snOPY snoRNA Orthological Gene Database

Family: SNORA31

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300367 -CTGCATCCACTGATAGACCTT-GAACAATTGGC-TGTTGT----TCTTT C_porcellus300040 -CTGCATCCACTGACAGACCTT-GAAAAATT----TGTTGT----TCTTT C_porcellus300323 -CTGCATCCACTGATAGACCTT-GAACAATT----TGTTGT----TCTTA C_porcellus300513 -CTGCATCCACTGATAGACCTT-GAACAATT----TGTTGT----TCTTA D_rerio300184 -GGGCATCCACTGATAGGCCTG-TTGCCTTGGTT-TGTGGC----CTC-- D_rerio300185 -TTGCATCAT-TGACAGCTCAG-AGTC--TTGTATTGTGGC-----CACC D_novemcinctus300123 -CTGCATCCACTGATAGACCTT-GAACAAAT----TGTTGT----TCTTT D_novemcinctus300463 -CTGCATCTACTGATAGACCTT-GAACAAATTGT-TGTTCT-------TT E_telfairi300047 -GAGCATCCTCTGATAGACCTG-GGACAATTGAC-TGTTGT----T-TTC E_telfairi300070 ---ACATCCTCTGATAGACCTG-GGACAATTGAC-CATTGT----TCTTC E_telfairi300088 -GAGCATCCTCTGATAGACCTG-GGACAATTGAC-CGTTAT----TCTGC E_telfairi300309 -CAGCATCCTCTGATAGACGTG-GGACAATTGAC-CGTTGT----T---C E_telfairi300459 -GAGCATCCTCTGATAGACCTG-GGACAATTGAC-CATTGT----TCTTC E_telfairi300601 -GAGCATCCTCTGATAGACCTG-AGACAATTGAC-CATTGT----T---C E_telfairi300602 -GAGCATCCTCTGATAGACCTG-GGACAATTGAC-TGTTGT----T-TTC E_telfairi300730 -GAGCATCCTCTGATAGACCTG-GGACAATTGACTCGCTGT----T---C E_telfairi300756 -CAGCATCTACTGATAGACCTG-GGACAATTGAC-TGTTGT----TCCTT E_telfairi300847 -GAGCATCCTATGATAGACCCG-AGACAATTGACCATTGTT-----CTTC E_telfairi300860 -GAGCATCCTCTGATAGACCTG-GGACAATCGAC-CGTTGT----TGTTC E_caballus300062 ACGCATCTATTTGACAGACCTG-GAGCAGTTACT-GTCTGC----TGCTA E_caballus300352 -CTGCATCCACTGATAGACCTT-GAACAATTTGC-TGTTGT----TCCTT E_europaeus300426 -CTGAATCCACTGATAGACCATCGAACAGTTTAC-TGTTGT----TCTTT E_europaeus300512 -CTGCATCCACTGATAGACCTTTGAACAGTTTCC----TGT----TCTT- H_sapiens300600 -CTGCATCCACTGATAGACCTT-GAACAATTTAC-TGTTGT----TCTTT L_africana300375 -CTGCATCCACTGATAGACCTT-GAACAATTTGC-TGTTGT----TCTTT M_mulatta300140 -GTCCATTTAC-ATTTACCTTT-AAGGTTAATAT-TGTTATG---TGTTT M_mulatta300739 -CTGCATCCACTGATAGACCTT-GAACAATTTAC-TGTTGT----TCTTT M_murinus300098 -CTGCATCCACTGATAGACCTT-GAACAATTTGC-TGTTGT----TCTTT M_murinus300111 -CTGTATCTACAGATAGATGGT-GAACAGTTTGC-TGTTGT----GCTTT M_domestica300023 -ATGCATCCACTGATAGACCTT-GAACAAGTTAC-TGTTG-----TTCAC M_musculus300391 -TTGCATGCATTGACAGCCCTT-GACCAGTTTGT-GGTTGT----TCTTC M_musculus300825 -CTGCATCCACTGATAGACCTC-GAACAGTTTGT-GGTTGT----TCTTC O_anatinus303335 -CCGCATCTACTGATAGACCTT-GAACAGTCCTC-CGTTGT----TCTTC O_anatinus304414 -CCGCATCTACTGATAGACCGT-GAACAGTTCTC-CGTTGT----TCTTC O_anatinus304415 CTGCATCTCTTTGACAGGCCTG-GGGCAGTT-CC-ATCTGC----TTTCG O_anatinus304550 -------------ATGCAGCTG-GGGCAGTT-CT-ATCTGC----TTTAA O_cuniculus300127 -TTGTATCCACTGATAGACCTG-GAACAATTAAC-TGTT-------CTTT O_cuniculus300139 GGCCCTTCTGT-ATTACACCTT-GAACAGTTTGT-TGTTGT----TATTT O_cuniculus300146 -CTGCATCCACTGATAGACCTT-GAATAATCTGC-TGTTGT----TCTTT O_cuniculus300257 -TTGCATCCACTGATAGACCTT-GAACAATTTGC-TGTTGT----TCTTT O_cuniculus300269 -CTGCATCCACTGATAGACCTT-GAACAATCTGC-TGTTGT----TCTTT O_cuniculus300382 -CTGCATCCACTGATAGACCTT-GAACAATCTGC-TGTTGT----TCTTT O_cuniculus300477 -CTGCATCTACGGATAGACCTT-GATCAGTTTGC-TGCTGT----TCTTT P_troglodytes300539 -CTGCATCCACTGATAGACCTT-GAACAATTTAC-TGTTGT----TCTTT P_pygmaeus300329 -CTACATCCACTGACAGACCTT-GGACAGTTTGC-TGTTGTTTTTTTTTT P_pygmaeus300715 -CTGCATCCACTGATAGACCTT-GAACAATTTAC-TGTTGT----TCTTT R_norvegicus300130 -CTGCATCCACTGATAGACCTC-GAACAGTTTAT-GGTTGT----TCTTC R_norvegicus300298 -CTACATCCACTGATAGACCTA-GAATGGTTTGT-GGCTGT----TCTTG R_norvegicus300844 -GTGCATACACTGATAGACCTT-GAACAGTTTGT-GGTTGT----TCTTC S_araneus300796 -CTGCATCCACTGATAGACCTT-GAACAAGTTGC-TGTTGT----TCATT S_araneus301076 -CTGCATCCACTGATAGACCTT-GAACAATTTGC-TGTT-------TGTT S_tridecemlineatus300068 -CAGCATCCACTGATAGACCTT-GAACAATTTGC-TGT-GT----TCTTT S_tridecemlineatus300205 -CTGTCTCTGCTGATAGACCTT-GAACAATTTGC-TGTTAT----TCTTT C_familiaris300367 TGGTTTGCACTAGG--ATGCAAGAGAA--AAAAATCCCTGCGCTTTCTGT C_porcellus300040 TGGTTTGCACTAGG--ATGCTAAAGGA--AAAA-TCCCTGTGCTTTCTGT C_porcellus300323 CGGTTTGCACGAGG--ATGCTAAAGGA--AACA-TCCCTGCGCTTTCTGT C_porcellus300513 TGGTTTGCACTAGG--ATGCTAAAGGA--AAAA-TCCCTGCACTTTCTGT D_rerio300184 TGGTTTGCACA-AGG-ATGCAACAGTA--ATAT-TCCTCAATATATCTGT D_rerio300185 TGGGTTTCAATATGTTACGATGCAAAATGAAAGGTCCCTGCGCTTTCTGC D_novemcinctus300123 TGGTTTGCACTAGG--ATGCGAAAGAA--AAGACTCCCTGCGCTTTCTGT D_novemcinctus300463 TGGTTTGCACTAGG--ATGCAGAAGAA--AAAACTCCCTGCACTTTC--- E_telfairi300047 TGGTTTGCACTAGG--ATGCAAAAGAATACAAAATCCCTGCGCTTTCTGC E_telfairi300070 TGGTTTGCACTAGG--ATGAGAAAGAATACAAAATCCCTGTGCTTTCTGC E_telfairi300088 TGGTTTTCACTAGG--AAGCGAGAGAATACAAA-TCCCTGCGTTTTCTGT E_telfairi300309 TGGTTTGCACTAGG--ATGCGAAAGAATAAAAAGTCCCTGCGCCTTCTGT E_telfairi300459 TGGTTTGCACCAGG--ATGCGAGAGAATACAAA-TCCCTGCGCTTTCTGT E_telfairi300601 TGGTTTGCACTAGG--ATGCGAAAGAACAAAAAGTCCCCGTGCTTTCTGT E_telfairi300602 TGGTTTGCACTAGG--ATGCAAAAGAATACAAAATCCCTGCGCTTTCTGC E_telfairi300730 TGGTTTGCACTAGG--ATGTGAAAATATAAAAGGTCCCTGCGCTTTCTGT E_telfairi300756 TGGTTTGCACTAGG--ATGCTAAAGAATAAAAAATCCCCGCACTTTCTGT E_telfairi300847 TGGTTTGCACTAGGATGCGA--AAGATTAAAAAGTCCCTGTGCTTTCTGT E_telfairi300860 TGGTTTGCACTAGG--ATGCGAAAGAATAAAAAGTCCCTGCGCTTTCTGT E_caballus300062 AGGTTTCCACTACAG-ATGCAAGAAAA--AGGTGTCCTCGCGCTTTCTTT E_caballus300352 TGGTTTGCACTAGG--ATGCGAAAGAA--AGAAATCCCTGCGCTTTCTGC E_europaeus300426 -GGTTTGCACTAGG--ATGCAAGAAGA--AAAAA-------AATCCCTGT E_europaeus300512 TGGTTTGCACTAGG--ATGCAAGAGGA--AAAAATCCTTGCGCTTTCTGT H_sapiens300600 TGGTTTGCACTAGG--ATGCAAAAGAA--AGAAATCCCTGCGCTTTCTGT L_africana300375 TGGTTTGCACTAGG--ATGCGAAAGAA--A-AAATCCCTGCGCTTTCTGC M_mulatta300140 TGGTTTGCACTAGG--ATGCAAAAGAA--AAA--TCCCTGCACTTTCTGT M_mulatta300739 TGGTTTGCACTAGG--ATGCAAAAGAA--A--AATCCCTGCGCTTTCTGT M_murinus300098 TGGTTTGCACTAGG--ATGCGAAAGAA--AA-A-TCCCTGCGCTTTCTGT M_murinus300111 TGGTTTGCACTAGG--AGGCAAAAGAA--AAAAATCCCTGTGCTTTCTGT M_domestica300023 TGGTTTGCACT-AGG-GTGCCAAAGAG--AAGT--CCTCCAGCTTTCTGT M_musculus300391 TGGTCTGTACTAGG--ATGCAAAAGAA--AAG-CTCCCTGAGTGTTCTGC M_musculus300825 TGGTTTGCACTAGG--ATGCAAAAGGA--AACTCTCCCTGCGCTTCCTGC O_anatinus303335 CGGTTTGCACGAAG--ATGCGAAAGAA--AGT-CTCCTCCCGTTTCCTGC O_anatinus304414 TGGTTTGCACAATG--ATGCGAAAGAA--CAC-TTCCTCGCACTTTCTGC O_anatinus304415 TGGCTCCCACT-AAG-ATGCAAGAAAA--AA-T-TCCTCGCGCTTTCTGC O_anatinus304550 CGGTTTCCACT-TAG-TTGCAAGAAAA--AACT-TCCTTGTTCTTTCTAC O_cuniculus300127 TGGTTTGCACTAGG--ATGCCAAAGAA--AA-AATCCCTGTACT----GT O_cuniculus300139 TGGTTTGCACCAGG--ATGCTAAAGAA--AAA--TCCCTGTACTTTC--T O_cuniculus300146 TGGTTTGCACTAGG--ATGCCAAAGAA--AA-A-TCCCTGCGCTTTCTGT O_cuniculus300257 TGGTTTGCACTAGG--ATGCCAAAGAA--AC-A-TCTCTGCGCTTTCTGT O_cuniculus300269 TGGTTTGCACTAGG--ATGCCAAAGAA--AA-A-TCCCTGCACTTTCTGT O_cuniculus300382 TGGTTTGCACTAGG--ATGCCAAAGAA--AA-A-TCCCTGCGCTTTCTGT O_cuniculus300477 TGGTTTGCACTAAG--ATGTGGAAGAA--AAA--TCCCTGCACTTTCTTT P_troglodytes300539 TGGTTTGCACTAGG--ATGCAAAAGAA--AGAAATCCCTGCGCTTTCTGT P_pygmaeus300329 TGGTTTGCTCTGGGG-ATGCAAAAGAG--GGAAATCCCGGCACTTCCTGT P_pygmaeus300715 TGGTTTGCACTAGG--ATGCAAAAGAA--AGAAATCCCTGCGCTTTCTGT R_norvegicus300130 TGGTTTGCACTAGG--ATGCAAAAGGA--AACTCTCCCTTCGCTTCCTGC R_norvegicus300298 TTGTCTGCACTAGG--ATGCAGAGGAA--ACCACTCCTGGCGCTTCCTTT R_norvegicus300844 TGGTTTGCATTAGG--ATGCAAAAGGA--AACTCTTCCTGAGCTTCCTGA S_araneus300796 TGGTTTGCACT-AGG-ATGCAAAAGAA--AATAATCCCAGCGCTTTCTGT S_araneus301076 TGATTTGCACT-ATG-ATGCAAAGCAA--AATCATCCCAGTGCTTTCTGT S_tridecemlineatus300068 TGGTTTGCACTAGG--ATGCAAAAGAA--AATAATCCCTGTGCTT----T S_tridecemlineatus300205 TGGTTTGAACTAGA--ATGCAAACAAA--AATACTCCCTTCTCTTTCTGT * C_familiaris300367 CTGTCCC---TGTGGC-AGCCCAGAT-TGAATAGGGGAGTACATCG C_porcellus300040 CTGTCTT---TATGGC-ATCCCAGAT-TGAACTGGGGAGTACACCT C_porcellus300323 CTGTCTT---TATGGC-AGCCCAGAT-TGAATTGGGGAGTACACCC C_porcellus300513 CTGTCTT---TATGGC-AGCCCAGAT-TGAATTGGGGAGTACACCT D_rerio300184 CCATCTGAATGGTGGC-TGGAAAAGTCTAATCTGAGGAGAATAGGA D_rerio300185 TTGCCCCATGAGTGGCATGTA-AGAT-TGAATTTGGGACTACAAAT D_novemcinctus300123 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATAGGGGAATACATAT D_novemcinctus300463 -TGCCTT---TGTGGC-AGCCCAGAT-TGAATAGGGGAATATATAT E_telfairi300047 CTGCCTC---TGTGGCGGGTCCAGTT-TGAATGAGGGATTACACAG E_telfairi300070 CTGTCTT---TGTGGAGGCTTCAAAT-TGAATGAGGGATTACATAG E_telfairi300088 CTGTCTT---TGTGGCGGGTCCAGAT-TGAATGAGGGATTACATAG E_telfairi300309 CTGTCTT---TGTGGTGGATCCAGAT-TGAATGAGCGATTACATAG E_telfairi300459 CTGTCTT---TGTGGCGGGTCCAGAT-TGAATGAGGGATTACATAG E_telfairi300601 CTGTCTT---TGTGGCGGGTCCAGAT-TGAATGAGGGATTACACAG E_telfairi300602 CTGCCTC---TGTGGCGGGTCCAGTT-TGAATGAGGGATTACACAG E_telfairi300730 CTGTCTT---TGTGGCAGGTCCAGAT-GGAATGAGGGATTACACAG E_telfairi300756 CTGTCTT---TGTGGCTGGTCCAGAT-TGAATGGGGGATTACATAC E_telfairi300847 CTGCCTT---TGTGGCGGGTCCAGAT-TGAATGAGGGATTACATAG E_telfairi300860 CTGTCTT---TGTGGCGGGTCCAGAT-TGAATGAGGGATTACATAG E_caballus300062 CTGTCTCAT-TGTGGC-AGCCAAGAT-TGAATGGGGGAATACAGGG E_caballus300352 CTGTCTC---TGTGGC-GGCTCAGAT-TGAATAGGGGAATACATCT E_europaeus300426 CTGTCTT---TGTGGT-GGCCCAGAT-TGAATAAGAGATTACATCT E_europaeus300512 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATAAGGGATTACATCT H_sapiens300600 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATTGGGGAATACATCT L_africana300375 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATGAGGGAATACATCT M_mulatta300140 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGGGGAATACATCT M_mulatta300739 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATTGGGGAATACATCT M_murinus300098 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGTGGAATACATCT M_murinus300111 CTGTCTT---TGTGGT-GGCACAGAT-TGAATTGGTGAATACATCT M_domestica300023 CTGTCT---CTGTGGC-AGCCCAGAT-TGAATAGAGGAATACATTT M_musculus300391 CTGCCTC---TGTGGC--GTTTAGAT-TGAATTGGGATATACATCT M_musculus300825 CTGCCTT---TGTGGC-AGTTCAGAT-TGAATTAGGGAGTACATCT O_anatinus303335 CTGCCTCG--CGTGGC-AGCCCAGAT-TGAATGGGGGAGTACACGT O_anatinus304414 CTGCCTTG--CGTGGC-CGCCCAGAT-TGAATCGGGGAGTACAGCT O_anatinus304415 CTGCTTGATCTGTGGC-AGTCCAGAT-TGAATAGAGGAAGACAAGT O_anatinus304550 CTGCTTGATCTGTGGA-AGTGCAGAT-TAACTAGGGAAAGACAAGT O_cuniculus300127 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGGGGAATACATTT O_cuniculus300139 CTGTCTT---TGTGGC-AACCCAGAC-TGAATTGCGGAATACATTT O_cuniculus300146 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGGGGAATACATTT O_cuniculus300257 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGGGGAATACATTT O_cuniculus300269 CTACCTT---TGTGGC-TGTCCAGAT-TGAATTGGGGAATACATTT O_cuniculus300382 CTGTCTT---TGTGGC-AGCCCAGAT-TGAATTGGGGAATACATTT O_cuniculus300477 CTGTCTT---TGTGGC-AGCTCAGAT-TGAATTTGGGAATACATTT P_troglodytes300539 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATTGGGGAATACATCT P_pygmaeus300329 CTGTCTT---TGTGGC-AGCCTGGAT-TGAATAGGGGAATGCATCT P_pygmaeus300715 CTGTCTT---TGTGGC-GGCCCAGAT-TGAATTGGGGAATACATCT R_norvegicus300130 CTGCCTT---TGTGGC-AGTCCAGAT-TGAATTGGGGAGTACATCT R_norvegicus300298 CTGTCTT---TGTGG----TCCAGAT-TGATGTATAGAGTTAAACT R_norvegicus300844 TTGCCTT---TGTGGC-AGTTCAGAT-TGAATTGTGGTGTACATCT S_araneus300796 CTGCCT---CTGTGGC-AGC-CAGAT-TGAATAGGGGAGAACATTG S_araneus301076 CT-------CTGTGGC-TGC-CAGAT-TGAATAAGGGAGAACATAT S_tridecemlineatus300068 CTGTCTT---TGTAAC-AGTCCAGAT-TGAATTGGGGAACACATCT S_tridecemlineatus300205 CTGTCTT---TGTTGT-GGCACAGAT-TGAATTAGGGAATGATTCT * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved