCTACTG--GGA-ACATTT--- O_cuniculus300514 ----CAGCCTTTTG--GGA-ACATTT--- O_garnettii300010 ----CAGCCTAGTG--GAG-ACATTT--- O_garnettii300046 ---TCAGTCTACT---GGGGACATTT--- O_garnettii300069 ----CAGCCTATTG--GAG-ACATTT--- O_garnettii300199 ----CAGCCTGTTG--TGG-GCATTT--- O_garnettii300206 ----CAACCTACTG--GGA-ACATTT--- O_garnettii300285 ---N--NNNNNNN---NNNNNNNNNNNN- O_garnettii300305 ----CAGCTTACTG--GGG-ACATTT--- O_garnettii300333 ----CAACCTACTG--GGA-ACATTT--- O_garnettii300400 ---TCGGTCTATT---GGGAACATTT--- O_garnettii300402 ----CAGCCTATTG--GAG-ACATTT--- O_garnettii300407 ---TCAGCCTACT---GGGGACATTT--- O_garnettii300412 ----CAGCCTACTG--GGG-ACATTT--- O_garnettii300437 ----CAGCCTATTG--GGGGACATTT--- O_garnettii300456 ----CAGCCTCCTG--GTG-ACATTT--- O_garnettii300510 ---TCAGCCTACT---GGGGACATTT--- O_garnettii300555 ----CAGCCTACTG--GGG-ACATTT--- O_garnettii300645 ---TCAGTCTACT---GGGGACATTT--- O_garnettii300698 ---TTGGCCTGCT---GTGAATGTTT--- P_troglodytes300670 ----CAGCTTATTG--GGA-ACAGTT--- P_troglodytes300130 ---GCCGTCTATT---GGGAACATTT--- P_troglodytes300203 ----CAGCCTATTG--GGA-ACATTT--- P_troglodytes300363 ----CAGCCCACTG--GGA-ACATTT--- P_pygmaeus300055 ---GCAGTCTATT---GGGAACATTT--- P_pygmaeus300252 ----CAACCCACTG--GGA-ACATTT--- P_pygmaeus300295 ----CAGCTTATTG--GGA-ACAGCT--- R_norvegicus300104 ---TTAGCCTGTT---GGGAACATTT--- R_norvegicus300114 ----TAACCTGCT---GGGAACATTT--- R_norvegicus300211 ----TAACCTGTT---GGGAACATTT--- R_norvegicus300284 ----TAACCTGTT---GGGAACATTT--- R_norvegicus300310 ---TTAGCCTGTT---GGGAACATTT--- R_norvegicus300488 ----TAACCTGTT---GGGAACATTT--- R_norvegicus300511 ----TAACCTGTT---GGGAACATTT--- R_norvegicus300533 ---TTAACCTGTT---GGGAACATTT--- R_norvegicus300537 ----TAACATGTT---GGGAACATTT--- R_norvegicus300544 ---TTAACCTGTT---GGGAACATTT--- R_norvegicus300583 ---TTAACCTGTT---GGGAACATTT--- R_norvegicus300631 ----TAACCTATT---GGGAACATTT--- R_norvegicus300650 ----TAACCTGTT---GGGAACATTT--- R_norvegicus300834 ----TAACCAGTT---GGGAACATCT--- R_norvegicus300862 ---TTAACCTGTT---GGGAACATTT--- R_norvegicus300870 ----TAACCTGTT---GGGAACACTT--- R_norvegicus301102 ---TTAACATGTT---GGGAACATTT--- R_norvegicus300557 ----TAACCTGTT---GGGAACATTT--- S_araneus300044 ------ACCCATG---AAAATTATT---- S_araneus300663 ---T--GTCTTCT---GCTACCTAATTTT S_araneus301029 ----CGACCAAT-G--GGG-ACATTAT-- S_araneus300722 ------ACCCAGA---AAAATTATTT--- S_tridecemlineatus300031 ---TCAGCCTATT---GGGGACAATT--- S_tridecemlineatus300111 ----CAACCCATTG--GGA-ACATTC--- T_belangeri300179 ----CAGCCTATTG--GGA-ACATTT---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved